Em formação

Regulação em plantas com flores cleistogâmicas e casmogâmicas


Na maioria das plantas com flores cleistogâmicas, as flores casmogâmicas também são geradas pelas plantas. Por exemplo, Viola, Oxalis e Commelina contêm ambos os tipos de flores. (Não conheço uma espécie que apresenta apenas flores cleistogâmicas, o que seria muito desfavorável para o sucesso evolutivo)

As flores Cleistogâmicas ajudam na reprodução com o mínimo gasto de energia e recursos. Também maximiza a chance de reprodução, que é um fator importante onde os agentes de polinização são escassos. Por outro lado, as flores chassmogâmicas proporcionam variabilidade, vigor híbrido e geram melhores genótipos por recombinação. Ambas as estratégias são úteis em ambientes diferentes. Em cleistogamia adversa (menos polinizadores, estresse de energia) seria favorável, e em outros casos onde não prevalece estresse de energia, a chsmogamia é vantajosa.

Minha pergunta é, Como podem as plantas, se puderem, regular qual estratégia é apoiada? A proporção de flores cleistogâmicas para casmogâmicas é constante, independentemente do ambiente, ou o ambiente predominante tem uma palavra a dizer na decisão de qual desses dois tipos de flores terá preferência sobre o outro? Em caso afirmativo, qual é o mecanismo regulador subjacente a esse controle de estratégias de floração?

Uma outra questão relacionada é se existem espécies que apresentam apenas flores cleistogâmicas? Isso pareceria muito desfavorável para a evolução agir.


Esta é uma pergunta muito boa, mas acho que o motivo pelo qual não está sendo respondida é porque é em um sentido muito amplo: diferentes grupos de plantas mantêm equilíbrios de flores cleistogâmicas e casmogâmicas e modulam esse equilíbrio por meio de mecanismos diferentes. Muitos desses mecanismos (genes envolvidos, pistas ambientais, vias de desenvolvimento) podem não ser totalmente compreendidos.

Culley e Klooster (2007) categorizam a cleistogamia dependendo do grau em que "o ambiente predominante tem uma palavra":

  • No cleistogamia dimórfica As flores CL e CH diferem na época ou local de produção, com as flores CL produzidas em condições (subterrâneas, baixos níveis de luz, no início da estação) que são potencialmente desfavoráveis ​​para cruzamento.
  • No cleistogamia induzida flores potencialmente CH que passam por condições como seca ou baixas temperaturas não abrem e se autopolinizam, tornando-se, na verdade, flores CL.

Você deve verificar o Culley and Klooster (disponível online se você fizer um login jstor) - eles discutem cleistogamia completa que responde à sua última pergunta. Eles relatam várias espécies completamente CL em sua Tabela 1, e fornecem referências.

Mais geralmente, muitos grupos de plantas diferentes mantêm equilíbrios de autopolinização e cruzamento (ou seja, "sexo real"), por meio de um conjunto de mecanismos ainda mais diverso.

De forma ainda mais geral, muitas plantas e alguns animais mantêm equilíbrios de reprodução sexual e reprodução clonal, por meio de um mesmo mais conjunto diversificado de mecanismos. Por exemplo, a reprodução vegetativa (por exemplo, corredores de morango) é muito comum em muitos grupos de plantas; partenogênese facultativa e obrigatória em animais também ocorre.


Culley, Theresa M. e Matthew R. Klooster (2007). The Cleistogamous Breeding System: Uma revisão de sua frequência, evolução e ecologia em angiospermas. Revisão botânica. Vol. 73, nº 1, pp. 1-30


O genoma de Cleistogenes songorica fornece um modelo para a dissecção funcional da diferenciação de flores dimórficas e adaptabilidade à seca

Cleistogenes songorica (2n = 4x = 40) é uma grama do deserto com um mecanismo de floração dimórfico único e capacidade de sobreviver a secas extremas. Pouco se sabe sobre a genética subjacente à tolerância à seca e sua adaptabilidade reprodutiva. Aqui, sequenciamos e montamos um genoma de C. songorica de nível cromossômico de alta qualidade (contig N50 = 21,28 Mb). Conjuntos completos de todos os telômeros e de dez cromossomos foram derivados. C. songorica passou por uma tetraploidização recente (

19 milhões de anos atrás) e quatro grandes rearranjos cromossômicos. Genes expandidos foram significativamente enriquecidos em alongamento de ácidos graxos, biossíntese de fenilpropanóides, metabolismo de amido e sacarose e vias de ritmo circadiano. Por análise transcriptômica comparativa, descobrimos que genes conservados relacionados à tolerância à seca foram expandidos. A transcrição dos genes CsMYB foi associada ao desenvolvimento diferencial das flores casmogâmicas e cleistogâmicas, bem como à tolerância à seca. Além disso, descobrimos que módulos de regulação abrangendo miRNA, fatores de transcrição e genes alvo estão envolvidos no desenvolvimento de flores dimórficas, validado pela superexpressão de CsAP2_9 e seu miR172 direcionado em arroz. Nossos resultados permitem uma maior compreensão dos mecanismos de tolerância à seca e floração em C. songorica, e fornecem novos insights sobre a adaptabilidade de espécies de gramíneas nativas em evolução, juntamente com recursos potenciais para melhoria de características em espécies agronomicamente importantes.

Palavras-chave: Cleistogenes songorica allotetraploid cleistogamia dimórfica flor tolerância à seca montagem do genoma.

© 2020 os autores. Plant Biotechnology Journal publicado pela Society for Experimental Biology e The Association of Applied Biologists e John Wiley & Sons Ltd.


Análise de todo o genoma do papel da família NAC no desenvolvimento de flores e respostas ao estresse abiótico em Cleistogenes songorica

NAC específico da planta (NAM, ATAF, CUC) A família do fator de transcrição (TF) desempenha papéis importantes nos processos biológicos, como o crescimento da planta e a resposta ao estresse. No entanto, nenhuma informação é conhecida sobre NAC TFs em Cleistogenes songorica, uma erva xerófita proeminente do deserto no noroeste da China. Neste estudo, 162 NAC genes foram encontrados a partir do Cleistogenes songorica genoma, entre os quais 156 C. songoricaNAC (CsNAC) genes (96,3%) foram mapeados em 20 cromossomos. A árvore filogenética construída por CsNAC e arroz NAC TFs pode ser separada em 14 subfamílias. Análises sintênicas e Ka / Ks mostraram que CsNACs foram expandidos principalmente por eventos de replicação em todo o genoma, e a seleção purificadora foi a principal força que impulsionou a evolução de CsNAC genes da família. o CsNAC perfis de expressão gênica mostraram que 36 CsNAC os genes mostraram expressão diferencial entre flores cleistogâmicas (CL) e casmógamas (CH). Cento e dois CsNAC genes mostraram expressão diferencial sob tratamento de calor, frio, seca, sal e ABA. Vinte e três CsNAC os genes foram comumente expressos diferencialmente tanto sob respostas de estresse quanto durante o desenvolvimento do florete dimórfico. A anotação do Gene Ontology (GO), a rede de coexpressão e os testes qRT-PCR revelaram que estes CsNAC genes podem regular simultaneamente o desenvolvimento de florzinha dimórfica e a resposta ao estresse. Nossos resultados podem ajudar a caracterizar os fatores de transcrição NAC em C. songorica e fornecer novos insights sobre a pesquisa funcional e aplicação da família NAC no melhoramento de culturas, especialmente em plantas florzinhas dimórficas.

Palavras-chave: Cleistogenes songorica NAC estresse abiótico cleistogâmico em todo o genoma.

Declaração de conflito de interesse

Os autores declaram não haver conflito de interesses.

Figuras

Árvore filogenética da transcrição de NAC ...

Árvore filogenética de fatores de transcrição NAC (TFs) em C. songorica e arroz. O…

Representações esquemáticas de relações sintéticas ...

Representações esquemáticas de relações sintéticas de NAC membros entre C. songorica e arroz. ...

Distribuições de valores Ks e Ka / Ks ...

Distribuições de valores Ks e Ka / Ks dos membros do NAC em C. songorica e ...

Relações filogenéticas, estrutura do gene e ...

Relações filogenéticas, estrutura do gene e distribuições de domínio conservado putativas da família CsNAC.…

Distribuição do NAC duplicado ...

Distribuição do NAC genes duplicados em C. songorica. As linhas coloridas dentro de ...

Localização cromossômica de C. songorica…

Localização cromossômica de C. songorica NAC genes. O número do cromossomo está acima de cada ...

Perfis de expressão e rede de coexpressão ...

Perfis de expressão e rede de coexpressão de TFs CsNAC durante o desenvolvimento de florzinha dimórfica. (…

Perfis de expressão e rede de coexpressão ...

Perfis de expressão e análise de rede de coexpressão de estresse abiótico associado CsNAC genes. ( uma…

A expressão do selecionado CsNAC…

A expressão do selecionado CsNAC genes sob estresse abiótico em brotos por qRT-PCR.…


Introdução

O gênero Viola (violetas) é distribuída nas regiões temperadas do norte e do sul, bem como nos trópicos e possui alta diversidade com 580 & # x2013620 espécies, extensa alopoliploidia e uma história evolutiva citogenética distinta (Ballard et al., 1998 Marcussen et al., 2012 , 2015, Wahlert et al., 2014). Viola é o maior gênero em Violaceae, uma família com relações moderadamente próximas com as famílias de passiflora (Passifloraceae) e salgueiro (Salicaceae) da ordem Malpighiales (Savolainen et al., 2000 Tokuoka e Hiroshi, 2006). Membros de Viola exibem hibridização frequente, diversas formas de crescimento, estratégias variadas de polinização e dispersão de sementes e sistemas de reprodução variados (Beattie, 1969, 1971 Beattie e Lyons, 1975 Ballard et al., 2011, 2014). As violetas têm sido o quarto grupo de plantas de cama mais popular (amores-perfeitos), por meio de vendas, nos Estados Unidos e no exterior (Altland et al., 2003) e apresentam potencial para biorremediação (Hermann et al., 2013) e desenvolvimento de novos compostos para uso humano (Craik et al., 1999). Viola pubescens (Figura 1) é um perene Viola erva comumente encontrada no sub-bosque das florestas mésicas no leste da América do Norte. Maioria Viola espécies, incluindo V. pubescens, possuem e evolutivamente bem-sucedidos, mas geneticamente não caracterizados, sistemas de reprodução mista de flores casmogâmicas e cleistogâmicas. Enquanto as flores cleistogâmicas têm aparência semelhante a botões (Figura 1A) e seladas mecanicamente ao longo de todo o seu ciclo de vida, resultando em autogamia forçada, as flores casmogâmicas se abrem na maturidade, expondo suas partes florais internas (Figura 1B). As flores casmogâmicas de polinização cruzada têm a vantagem de reprodução sexual entre dois pais díspares, oferecendo progênie geneticamente diversa, redução da depressão por endogamia e remoção de alelos deletérios da população (Ballard et al., 2011). No entanto, a fertilização de flores casmogâmicas depende da disponibilidade de agentes polinizadores, e seu néctar e órgãos florais vistosos requerem grandes quantidades de energia e recursos. Os minúsculos órgãos florais e a falta de néctar nas flores cleistogâmicas tornam-nas menos caras de produzir e têm mais recursos para a produção de sementes, incluindo aumentos no número geral de sementes e / ou sementes maiores com maior viabilidade (Culley e Klooster, 2007). Culley e Klooster (2007) realizaram um levantamento investigando a ocorrência do sistema de reprodução misto chasmogâmico / cleistogâmico, relatando um total de 536 espécies abrangendo 41 famílias de plantas diversas, com a maioria das ocorrências relatadas em Poaceae (gramíneas), Fabaceae (leguminosas), Violaceae (violetas) e Orchidaceae (orquídeas). Ballard et al. (2011) forneceram uma revisão abrangente da literatura sobre este sistema de reprodução mista e destacaram a falta de informações sobre a base genética do sistema. No entanto, a distribuição generalizada do sistema de reprodução misto casmogâmico / cleistogâmico entre as famílias de monocotiledôneas e dicotiledôneas, bem como sua extensa gama geográfica, sugere que o sistema de criação evoluiu muitas vezes através das angiospermas (Ballard et al., 2011). Esta ampla distribuição também implica que o sistema de reprodução mista não é uma estratégia de acasalamento que ocorre aleatoriamente e pode ser selecionado ativamente.

Figura 1. Viola pubescens var. rolamento scabriuscula (UMA) cleistogâmico e (B) flores casmogâmicas. As fotografias foram tiradas em populações nativas localizadas em Sells Park, Athens County, Ohio, 45701 (39 & # x00B020 & # x203240.6 & # x2032 & # x2032N 82 & # x00B004 & # x203231.9 & # x2032 & # x2032W).

Além de ter sistemas de reprodução mista evolutivamente vantajosos, os membros de Violaceae também produzem ciclotídeos. Os ciclotídeos representam a maior família de proteínas circulares e foram classificados como proteínas de defesa de plantas com base em suas propriedades inseticidas (Jennings et al., 2001) e antimicrobianas (Tam et al., 1999), mas também têm propriedades identificadas como anti-HIV (Gustafson et al., 1994), anticâncer (Guzm & # x00E1n-Rodr & # x00EDguez et al., 2015), hemolítico (Tam et al., 1999), citotóxico (Lindholm et al., 2002 Herrmann et al., 2008), inibidor de tripsina (Trabi e Craik, 2002) e uterotônico (Gran, 1973) entre outros (Zhang et al., 2009). Os ciclotídeos são caracterizados por seu motivo de nó de cistina cíclico (CCK) de seis resíduos cys conservados formando uma rede estreita de ligações dissulfeto. Essa estrutura estável torna os ciclotídeos resistentes à proteólise e fortes candidatos para estruturas de design de drogas e aplicações de agroquímicos (Craik et al., 1999 Gruber et al., 2008). Com maior disponibilidade de dados genômicos, em sílico os métodos facilitaram a descoberta de muitas novas sequências de ciclotídeos. A maioria dos ciclotídeos recentemente descobertos está em Violaceae, que especula-se que contenha mais de 30.000 ciclotídeos únicos (Zhang et al., 2015). Embora apenas uma pequena porcentagem de espécies em outras famílias produtoras de ciclotídeos tenham testado positivo para a presença de ciclotídeos, a expressão de ciclotídeos parece ser onipresente em Violaceae, e ciclotídeos foram identificados em todas as espécies investigadas (Burman et al., 2015 G & # x00F6ransson et al. , 2015 Ravipati et al., 2017). Enquanto nove Viola transcriptomas foram sequenciados até o momento (Tabela Suplementar S1), não Viola o genoma foi montado (Matasci et al., 2014). O rascunho V. pubescens o genoma preenche essa lacuna nos dados genômicos e fornece um recurso exclusivo de dados de sequenciamento e expressão gênica. Aqui apresentamos o de novo montagem e anotação do V. pubescens esboço do genoma e seu uso para investigar a expressão gênica específica de tecido e diversidade de ciclotídeos em V. pubescens. Essas análises fornecem informações sobre as disparidades genéticas entre flores casmogâmicas e cleistogâmicas e identificou 81 sequências de ciclotídeos.


Métodos

Materiais vegetais

Cardamine kokaiensis Yahara (Brassicaceae) é uma erva cleistogâmica anual que cresce apenas perto do rio Kokai, Prefeitura de Ibaraki, Japão (36 ° 1′58 ″ N, 140 ° 0′27 ″ E). Esta planta foi descoberta por T. Yahara (Kyushu University, Japão) e será descrita sob o nome desta espécie em outro lugar (Yahara, comunicação pessoal). O nível da água do rio Kokai aumenta do outono ao início do inverno e diminui do meio do inverno à primavera. Assim, as sementes ficam de molho em água e começam a germinar quando o nível da água diminui. Os indivíduos que germinam cedo (ou seja, em janeiro e fevereiro) têm curtos períodos de imersão e longos períodos de crescimento, tornam-se plantas maiores e produzem flores CL e CH. Indivíduos que germinam mais tarde (isto é, em março e abril) têm longos períodos de imersão e curtos períodos de crescimento, tornam-se plantas menores e produzem apenas flores CL. As sementes são provavelmente vernalizadas por imersão. As flores CH têm quatro sépalas, quatro pétalas, dois estames laterais, quatro estames mediais e um pistilo (Fig. S1 em Material Suplementar). Os estames laterais são mais curtos do que os estames mediais. Estas flores, que são morfologicamente semelhantes a A. thaliana flores, têm a capacidade de autopolinização e polinização cruzada. Em contraste, as flores CL não têm pétalas e estames laterais (Fig. Suplementar S1) e são autopolinizadas obrigatoriamente.

Em abril de 2003, C. kokaiensis as plantas foram coletadas no rio Kokai. Depois que as plantas foram autopolinizadas e cultivadas por quatro gerações, sementes de descendência única foram usadas em experimentos. Sementes autopolinizadas de flores CH e CL eram férteis (Morinaga et al. unpubl. dados).

Experimentos arrepiantes

Como a cleistogamia costuma estar relacionada ao tamanho da planta, nos concentramos nas condições ambientais que influenciam as mudanças no tamanho da planta. Cardamina flexuosa é uma espécie intimamente relacionada com C. kokaiensis. O tamanho de C. flexuosa as plantas são afetadas por diferentes tratamentos de resfriamento, o que foi interpretado como um efeito de vernalização (Kudoh et al. 1995 , 1996 ).

Portanto, conduzimos tratamentos de resfriamento para examinar as respostas fenotípicas de características florais e tamanho de planta de C. kokaiensis sob sete condições de crescimento: tratamentos de resfriamento após a germinação por 14, 28 ou 56 dias (0-14, 0-28 e 0-56 tratamentos, respectivamente), tratamentos de resfriamento antes da germinação por 14, 28 ou 56 dias (14- 0, 28-0 e 56-0 tratamentos, respectivamente), e sem resfriamento (controle 0-0).

As plantas foram cultivadas em câmara de crescimento a 22 ° C sob 16 h de luz e 8 h de escuridão. O resfriamento foi realizado a 4 ° C sob 24 h de escuridão. Cinco plantas que germinaram de sementes de um único descendente autopolinizadas por quatro gerações foram usadas para cada experimento. As sementes foram semeadas em meio contendo 0,46% de Murashige e Skoog Plant Salt Mixture (Wako Pure Chemical Industries, Osaka, Japão), 0,1% de solução de vitamina Gamborg 1000 × (Sigma-Aldrich, St. Louis, MO, EUA), 1% de sacarose e 0,8% de ágar. Cada muda foi transplantada para um vaso de 125 mL contendo uma mistura 2: 1 de vermiculita e perlita. As plantas foram regadas e fertilizadas (HYPONeX, Hyponex, Marysville, OH, EUA) a cada 3-4 dias.

A primeira e a décima quinta flores da primeira inflorescência com flor de cada planta foram amostradas. Uma amostra de sépala, pétala, estame lateral, estame medial e pistilo foi coletada aleatoriamente de cada flor, e seu comprimento medido com precisão de 0,1 mm em um estereomicroscópio. O número de dias para o florescimento sem tratamento de resfriamento foi registrado. O peso seco de cada planta foi medido com precisão de 1 mg após secagem em estufa a 60 ° C por 72 h, quando sua décima quinta flor havia aberto. Examinamos as diferenças no comprimento dos órgãos florais, dias para a floração e massa seca da planta entre os tratamentos usando análise de variância unilateral (anova) e post hoc Teste de Tukey. Essas análises estatísticas foram conduzidas usando stat view 5.0 (SAS Institute Inc., Cary, NC, EUA).

Hibridização de DNA genômico e seleção de sonda

Usamos uma estratégia de seleção de sonda baseada em DNA genômico (gDNA) (Hammond et al. 2005) para verificar a qualidade do microarray de espécies cruzadas. Cardamine kokaiensis O gDNA foi hibridizado com um GeneChip A. thaliana Matriz de ATH1 (Affymetrix, Santa Clara, CA, EUA), em que 22.810 conjuntos de sondas foram digitalizados e pelo menos 11 pares de sondas (ou seja, sondas de correspondência perfeita e incompatibilidade) foram alocados para cada conjunto de sondas. Os pares de sondas foram selecionados para análise de expressão gênica com base em C. kokaiensis Limiares de intensidade de hibridização de gDNA variando de 0 (sem seleção de sonda) a 300 de acordo com Hammond et al. (2005) (Apêndice Suplementar S1). Na estratégia de seleção de sonda ideal resultante para análise de expressão gênica de C. kokaiensis, usamos limiares de intensidade de hibridização de gDNA de 50, 75 e 100 (Apêndice Suplementar S1).

Experimentos de microarray entre espécies

Nós investigamos os padrões de expressão gênica entre flores CH, intermediárias (INT) e CL. Três tratamentos de resfriamento foram realizados a 4 ° C no escuro: antes da germinação por 14 dias ou após a germinação por 14 ou 28 dias (tratamentos 14-0, 0-14 e 0-28, respectivamente). As primeiras flores de 14-0, 0-14 e 0-28 plantas produziram flores CH, INT e CL, respectivamente. Realizamos duas replicações biológicas por tratamento. Replicações biológicas foram tecnicamente replicadas uma vez por tratamento. Para cada replicação, o RNA foi extraído de 160 plantas que foram germinadas de sementes de descendentes únicos autopolinizadas por quatro gerações. A primeira inflorescência com primórdios de flor foi coletada de cada planta quando o primeiro botão de flor era visível. Colocamos as 160 inflorescências das 160 plantas em um mesmo microtubo. O RNA total foi extraído de seis amostras (ou seja, duas replicações biológicas de três tratamentos) usando Isogen (Nippon Gene, Tóquio, Japão). A qualidade e a quantidade do RNA total foram verificadas usando um RNA Nano Labchip e 2100 Bioanalyzer (Agilent Technologies, Palo Alto, CA, EUA).

A síntese de cDNA de fita dupla, síntese de cRNA, marcação, hibridização e varredura para matrizes de Affymetrix ATH1 foram realizadas de acordo com as instruções do fabricante & lthttp: //www.affymetrix.com/support/technical/manual/expression_manual.affx>. Os arquivos CEL (CL1, CL2, INT1, INT2, CH1 e CH2.cel, número de acesso GSE9799 em GEO) foram gerados usando um Microarray Analysis Suite. Este experimento foi realizado em dois dias diferentes: o CL1 e o CH1.cel foram gerados em 26 de novembro de 2004 e os outros foram gerados em 22 de março de 2005. Os arquivos CEL foram carregados no pacote de software de análise GeneSpring (Agilent Technologies, EUA) usando o multichip robusto algoritmo de pré-normalização médio (RMA) (Irizarry et al. 2003). Durante o carregamento do arquivo CEL, cálculo de intensidades para cada conjunto de sonda e pré-normalização, os arquivos CEL foram interpretados usando arquivos de dados gerados a partir de limites de intensidade de hibridização de gDNA de 50, 75 e 100 que foram considerados um intervalo ideal para seleção de sonda para análise de expressão gênica com base no experimento de hibridização de gDNA (Apêndice S1). Realizamos a normalização por chip, ou seja, a intensidade de cada conjunto de sondas foi dividida pela intensidade mediana de todos os genes da matriz. Genes com diferentes intensidades de sinal entre flores CL e CH foram analisados ​​com anova unilateral e fold-change usando GeneSpring. Além disso, ao selecionar para valores altos e baixos de genes diferencialmente expressos em flores CL e CH, usamos fold-change estrito para considerar os efeitos do dia do experimento (26 de novembro de 2004 e 22 de março de 2005) na intensidade do sinal. A alteração estrita de dobra foi considerada o valor mais baixo de qualquer razão obtida em ambos os dias.

Reação em cadeia da polimerase de transcrição reversa semiquantitativa (rt-pcr)

O cDNA de fita dupla realizado nos experimentos de microarray de espécies cruzadas também foi usado para RT-PCR semiquantitativo para validar os resultados do microarray. Os primers para RT-PCR de 13 genes diferencialmente e não diferencialmente expressos foram projetados com base em regiões de exon que foram bem conservadas entre A. thaliana e outros organismos usando o Primer 3 & lthttp: //biotools.umassmed.edu/bioapps/primer3_www.cgi>. As identidades dos produtos de PCR amplificados de sete genes foram confirmadas por sequenciamento usando um sequenciador ABI Prism 3130xl (Applied Biosystems, Foster City, CA, EUA). Cardamine kokaiensis ortólogos de A. thaliana DRM1, SPL5, AT4G29190, HSP81-4, NMT1, RD21, e ACTIN2 os genes foram amplificados por conjuntos de primers (Tabela 1). Cada RT-PCR semiquantitativo foi realizado usando um sistema GeneAmp PCR 9700 (Applied Biosystems) e EX Taq HS (TaKaRa, Shiga, Japão) em um volume total de 25 µL contendo 40 ng de cDNA de fita dupla. O programa de PCR consistiu em 1 ciclo a 94 ° C por 5 min seguido por 27 (ACTIN2 gene ortólogo) ou 29 (outros genes) ciclos de 94 ° C por 30 s, 55 ° C por 30 s e 72 ° C por 30 s. Os produtos de PCR não foram saturados nessas condições. Os produtos de PCR foram submetidos à eletroforese em gel de agarose a 1% e detectados por coloração com brometo de etídio. As análises das intensidades de expressão foram realizadas usando o Gel Analyzer em ImageJ & lthttp: //rsb.info.nih.gov/ij/>. A expressão relativa do gene foi calculada como:

Genes ortólogos Primer para frente Primer reverso
DRM1 ACGACTCCAGGATCGGTGA CCGAACAGTAGAATTATTATTACAAGA
SPL5 CACAATGAAAGGAGGAGGAAG CATAAGTCTTTTACATTTGCGGATA
AT4G29190 GCGTTTCAGCTCTCGATTTC GGGTACGGGTCGGATTTTAT
HSP81-4 CCTTGGGTTTGTCAAGGGTA CCTTCCTTGGTTGCAGAGAC
NMT1 CAATGGTCATCGCATCATGT CTCCCGTCACGATCTTGTTT
RD21 AGCATTCCGCTGATCTGACT TGGAATAGAAACGGGGTTCA
ACTIN2 TTGTTGGTAGGCCAAGACATC GGCATGAGGAAGAGAGAGAAACC

Expressão relativa do gene (%) = (expressão do gene objetivo) / (ACTIN2 expressão do gene ortólogo). A expressão relativa do gene no microarray de espécies cruzadas também foi calculada com base no limite de intensidade de hibridização de gDNA de 100.


Regulação em plantas com flores cleistogâmicas e casmogâmicas - Biologia

Você solicitou uma tradução automática de um conteúdo selecionado de nossos bancos de dados. Esta funcionalidade é fornecida exclusivamente para sua conveniência e não tem a intenção de substituir a tradução humana. Nem a BioOne nem os proprietários e editores do conteúdo fazem, e se isentam explicitamente, de quaisquer representações ou garantias expressas ou implícitas de qualquer tipo, incluindo, sem limitação, representações e garantias quanto à funcionalidade do recurso de tradução ou a precisão ou integridade de as traduções.

As traduções não são retidas em nosso sistema. O uso deste recurso e as traduções estão sujeitos a todas as restrições de uso contidas nos Termos e Condições de Uso do site da BioOne.

O papel potencial de dois ortólogos LEAFY no sistema de reprodução misto chasmogâmico / cleistogâmico de Viola pubescens (Violaceae) 1

Yunjing Wang, 1 Harvey E. Ballard, 1 Anne L. Sternberger 1

1 Departamento de Biologia Ambiental e Vegetal, 315 Porter Hall, Ohio University, Athens, OH 45701

Inclui PDF e HTML, quando disponível

Este artigo está disponível apenas para assinantes.
Não está disponível para venda individual.

Muitas plantas, incluindo a maioria das espécies em Viola, produzem flores cleistogâmicas abertas e cruzadas e fechadas e autopolinizantes. O sistema de reprodução misto casmogâmico / cleistogâmico é considerado uma estratégia reprodutiva evolutivamente bem-sucedida, mas a base molecular subjacente permanece amplamente desconhecida. o FRONDOSO (LFY) gene em Arabidopsis é responsável pelo início dos meristemas florais e pela regulação do desenvolvimento floral, portanto, buscamos identificar LFY ortólogos em Viola pubescens Aiton com o objetivo de compreender as possíveis diferenças na genética reguladora do desenvolvimento floral e na genética molecular subjacente aos sistemas de reprodução mistos chasmogâmicos / cleistogâmicos. Uma biblioteca genômica de V. pubescens foi construído para identificar LFY ortólogos e reação em cadeia da polimerase de transcrição reversa foram empregados para estudar a expressão gênica em ambos os tipos de flores. Além disso, estudos de superexpressão dos ortólogos foram realizados em Arabidopsis para explorar seu papel no sistema de reprodução de Viola. Dois LFY ortólogos, VpLFY1 e VpLFY2, foram isolados de uma biblioteca genômica de V. pubescens . Ambos os genes foram expressos em ambos os tipos de flores, especialmente em botões florais jovens. No entanto, a superexpressão de VpLFY2, mas não VpLFY1, causou floração precoce em Arabidopsis, indicando um papel potencialmente único de cada ortólogo. Os resultados sugerem que VpLFY1 e VpLFY2 funcionam juntos no desenvolvimento da flor de V. pubescens . Os diferentes efeitos causados ​​por VpLFY1 e VpLFY2 pol Arabidopsis indicam que os dois ortólogos podem ter propriedades únicas e específicas do gene que podem contribuir para o tipo de flor nas violetas.


Métodos

Materiais vegetais

Os materiais para o estudo de sequenciamento do transcriptoma foram coletados de uma população natural do Monte Lao, localizado próximo ao Mar da China Oriental, na costa sudeste da Península de Shandong, na China (120 ° 36′10 ″ E, 36 ° 06′27 ″ N ) Os botões de flores CH foram coletados em 8 de abril de 2014 (a temperatura média mínima é de 8 ° C, a temperatura máxima média é de 15 ° C e a precipitação média é de 36 mm em abril http://qingdao.tianqi.com/laoshan/). Os botões de flores de CL foram coletados em 26 de maio de 2014 (a temperatura mínima média é de 13 ° C, a temperatura máxima média é de 20 ° C e a precipitação média é de 54 mm em maio http://qingdao.tianqi.com/laoshan/). As inflorescências dicotômicas inteiras CH e CL foram coletadas por volta das 9h-10h, com cada inflorescência incluindo 3-5 botões florais em diferentes estágios de desenvolvimento. O primeiro botão de flor de uma inflorescência dicotômica (a mais antiga) é bem desenvolvido com todos os órgãos florais com cerca de 5 mm de tamanho no botão de flor CH e 3 mm no botão de flor CL. O segundo botão de flor é mais jovem que o primeiro e o terceiro botão de flor é o mais jovem de todos. Na maioria dos casos, existem 1-2 botões de flores quase invisíveis localizados na parte inferior da bráctea. Os botões florais de CH e CL foram coletados frescos, congelados imediatamente em nitrogênio líquido e, em seguida, transportados em gelo seco para um freezer, onde foram armazenados a -80 ° C.

Sequenciamento

Bibliotecas de flores CH e CL foram geradas a partir de botões de flores, e cada amostra de botões de flores consistia em uma mistura de botões de flores de diferentes estágios de desenvolvimento obtidos de 50 indivíduos da mesma. P. heterophylla população. Para cada tipo de flor, o RNA total foi isolado dos botões florais usando Trizol Reagent (Invitrogen) e tratado com DNaseI (Promega) para remover o DNA contaminante residual. A qualidade e integridade do RNA foram determinadas usando um Agilent 2100 Bioanalyzer (Agilent). Duas bibliotecas de RNA-seq (por exemplo, flores CH e flores CL) foram preparadas usando o Kit de preparação de amostra TruSeqRNA Illumina (Illumina) seguindo as instruções do fabricante. Duas bibliotecas de cDNA normalizadas (flores CH, flores CL) foram construídas e sequenciadas usando a plataforma Illumina HiSeq (Shanghai Personal Biotechnology Co. Ltd, China) para gerar leituras brutas emparelhadas de 100 bp.

Montagem e anotação funcional

As leituras limpas foram obtidas removendo as sequências do adaptador, leituras de baixa qualidade e leituras mais curtas (menores que 50 bp). Trinity (http://trinityrnaseq.github.io) foi usado para reunir as leituras de qualidade em contigs e transcrições [71]. A Ferramenta de Pesquisa de Alinhamento Local Básico (BLAST) foi utilizada para pesquisar alinhamentos de sequência (E-value & lt1.00E-5) entre sequências únicas e o NCBI não redundante (http://www.ncbi.nlm.nih.gov/) e Bancos de dados Swiss-Prot (http://www.expasy.ch/sprot). As transcrições de melhor sucesso foram selecionadas como unigenes. Os unigenes com categorias funcionais foram anotados pelo banco de dados Gene Ontology (GO, http://www.geneontology.org) [72], banco de dados Non-supervisioned Orthologous Groups (eggNOG) (http://eggnog.embl.de/) [73], e o banco de dados da Enciclopédia de Genes e Genomas de Kyoto (KEGG, (http://www.genome.jp/kegg/) [74].

Identificação de transcrições expressas diferencialmente

Leituras por quilobase de exon por milhão de leituras mapeadas (RPKM) [75] foram usadas para normalizar a abundância de transcritos com base na eliminação da influência de diferentes comprimentos de genes e discrepâncias de sequenciamento. As transcrições expressas diferencialmente entre as bibliotecas de flores CH e CL foram identificadas usando DEseq [76]. DETs entre duas bibliotecas eram obrigados a ter um valor absoluto de um log2foldchange (log2FC) & gt 2 na expressão, a p-valor de & lt0,001 e um FDR & lt0,05 [77, 78].

Os DETs foram submetidos à análise de enriquecimento de GO e KEGG Orthology (KO) com base em um teste hipergeométrico (ponto de corte: FDR & lt 0,05). O banco de dados KEGG também foi usado para prever as vias nas quais os DETs estavam envolvidos, e a anotação da via foi identificada pelo mapeador KEGG (http://www.genome.jp/kegg/tool/map_pathway2.html).

Identificação de genes envolvidos nos processos de floração

Um total de 599Arabidopsis genes associados a redes de regulação gênica que controlam os processos de floração foram obtidos a partir dos termos GO (GO: 0009908 desenvolvimento da flor, GO: 0009909 regulação do desenvolvimento da flor, GO: 0048439 morfogênese da flor, GO: 0048438 desenvolvimento do verticilo da flor GO: 0048440 desenvolvimento do carpo, GO: 0010093 especificação da identidade do órgão floral, GO: 0048497 manutenção da identidade do órgão floral, etc., http://amigo.geneontology.org/), bem como de Srikanth & amp Schmid [22] e Alvarez-Buylla et al. [24]. As sequências desses genes foram baixadas do Arabidopsis Information Resource (TAIR, http://Arabidopsis.org/). Usamos o Arabidopsis genes envolvidos em processos de floração como sequências de consulta para pesquisar genes homólogos potenciais entre as sequências de transcrição de P. heterophylla por BLAST autônomo (versão 2.2.30+, ftp://ftp.ncbi.nlm.nih.gov/blast/executables/blast+/LATEST/) com um valor E & lt1.00E-10. Todos os resultados com identidades acima de 60% foram considerados genes homólogos em P. heterophylla.

Validação de genes florais por PCR quantitativo em tempo real

Vinte e quatro transcritos relacionados a redes regulatórias de genes de processos de floração identificados na análise de sequenciamento do transcriptoma foram validados e quantificados por PCR quantitativo em tempo real (qRT-PCR). Os primers foram projetados usando o Primer Premier 5 de acordo com os dados de sequenciamento do transcriptoma (arquivo adicional 4). O RNA total foi obtido a partir das réplicas biológicas das amostras utilizadas para o sequenciamento de RNA. O cDNA reverso foi sintetizado usando o PrimeScript Reagent Kit com gDNA Eraser (Takara), e o RT-PCR foi realizado usando um ciclador Eppendorf Master. P. heterophylla β-actina foi usado como um controle interno para normalizar o nível de expressão, e todos os experimentos foram realizados com três repetições. A reação foi realizada em um volume total de 10 μL contendo 5 μL de SYBR Green Master Mix (Takara), 1 μL de mistura de cDNA diluída, 0,5 μL de cada primer (10 mM) e 3 μL de água livre de RNase. As reações foram realizadas em sistema de PCR em tempo real LightCycler480 (Roche) a 95 ° C por 30 s, seguido de 45 ciclos de 95 ° C por 5 se 60 ° C por 30 s. A amplificação e a detecção de apenas um produto de PCR foram confirmadas pela análise da curva de fusão dos produtos de amplificação no final de cada PCR. Após o programa de PCR, o nível de expressão de diferentes genes foi analisado usando o método comparativo de CT (2 - △ △ método de CT) [79].

Disponibilidade de dados de apoio

Os conjuntos de dados de sequência que suportam os resultados deste artigo estão disponíveis no banco de dados Short Read Archive (SRA) no NCBI sob o acesso SRP052597.


2ª PUC Biologia Reprodução Sexual em Plantas com Flores NCERT Livro Texto Perguntas e Respostas

Questão 1.
Cite as partes de uma flor de angiosperma em que ocorre o desenvolvimento do gametófito masculino e feminino.
Responder:
O desenvolvimento do gametófito masculino ocorre a partir de micrósporos ou grãos de pólen que se desenvolvem dentro do microsporângio ou saco polínico de uma antera.
O desenvolvimento do gametófito feminino ocorre no nucelo do óvulo.

Questão 2.
Diferencie entre microsporogênese e megasporogênese. Que tipo de divisão celular ocorre durante esses eventos? Cite a estrutura formada ao final desses dois eventos.
Responder:
O desenvolvimento de micrósporos a partir da célula-mãe dos micrósporos é denominado microsporogênese. O desenvolvimento do megásporo a partir da célula-mãe do megásporo é denominado megasporogênese. Em ambos os desenvolvimentos, a célula-mãe sofre divisão meiótica ou divisão de redução para produzir esporos. No final dessas divisões, micrósporos ou grãos de pólen são produzidos dentro do saco polínico, e megásporos são produzidos dentro do ovário.

Questão 3.
Organize os seguintes termos na sequência de desenvolvimento correta. Grão de pólen, tecido esporógeno, tétrade de micrósporos, célula mãe de pólen, gameta masculino.
Responder:
Tecido esporógeno & # 8211 célula mãe de pólen & # 8211 micrósporo tétrade & # 8211 grãos de pólen & # 8211 gametas masculinos.

Questão 4.
Com um diagrama limpo e rotulado, descreva as partes de um óvulo de angiosperma típico.
Responder:
Um óvulo é um megásporângio feminino onde ocorre a formação de megásporos.


As várias partes de um óvulo são:

  • Um pequeno pedúnculo ou funículo pelo qual o óvulo permanece preso à placenta do ovário.
  • Hilo é o ponto em que se liga ao óvulo. No óvulo invertido, o funículo se funde com o corpo principal do óvulo e é chamado de rafe.
  • O óvulo é cercado em todos os lados por dois tegumentos, mas não no ápice, onde uma abertura chamada micrópila está presente. Essa extremidade do óvulo é chamada de micropilar, enquanto a extremidade oposta a ele é chamada de extremidade calazal.
  • O saco embrionário está situado dentro do nucelo.
  • Em direção à extremidade da micrópila do embriõesac, um ovo ou oósporo e dois sinérgidos são encontrados, e em direção à extremidade da calaza do embriosaco, três células antípodas são encontradas. No centro encontram-se núcleos secundários.

Questão 5.
O que se entende por desenvolvimento monospórico do gametófito feminino?
Responder:
Em muitas plantas com flores, apenas um dos quatro megásporos aumenta e se desenvolve em um gametófito feminino ou saco embrionário. Os outros três megásporos degeneram. Esse tipo de formação de saco embrionário é denominado tipo de desenvolvimento monospórico.

Questão 6.
Com um diagrama bem marcado, explique a natureza de 7 células e 8 nucleados do gametófito feminino.
Responder:

O saco embrionário é uma estrutura multicelular oval. É coberto por uma membrana fina derivada da parede do megásporo-mãe. O tipo de saco embrionário típico ou Polygonum contém 8 núcleos, mas 7 células & # 8211 3 micropilar, 3 calazal e um central. As três células micropilares são conhecidas coletivamente como aparato do ovo.Uma célula é maior e é chamada de ovo ou oosfera. Possui um vacúolo central ou micropilar e um núcleo voltado para a extremidade calazal. As duas células restantes são chamadas de sinérgidas ou células de ajuda.

Cada um deles carrega um aparato filiforme na região micropilar, um gancho lateral, vacúolo calazal e um núcleo central. O ovo ou oosfera representa o único gameta feminino do saco embrionário. As sinérgidas auxiliam na obtenção de nutrição das células nucelares externas, orientam o trajeto do tubo polínico por sua secreção e funcionam como absorvedores de choque durante a penetração do tubo polínico no saco embrionário.

As três células calazais do saco embrionário são chamadas de células antípodas. Eles são as células vegetativas do saco embrionário que podem degenerar em breve ou participar na absorção de nutrientes das células nucelares circundantes. Internamente, eles se conectam com a célula central por meio de plasmodesmos.

A célula central é a maior célula do saco embrionário. Possui citoplasma altamente vacuolado, rico em alimentos de reserva e corpos de Golgi. No meio, a célula contém dois núcleos polares que freqüentemente se fundem para formar um único núcleo diplóide secundário. Assim, todas as células do saco embrionário são haplóides, exceto a célula central que se torna diplóide devido à fusão de núcleos polares.

Questão 7.
O que são flores casmogâmicas? A polinização cruzada pode ocorrer em flores cleistogâmicas? Dê uma razão para sua resposta.
Responder:
As flores chassmogâmicas são o tipo normal de flores, que se assemelham às flores de outras espécies com anteras expostas e estigma, geralmente encontradas na Commelina. Naturalmente, a polinização cruzada não pode ocorrer em flores cleistogâmicas porque geralmente são vistas abaixo da superfície do solo.

Questão 8.
Mencione que duas estratégias evoluíram para prevenir a autopolinização em flores.
Responder:
A autopolinização contínua resulta em depressão por endogamia. Portanto, as plantas com flores desenvolveram os seguintes dispositivos para desencorajar a autopolinização e encorajar a polinização cruzada:

  1. Dicliny (unissexualidade): As flores são unissexuais, de modo que a autopolinização não é possível. As plantas podem ser monóicas (apresentando flores masculinas e femininas, por exemplo, milho) ou dióicas (apresentando flores masculinas e femininas em diferentes plantas, por exemplo, amora, mamão).
  2. Dicogamia: Anteras e estigmas amadurecem em momentos diferentes em uma flor bissexual para prevenir a autopolinização.
  • Protandria & # 8211 Anteras amadurecem antes do estigma da mesma flor. Seus grãos de pólen ficam disponíveis para os estigmas das flores mais antigas,
    por exemplo, girassol, Salvia.
  • Protoginia & # 8211 Os estigmas amadurecem mais cedo para que sejam polinizados antes que as anteras da mesma flor desenvolvam grãos de pólen, por exemplo, Mirabilis jalapa (quatro horas & # 8217clock), Gloriosa, Plantago.

Questão 9.
O que é auto-incompatibilidade? Por que a autopolinização não leva à formação de sementes em espécies auto-incompatíveis?
Responder:
Em algumas flores, os grãos de pólen não germinam no pistilo da mesma flor. Isso é chamado de autoincompatibilidade. Nesses casos, os grãos de pólen não germinam e produzem gametas masculinos e, portanto, a fertilização não ocorre. Portanto, as sementes não são produzidas em flores auto-incompatíveis.

Questão 10.
O que são técnicas de ensacamento? Como é útil em um programa de melhoramento de plantas.
Responder:
Se o pai feminino tiver flores bissexuais, é necessário remover as anteras do botão da flor antes que a antera se deite usando um par de pinças. Esta etapa é conhecida como emasculação. As flores emasculadas devem ser cobertas com um saco de tamanho adequado, geralmente feito de papel manteiga, para evitar a contaminação de seu estigma com pólen indesejado. Este processo é denominado ensacamento. Quando o estigma da flor ensacada atinge a receptividade, grãos de pólen maduros coletados das anteras do pai masculino são pulverizados sobre o estigma e as flores são reenquadradas e os frutos podem se desenvolver. Este processo permite que os melhoristas de plantas usem as variedades desejadas de pólen para obter as sementes desejadas.

Questão 11.
O que é fusão tripla? Onde e como isso ocorre? Cite os núcleos envolvidos na fusão tripla.
Responder:
Um dos gametas masculinos se funde com o núcleo secundário é chamado de fusão tripla. Ocorre no saco embrionário. Após a fertilização normal, ou seja, singamia (fusão do gameta masculino com o ovo), o outro gameta masculino se funde com o núcleo secundário ou núcleo do endosperma. Os núcleos envolvidos na fusão tripla são o núcleo secundário ou núcleo do endosperma. São diplóides

Questão 12.
Por que você acha que o zigoto está adormecido por algum tempo em um óvulo fertilizado?
Responder:
O ovo fertilizado é conhecido como zigoto, que dá origem ao embrião. Antes do desenvolvimento, o zigoto passa por um período de repouso. Isso porque o zigoto aguarda a formação de certa quantidade de endosperma para a nutrição do embrião. Esta é uma adaptação para fornecer nutrição garantida ao embrião em desenvolvimento.

Questão 13.
Diferencie entre
(a) Hipocótilo e epicótilo
(b) Coleoptile e coleorhiza
(c) Tegumento e testa
(d) Perisperma e pericarpo
Responder:
(a) Hipocótilo e epicótilo

Hipocótilo Epicótilo
1. A porção do eixo embrionário que fica abaixo do cotilédone em um embrião dicotiledônea é conhecida como hipocótilo.
2. Termina com a radícula.
1. A porção do eixo embrionário que fica acima do cotilédone em um embrião dicotiledônea é conhecida como epicótilo.
2. Termina com a plúmula.

(b) Coleoptile e coleorhiza

Coleóptilo Coleorhiza
É uma bainha protetora cônica que envolve a plúmula em uma semente de monocotiledônea. É uma bainha indiferenciada que envolve a radícula e a capa da raiz em uma semente de monocotiledônea.

Tegumento Testa
É a cobertura externa de um óvulo. Ele fornece proteção para ele. É a cobertura externa de uma semente.

Perisperma Pericarpo
É o nucelo residual que persiste. Está presente em algumas sementes, como a beterraba. É a parede amadurecida de um fruto, que se desenvolve a partir da parede de um ovário.

Questão 14.
Por que a maçã é chamada de fruta falsa? Qual (is) parte (s) da flor dá forma ao fruto?
Responder:
A maioria das frutas se desenvolve apenas no ovário e são chamadas de frutas verdadeiras. Quando a fruta se desenvolve a partir de outras partes florais além do ovário, é chamada de fruta falsa. A maçã é uma fruta falsa em que o tálamo contribui para a formação do fruto.

Questão 15.
O que se entende por emasculação? Quando e por que um criador de plantas emprega essa técnica?
Responder:
É a remoção das anteras antes da antese da flor bissexual que é usada como mãe feminina. Durante a hibridização, o melhorista de plantas usa essa técnica para evitar a autopolinização.

Questão 16.
Se alguém pode induzir a partenocarpia por meio da aplicação de substâncias de crescimento, quais frutas você selecionaria para induzir a partenocarpia e por quê?
Responder:
Os frutos partenocárpicos são frutos que se desenvolvem sem fertilização e, portanto, não têm sementes. A partenocarpia pode ser induzida pela aplicação de hormônios de crescimento. Frutas importantes como banana, mamão, laranja, uva, goiaba, melancia, etc. podem ser tornadas sem sementes pela aplicação de substâncias de crescimento, pois são frutas economicamente importantes e, se não tiverem sementes, serão mais valiosas.

Questão 17.
Explique o papel do tapete na formação das paredes dos grãos de pólen.
Responder:
Tapetum é a camada mais interna do microsporangium. Fornece nutrição para os grãos de pólen em desenvolvimento. Durante a microsporogênese, as células do tapete produzem várias enzimas, hormônios, aminoácidos e outros materiais nutritivos necessários para o desenvolvimento do grão de pólen. Também produz a camada de exina dos grãos de pólen, que é composta de esporopolenina.

Questão 18.
O que é apomixia e qual a sua importância?
Responder:
O tipo normal de reprodução sexuada com duas características regulares, ou seja, meiose e fertilização, é chamado de anfimixia. Mas, em algumas plantas, essa reprodução sexual normal é substituída por algum tipo anormal de reprodução sexual chamada apomixia.

O termo apomixia foi dado pela primeira vez por Winkler (1908). A apomixia pode ser definida como um tipo anormal de reprodução sexual em que um ovo ou outras células associadas a um ovo (sinérgidas, antípodais, etc.) se desenvolvem em um embrião sem fertilização e com ou sem meiose. Variedades híbridas de várias safras de alimentos e vegetais estão sendo amplamente cultivadas. O cultivo de híbridos aumentou tremendamente a produtividade.

Um dos problemas dos híbridos é que as sementes híbridas precisam ser produzidas todos os anos. Se as sementes coletadas dos híbridos forem semeadas, as plantas da progênie segregarão e não manterão os caracteres híbridos. A produção de sementes híbridas é cara e, portanto, o custo das sementes híbridas torna-se muito caro para os agricultores. Se esses híbridos forem transformados em apomitos, não haverá segregação de caracteres na progênie híbrida. Então, os agricultores podem continuar usando as sementes híbridas para cultivar novas safras ano após ano e não precisam comprar sementes híbridas todos os anos. Embriões formados por apomixia geralmente estão isentos de infecções.

2ª PUC Biologia Reprodução Sexual em Plantas com Flores Perguntas e Respostas Adicionais

2ª PUC Biologia Reprodução Sexual em Plantas com Flores Perguntas Um Marco

Questão 1.
Encontre o diferente
b. Endotécio, Tapetum, Camadas Médias, Nucelo
c. Exina, núcleo tubular, sinérgicas, célula geradora
d. Ovo, Intino, Antípedes, Núcleo Secundário
Responder:
b. Nucellus
c. Sinérgidas
d. Intino

Questão 2.
Cite algumas placas polinizadas pela água.
Responder:

Questão 3.
Algumas flores são altamente modificadas para a polinização por insetos. Eles possuem muitas características que auxiliam neste tipo de polinização.
uma. Como são chamadas essas flores?
b. Explique os caracteres que os tornam adequados para este tipo de polinização.
Responder:
uma. Flores entamófilas
b. Grãos de pólen de cores vivas, perfumadas, nectárias e pegajosas.

Questão 4.
O que é um fruto falso? Dê um exemplo.
Responder:
O fruto é formado por qualquer parte floral da flor, exceto o ovário, por exemplo. maçã, pêra, castanha de caju, etc. [CBSE & # 8211 95]

Questão 5.
As angiospermas produzem estruturas reprodutivas masculinas e femininas nas quais gametófitos e gametas masculinos e femininos são produzidos.
uma. Cite a estrutura reprodutiva masculina e feminina.
b. Cite os gametófitos masculinos e femininos.
Responder:
uma. A estrutura reprodutiva masculina é outra e a estrutura reprodutiva feminina é o pistilo.
b. O gametófito masculino é o grão de pólen maduro e o gametófito feminino é embrionário.

Questão 6.
Quais núcleos se fundem para dar endosperma?
Responder:
Núcleos polares.

Questão 7.
Cite o estágio de ocorrência de mais de um embrião em uma semente.
Responder:
Poliembrionia.

Questão 8.
O termo para os estágios iniciais do desenvolvimento do embrião.
Responder:
Embriogenia

Questão 9.
A formação do núcleo primário do endosperma é chamada de fusão tripla. Por que é chamado assim?
Responder:
O núcleo do endosperma primário é formado pela fusão do núcleo secundário com um gameta masculino e o núcleo secundário é formado pela fusão de dois núcleos polares haplóides. Como três fusões estão ocorrendo na formação do núcleo primário do endosperma, ela é chamada de fusão tripla.

Questão 10.
Defina partenocarpia.
Responder:
São frutos sem sementes que se formam sem polinização e fertilização.

Questão 11.
O que é fertilização?
Responder:
É a fusão de um gameta masculino com o óvulo e um segundo gameta com núcleos polares no angiosperma. [CBSE & # 8211 99]

Questão 12.
Indique a diferença entre o endosperma das gimnospermas e as angiospermas.
Responder:
O endosperma das gimnospermas é gametófito haplóide, mas nas angiospermas é triploide, pois é formado após a fertilização dupla.

Questão 13.
O que é epicótilo?
Responder:
Uma porção de um eixo embrionário entre a plúmula e o cotilédone.

Questão 14.
Defina o termo geitonogamia.
Responder:
Condição em que o pólen de uma flor é depositado no estigma de outra flor carregada na mesma planta.

Questão 15.
Qual é o destino do núcleo secundário após a fertilização?
Responder:
Ele forma os endospermas.

Questão 16.
O que é alogamia?
Responder:
É a transferência de pólen de uma flor para o estigma de outra flor em uma planta separada da mesma espécie.

Questão 17.
O que se desenvolve em uma célula-mãe de micrósporos em uma flor?
Responder:
Células esporógenas.

Questão 18.
O que é coleorrhiza? [CBSE & # 8211 97]
Responder:
É a tampa protetora sobre a raiz do milho.

Questão 19.
O que é escutelo?
Responder:
É o único cotilédone do milho.

Questão 20.
O que é funículo?
Responder:
O pedúnculo do óvulo pelo qual ele está preso à placenta.

2ª PUC Biologia Reprodução Sexual em Plantas com Flores Duas Marcas Perguntas

Questão 1.
Diferencie partenocarpia e partenogênese.
Responder:
Partenocarpia é a formação de frutos sem fertilização, enquanto a partenogênese é a formação de um embrião a partir de um ovo não fertilizado.

Questão 2.
Desenhe um diagrama rotulado do grão de pólen maduro. [CBSE & # 8211 90]
Responder:

Questão 3.
O que é dormência da semente? Dê quaisquer 2 vantagens. [CBSE & # 8211 94]
Responder:
A dormência da semente é a condição da semente quando ela deixa de germinar, embora as condições ambientais sejam favoráveis ​​para o crescimento ativo.
Duas vantagens da dormência:

  • Ajuda a semente a se disseminar no tempo e no espaço de forma a atingir um ambiente cooperativo máximo para a sobrevivência das espécies.
  • Para garantir o sucesso da germinação das sementes nas condições mais favoráveis.

Questão 4.
O que são frutos falsos? Dê um exemplo.
Responder:
Os frutos que se desenvolvem de outras partes além do ovário amadurecido são chamados de frutos falsos.
Ex: frutos de maçã e pêra se desenvolvem a partir do tálamo carnudo. [CBSE & # 8211 95]

Questão 5.
Escreva o significado da fertilização dupla.
Responder:
A fertilização dupla leva ao desenvolvimento de endosperma triploide que fornece nutrição para a semente saudável em desenvolvimento e este endosperma triploide compensa a redução extrema do gametófito feminino em angiospermas.

Questão 6.
Organize os seguintes termos em uma sequência de desenvolvimento correta.
Grão de pólen, tecido esporógeno, micrósporo tétrade, célula mãe de pólen, gametas masculinos.
Responder:
A sequência de desenvolvimento correta para os termos acima é tecido esporógeno, micrósporo tétrade, célula mãe de pólen, grão de pólen, gametas masculinos.

Questão 7.
Escreva a diferença entre coleóptilo e coleorhiza.
Responder:

  • Na semente de monocotiledônea, a região do eixo embrionário abaixo do cotilédone é a radícula coberta por uma bainha protetora é coleorhiza.
  • Acima do ponto de fixação do cotilédone, o eixo embrionário torna-se a plúmula que é envolta por uma cobertura semelhante a uma folha chamada coleóptilo.

2ª PUC Biologia Reprodução Sexual em Plantas com Flores Cinco Marcas de Perguntas

Questão 1.
Descreva o processo de desenvolvimento de um embrião dicotiledônea.
Responder:
O processo de desenvolvimento de um embrião maduro a partir de um zigoto diplóide é denominado embriogênese. Após a fertilização, o zigoto do óvulo se divide transversalmente em duas células & # 8211 uma pequena célula apical e uma grande célula basal. A célula basal situada em direção à micrópila se divide em uma direção em uma fileira de células denominada suspensor. Ele empurra o embrião em desenvolvimento para o endosperma para a absorção de nutrientes.

A célula apical localizada em direção à extremidade antípoda do zigoto sofre duas divisões verticais e uma divisão transversal para formar a massa embrionária. As células da massa embrionária dividem-se repetidamente e as várias partes do embrião são formadas. As células anteriores da massa embrionária formam uma plúmula e dois cotilédones. A parte principal da radícula e do hipocótilo são formados a partir das células da massa embrionária posterior.

Questão 2.
Rastreie os eventos que ocorreriam em uma flor desde o momento em que o grão de pólen da mesma espécie cai no estigma até a conclusão da fertilização.
Responder:

O grão de pólen se desenvolve no estigma estimulado pela secreção do estigma. A intina cresce como uma protuberância por um dos poros do germe. Esta conseqüência continua a crescer como um tubo polínico. O núcleo da célula vegetativa se move para dentro dele, seguido pela célula geradora. A célula geradora se divide em dois gametas masculinos e se move para a ponta do tubo polínico.

O tubo polínico secreta enzimas para digerir os tecidos do estilete e entra no óvulo pela extremidade micropilar e descarrega os dois gametas masculinos em uma das sinergias do saco embrionário. Um dos gametas masculinos se funde com o óvulo para formar um zigoto. Este processo é denominado singamia. O outro gameta masculino se funde com o núcleo secundário para formar o núcleo primário do endosperma.

Este processo é denominado fusão tripla. Como existem duas fusões (singamia e fusão tripla) dentro do óvulo durante a fertilização, isso é conhecido como fertilização dupla.

Questão 3.
Desenhe um diagrama rotulado de um T.S de uma antera dehisced.
Responder:

Questão 4.
A flor da berinjela é chamada de chasmogâmica, enquanto a do feijão é cleistogâmica. Como eles são diferentes uns dos outros?
Responder:

  • Flores Chasmogâmicas: As flores Chasmogâmicas são semelhantes às flores de outras espécies com anteras expostas e estigma.
  • Flores cleistogâmicas: flores cleistogâmicas nunca se abrem para garantir a autopolinização. Eles permanecem fechados para que a polinização cruzada não ocorra.

Três células são agrupadas na extremidade clealazal e são chamadas de antípodas. A grande célula no centro do saco embrionário é a célula central. Posteriormente, 2 núcleos polares na célula central se fundiram para formar um núcleo secundário depolid ou núcleo de endosperma. Assim, o saco embrionário de plantas com flores é 8 nucleado 7 células na maturidade. Este tipo de saco embrionário é denominado monospórico porque é formado por apenas um dos 4 megásporos.


NCERT Exemplar Problemas Classe 12 Biologia Capítulo 2 Reprodução Sexual em Plantas Com Flores

Questões de múltipla escolha
Tipo de resposta correta única
Questão 1. Entre os termos listados abaixo, aqueles que não possuem nomes tecnicamente corretos para um verticilo floral são
eu. Androecium ii. Carpelo
iii. Corolla iv. Sépala
(a) i e iv (b) iii e iv
(c) ii andiv (d) i e ii
Responder. (c)
• Existem 4 verticilos florais viz., Cálice, corola, androceu e gineceu. Cálice e corola são órgãos acessórios ou verticilo não essencial, enquanto androceu e gineceu são órgãos reprodutivos.
• O cálice é o verticilo externo da flor e os membros são chamados de sépalas.
• Gynoecium é a parte reprodutiva feminina da flor e é composta por um ou mais carpelos.

Questão 2. O saco embrionário está para o óvulo assim como para uma antera.
(a) Estame. (b) Filamento
(c) Grão de pólen (d) Androecium
Responder. (c)
• Saco embrionário (gametófito feminino) • Óvulo (megasporângio)
• Grão de pólen (gametófito masculino) • Antera (microsporângio)

Questão 3. Em uma flor completa, bissexual e hipógena típica, o arranjo de espirais florais no tálamo do mais externo ao mais interno é
(a) Cálice, corola, androceu e gineceu
(b) Cálice, corola, gineceu e androceu
(c) Gynoecium, androecium, corolla e cálice
(d) Androécio, gineceu, corola e cálice
Responder. (a) O arranjo de verticilos florais no tálamo, do mais externo para o mais interno, é cálice, corola, androceu e gineceu.

Question.4. Uma planta dicotiledônea dá flores, mas nunca produz frutos e sementes. A causa mais provável para a situação acima é
(a) A planta é dióica e tem apenas flores pistiladas
(b) A planta é dióica e tem flores tanto pistiladas quanto estaminadas
(c) A planta é monóica
(d) A planta é dióica e produz apenas flores estaminadas.
Responder. (d) Uma planta dicotiledônea dá flores, mas nunca produz frutos e sementes porque a planta é dióica e dá apenas flores estaminadas.

Question.5. As camadas de parede mais externa e interna de microsporângio em uma antera são, respectivamente
(a) Endotécio e tapete (b) Epiderme e endoderme
(c) Epiderme e camada média (d) Epiderme e tapete
Responder. (d) As camadas de parede de microsporângio em uma antera são:

Question.6. Durante a microsporogênese, a meiose ocorre em
(a) Endotécio (b) Células-mãe de micrósporos
(c) Tétrades de micrósporos (d) Grãos de pólen
Responder. (b) Durante a microsporogênese, a meiose ocorre nas células-mãe dos micrósporos.

Question.7. Dentre os conjuntos de termos fornecidos a seguir, identifique aqueles que estão associados ao gineceu.
(a) Estigma, óvulo, saco embrionário, placenta
(b) Tálamo, pistilo, estilete, óvulo
(c) Óvulo, ovário, saco embrionário, tapete
(d) Óvulo, estame, ovário, saco qpibryo
Responder. (a) Estigma, óvulo, saco embrionário e placenta estão associados ao gineceu.

Question.8. Começando pela parte mais interna, a sequência correta de partes em um óvulo são
(a) Ovo, nucelo, saco embrionário, tegumento.
(b) Ovo, saco embrionário, nucelo, tegumento.
(c) Saco embrionário, nucelo, tegumento, ovo
(d) Ovo, tegumento, saco embrionário, nucelo
Responder. (b) A sequência correta das partes de um óvulo são

Question.9. A partir das afirmações abaixo, escolha a opção que é verdadeira para um gametófito feminino típico de uma planta com flor.
eu. É 8 nucleado e 7 células na maturidade
ii. É nuclear livre durante o desenvolvimento
iii. Situa-se dentro do tegumento, mas fora do nucelo
4. Possui um aparelho de ovo situado na extremidade calazal
(a) i e iv (b) ii e iii
(c) i e ii (d) ii e iv
Responder. (c) Um gametófito feminino típico de uma planta com flor tem 8 núcleos e 7 células na maturidade e é nuclear livre durante o desenvolvimento.

Questão.10. A autogamia pode ocorrer em uma flor casmogâmica se
(a) O pólen amadurece antes da maturidade do óvulo
(b) Os óvulos amadurecem antes da maturidade do pólen
(c) O pólen e os óvulos amadurecem simultaneamente
(d) Tanto a antera quanto o estigma são de comprimentos iguais
Responder. (c) Em uma flor normal que abre e expõe as anteras e o estigma, a autogamia completa é bastante rara. A autogamia em tais flores requer sincronia na liberação de pólen e receptividade do estigma e também, as anteras e o estigma devem ficar próximos um do outro para que a autopolinização possa ocorrer.

Question.11. Escolha a declaração correta entre as seguintes:
(a) Flores cleistogâmicas sempre exibem autogamia
(b) Flores caipiras sempre exibem geitonogamia
(c) Flores cleistogâmicas exibem autogamia e geitonogamia
(d) Flores chassmogâmicas nunca exibem autogamia
Responder. (a) As flores cleistogâmicas são invariavelmente autógama, pois não há chance de pólen cruzado pousar no estigma. Flores cleistogâmicas produzem sementes garantidas mesmo na ausência de polinizadores.
Por exemplo. das flores cleistogâmicas são Viola (amor-perfeito comum), Oxalis, Commelina, Arachis hypogea e Oryza sativa.

Question.12. Uma determinada espécie de planta produz pólen leve e não pegajoso em grande número e seus estigmas são longos e emplumados. Essas modificações facilitam a polinização por
(a) Insetos (b) Água (c) Vento (d) Animais
Responder. (c) A polinização pelo vento é chamada de anemofilia. As flores anemófilas são pequenas, de forma conspícua, não perfumadas, sem cores vivas, néctar e fragrância. A polinização pelo vento também requer que os grãos de pólen sejam leves e não pegajosos, o que é grande, e seus estigmas são longos e penugentos.

Question.13. Dentre as situações a seguir, escolha aquela que impede tanto a autogamia quanto a geitonogamia.
(a) Planta monóica com flores unissexuais
(b) Planta dióica que apresenta apenas flores masculinas ou femininas
(c) Planta monóica com flores bissexuais
(d) Planta dióica com flores bissexuais
Responder. (b)
• Geitonogamia de autogamia (mesma flor) (flores diferentes da mesma xenogamia (flor de planta diferente)
• Planta dióica com flores masculinas ou femininas que previne tanto a autogamia quanto a geitonogamia.

Question.14. Em um saco embrionário fertilizado, as estruturas haplóides, diplóides e triplóides são
(a) Núcleo sinérgico, zigoto e endosperma primário
(b) Núcleos sinérgicos, antípodais e polares
(c) Núcleo antípodal, sinérgico e endosperma primário
(d) Sinérgico, núcleos polares e zigoto
Responder. (a) Em um saco embrionário fertilizado, as estruturas haplóide, diplóide e triplóide são sinérgicas, zigoto e núcleo endosperma primário, respectivamente.

Question.15. Em um saco embrionário, as células que degeneram após a fertilização são
(a) Sinérgidos e célula endosperma primária
(b) Sinérgidos e antípodais
(c) Antípodais e célula endosperma primária
(d) Ovo e antípodais
Responder. (b) Em um saco embrionário, sinérgidos e antípodais degeneram após a fertilização.

Question.16. Durante o planejamento de um programa de hibridização artificial envolvendo plantas dióicas, qual das etapas a seguir não seria relevante?
(a) Saco de flor feminina
(b) A poeira do pólen no estigma
(c) Emasculação
(d) Coleta de pólen
Responder. (c)
• A hibridização artificial é uma das principais abordagens do programa de melhoramento de safras. Em tais experimentos de cruzamento, é importante certificar-se de que apenas os grãos de pólen desejados sejam usados ​​para a polinização e que o estigma seja protegido de contaminação (de pólen indesejado). Isso é conseguido por meio de técnicas de emasculação e ensacamento.
• A emasculação é relevante em plantas monóicas.

Question.17. Nos embriões de uma típica dicotiledônea e uma grama, verdadeiras estruturas homólogas são
(a) Coleorhiza e coleóptilo
(b) Coleóptilo e escutelo
(c) Cotilédones e escutelo
(d) Hipocótilo e radícula
Responder. (c) Os cotilédones do embrião típico de dicotiledôneas são estruturas simples geralmente espessas e inchadas devido ao armazenamento de reservas de alimentos (como em leguminosas) e o embrião de monocotiledôneas consiste em um cotilédone grande e em forma de escudo conhecido como escutelo situado em direção a um lado (lateral) de o eixo embrionário. Ex: família Grass, Sorghum.

Question.18. O fenômeno observado em algumas plantas em que partes do aparelho sexual são usadas para formar embriões sem fertilização é chamado
(a) Partenocarpia (b) Apomixia
(c) Propagação vegetativa (d) Reprodução sexual
Responder. (b)
• A apomixia é o mecanismo especial para produzir sementes sem fertilização. É observada em poucas plantas com flores, como algumas espécies de asteraceae e gramíneas.
• Apomixis é uma forma de reprodução assexuada que simula a reprodução sexual. Se uma fruta é formada sem fertilização do ovário, ela é chamada de fruta partenocárpica, por exemplo, banana e uva.

Question.19. Em uma flor, se a célula-mãe do megásporo formar megásporos sem sofrer meiose e se um dos megásporos se desenvolver em um saco embrionário, seus núcleos seriam
(a) Haploide
(b) Diploide
(c) Alguns haplóides e alguns diploides
(d) Com ploidia variável
Responder. (b) Em uma flor, se a célula-mãe do megásporo formar megásporos sem sofrer meiose e se um dos megásporos se desenvolver em um saco embrionário, seus núcleos seriam diplóides.

Questão.20. O fenômeno em que o ovário se desenvolve em uma fruta sem fertilização é chamado
(a) Partenocarpia
(b) Apomixia
(c) Reprodução assexuada
(d) Reprodução sexual '
Responder. (a) Se uma fruta é formada sem fertilização de ovaty, ela é chamada de fruta partenocárpica, por exemplo, banana e uva.

Perguntas do tipo resposta muito curta
Questão 1. Nomeie as células componentes do "aparelho do ovo" em um saco embrionário.
Responder. O aparelho de ovo tem três células - uma célula de ovo e duas sinérgidas.

Questão 2. Cite a parte do gineceu que determina a natureza compatível do grão de pólen.
Responder. A natureza compatível do grão de pólen é determinada pelo estigma de carpelo / pistilo.

Questão 3. Cite a função comum que os cotilédones e os nucelos executam.
Responder. Ambos os cotilédones e nucelos fornecem nutrição.

Question.4.Complete o seguinte fluxograma:

Responder.

Pergunta.5. Indica as fases em que ocorrem a meiose e a mitose (1, 2 ou 3) no fluxo?

Responder.

Question.6. No diagrama abaixo, mostre o caminho de um tubo polínico do pólen do estigma até o saco embrionário. Cite os componentes do aparelho de ovo.

Responder. Componentes do aparelho de ovo: uma célula-ovo e duas sinérgidas.

Question.7. Cite as partes do pistilo que se transformam em frutos e sementes.
Responder. O ovo do pistilo se transforma em fruto, enquanto os óvulos se transformam em sementes.

Questão.8. No caso de poliembrionia, se um embrião se desenvolve a partir da sinérgica e outro do nucelo que é haplóide e qual é diplóide?
Responder.O embrião sinérgico é haplóide e o embrião nucelar é diplóide.

Question.9. Um saco embrionário apomítico não fertilizado pode dar origem a um embrião diplóide? Se sim, como?
Responder.Sim, se o embrião se desenvolver a partir das células do nucelo ou tegumento, será diplóide.

Pergunta.10. Quais são as três células encontradas em um grão de pólen quando ele é eliminado no estágio de três células?
Responder.Uma célula vegetativa e dois gametas masculinos.

Question.11.O que é auto-incompatibilidade?
Responder.O dispositivo para prevenir a endogamia é a auto-incompatibilidade ou autoesterlidade. Este é um mecanismo genético e evita que o autopólen (da mesma flor ou de outras flores da mesma planta) fertilize os óvulos ao inibir a germinação do pólen ou o crescimento do tubo polínico no pistilo.

Question.12.Name o tipo de polinização em plantas auto-incompatíveis.
Responder.Xenogamia

Pergunta.13. Desenhe o diagrama de um saco embrionário maduro e mostre sua natureza de 8 nucleados e 7 células. Mostre as seguintes partes: antípodais, sinérgidos, ovo, célula central, núcleos polares.
Responder.

Question.14. Qual é o tecido triploide em um óvulo fertilizado? Como a condição triploide é alcançada?
Responder. O tecido triploide do óvulo é o endosperma. Sua condição triploide é. obtido devido à fusão de dois núcleos polares e um núcleo do gameta masculino (também conhecido como fusão tripla).

Question.15. A polinização e a fertilização são necessárias na apotnixia? Dê razões.
Responder. Não, eles não são necessários. A apomixia é, na verdade, uma alternativa à sexualidade
reprodução embora o aparelho sexual feminino seja usado no processo. Em apomitos, os embriões podem se desenvolver diretamente do nucelo ou sinérgico ou ovo. Portanto, não há necessidade de polinização ou fertilização.

Question.16. Identifique o tipo de carpelo com a ajuda dos diagramas abaixo:

Responder.

Question.17. Como é feita a polinização em plantas aquáticas?
Responder. A polinização pela água é chamada de hidrofilia. Alguns exemplos de plantas polinizadas pela água são Vallisneria e Hydrilla (ambas são angiospérmicas hidrófitas) que crescem em água doce e em várias ervas marinhas marinhas, como a Zostera. Nem todas as plantas aquáticas usam água para a polinização. Na maioria das plantas aquáticas, como o aguapé e o nenúfar, as flores surgem acima do nível da água e são polinizadas por insetos ou pelo vento, como na maioria das plantas terrestres.

Question.18. Qual é a função dos dois gametas masculinos produzidos por cada grão de pólen nas angiospermas?
Responder. Depois de entrar em uma das sinérgidas, o tubo polínico libera os dois gametas masculinos no citoplasma da sinérgica. Um dos gametas masculinos se move em direção à célula-ovo ou oosfera e se funde com seu núcleo, completando assim a singamia. Isso resulta na formação de uma célula diplóide, o zigoto. O outro gameta masculino se move em direção aos dois núcleos polares localizados na célula central e se funde com eles para produzir um núcleo de endosperma primário triploide (PEN).

Perguntas do tipo resposta curta
Questão 1. Liste três estratégias que uma flor chasmogâmica bissexual pode desenvolver para prevenir a autopolinização (autogamia).
Responder. As plantas com flores desenvolveram muitos dispositivos para desencorajar a autopolinização e encorajar a polinização cruzada.
• Primeiro dispositivo: em algumas espécies, a liberação de pólen e a receptividade do estigma não são sincronizadas. Ou o pólen é liberado antes que o estigma se torne receptivo ou o estigma se torna receptivo muito antes da liberação do pólen. Essa condição é chamada de dicogamia, na qual o estigma e a antera amadurecem em épocas diferentes.
• Segundo dispositivo: em algumas espécies, a antera e o estigma são colocados em posições diferentes para que o pólen não entre em contato com o estigma da mesma flor. Essa condição é chamada de heterostilia.
• Hercogamia: Não há transferência de pólen da antera para o estigma da mesma flor devido a uma barreira mecânica entre a antera e o estigma. Ex .: Calotropis (Asclepiadaceae), Aristolochia, Gloriosa superba.
O terceiro dispositivo para prevenir a endogamia é a auto-incompatibilidade ou autoesterilidade. Este é um mecanismo genético e evita que o autopólen (da mesma flor ou de outras flores da mesma planta) fertilize os óvulos ao inibir a germinação do pólen ou o crescimento do tubo polínico no pistilo.

Questão 2. Dada a seguir são os eventos que são observados em um programa de hibridização artificial. Organize-os na ordem sequencial correta em que são seguidos no programa de hibridização.
(a) Re-bagging, (b) Seleção dos pais, (c) Bagging, (d) Espanando o pólen no estigma, (e) Emasculação, (f) Coleta de pólen do pai masculino.
Responder. (b) Seleção dos pais - & gt (e) Emasculação - & gt (c) Ensaque - & gt (f) Coleta de pólen do pai masculino - & gt (d) Espanando o pólen no estigma - & gt (e) Rebatendo.

Questão 3. Vivipary limita automaticamente o número de descendentes em uma ninhada. Como?
Responder. Em animais vivíparos (a maioria dos mamíferos, incluindo seres humanos), o
zigoto se desenvolve em um jovem dentro do corpo do organismo feminino. Após atingir um determinado estágio de crescimento, os filhotes são liberados para fora do corpo do organismo feminino. Vivipary limita automaticamente o número de descendentes em uma ninhada porque as fêmeas têm espaço limitado para o desenvolvimento do embrião.

Question.4. A autoincompatibilidade impõe alguma restrição à autogamia? Dê razões e sugira o método de polinização em tais plantas.
Responder. A auto-incompatibilidade impõe restrições à autogamia. O dispositivo para prevenir a endogamia é a auto-incompatibilidade ou autoesterilidade. Este é um mecanismo genético e evita que o autopólen (da mesma flor ou de outras flores da mesma planta) fertilize os óvulos ao inibir a germinação do pólen ou o crescimento do tubo polínico no pistilo. A auto-incompatibilidade é superada pela polinização mista.

Question.5. No diagrama fornecido, escreva os nomes das peças mostradas com linhas.

Responder.

Question.6. O que é poliembrionia e como pode ser explorada comercialmente?
Responder. Como em muitas variedades de frutas cítricas e de manga, algumas das células nucelares que cercam o saco embrionário começam a se dividir, projetam-se para o saco embrionário e se transformam em embriões. Em tais espécies, cada óvulo contém muitos embriões. A ocorrência de mais de um embrião em uma semente é chamada de poliembrionia.
Se os híbridos forem transformados em apomitos, não haverá segregação de caracteres na progênie híbrida. Então, os agricultores podem continuar usando as sementes híbridas para levantar novas safras ano após ano e ele não precisa comprar sementes híbridas todos os anos.

Question.7. A partenocarpia e a apomixia são fenômenos diferentes? Discuta seus benefícios.
Responder. Sim, eles são diferentes. A partenocarpia leva ao desenvolvimento de frutos sem sementes.
A apomixia leva ao desenvolvimento do embrião.

Question.8. Por que o zigoto começa a se dividir somente após a divisão da célula endosperma primária (PEC)?
Responder. O zigoto precisa de nutrição durante seu desenvolvimento. Como o saco embrionário fertilizado maduro oferece muito pouca nutrição ao zigoto, o PEC se divide e gera o tecido de endosperma que nutre o zigoto. Portanto, o zigoto sempre se divide após a divisão do PEC.

Question.9. A célula geradora de um pólen de duas células se divide no tubo polínico, mas não em um pólen de três células. Dê razões.
Responder. Em um pólen de 3 células, como a célula geradora já foi dividida e formou 2 gametas masculinos, ela não se dividirá novamente no tubo polínico. Mas em um pólen de 2 células, como a célula geradora não se dividiu, ele se divide no tubo polínico.

Questão.10. Na figura abaixo, identifique as seguintes partes: gametas masculinos, óvulo, núcleos polares, sinérgica e tubo polínico

Responder.

Perguntas do tipo resposta longa
Questão 1. Começando com o zigoto, desenhe os diagramas dos diferentes estágios de desenvolvimento do embrião em uma dicotiledônea.
Responder.

Questão 2. Quais são os possíveis tipos de polinização em flores casmogâmicas? Dê razões.
Responder. Uma flor bissexual que normalmente se abre é chamada de flor chasmogâmica.
Tipos de polinização
1. Autogamia: neste tipo, a polinização é realizada dentro da mesma flor. Transferência do pólen da antera para o estigma da mesma flor. Em uma flor normal que abre e expõe as anteras e o estigma, a autogamia completa é bastante rara.
A maioria das plantas com flores produzem flores hermafroditas e os grãos de pólen provavelmente entram em contato com o estigma da mesma flor. A autopolinização contínua resulta em depressão por endogamia. As plantas com flores desenvolveram muitos dispositivos para desencorajar a autopolinização e encorajar a polinização cruzada.
2. Geitonogamia: Transferência de grãos de pólen da antera para o estigma de outra flor da mesma planta.
3. Xenogamia: Transferência de grãos de pólen da antera para o estigma de uma planta diferente.

Questão 3. Com um diagrama limpo e rotulado, descreva as partes de um saco embrionário de angiosperma maduro. Mencione o papel das sinérgidas.
Responder.

Aparelho filiforme presente na parte micropilar das sinérgidas orienta a entrada do tubo polínico.

Question.4. Desenhe o diagrama de um microsporângio e rotule suas camadas de parede. Escreva brevemente sobre o papel do endotécio.
Responder.

A endotécio desempenha a função de proteção e auxilia na deiscência da antera para liberação do pólen.

Question.5. Os sacos embrionários de algumas espécies apomíticas parecem normais, mas contêm células diplóides. Sugira uma explicação adequada para a condição.
Responder. É verdade que muitos apomitos possuem sacos embrionários de aparência normal. A única possibilidade de o saco embrionário possuir células diplóides é devido à falha da divisão meiótica no estágio da célula-mãe do megásporo. Visto que a célula-mãe do megásporo tem um núcleo diplóide, se ela sofrer mitose em vez de meiose, todos os núcleos e células resultantes serão de natureza diplóide.


DISCUSSÃO

Nossos resultados sugerem controle ambiental da fenologia e alocação diferencial de recursos, dependendo da quantidade de pólen recebida no cleistogâmico. R. nudiflora. Sob condições de sombra, a produção de flores CH foi por um período mais curto e a produção de frutos CH terminou mais cedo, enquanto a sombra induziu um início mais precoce à produção de frutos CL. No entanto, o número total de flores CH e todos os frutos (CH e CL) não foram afetados pela sombra. Com relação à alocação de biomassa para sementes, condições subótimas (sombreadas), mas não condições não sombreadas, favoreceram a alocação para sementes CH recebendo suplementação de pólen. Esses resultados sugerem que sob condições subótimas, não apenas os recursos são realocados para produzir estruturas CL mais cedo, mas também as plantas realocam a biomassa principalmente para sementes CH que se desenvolveram a partir de flores CH que recebem cargas de pólen maiores. Assim, o cleistogâmico R. nudiflora responde a condições subótimas com duas estratégias contrastantes: produção antecipada de sementes de CL e maior alocação de biomassa para sementes CH presumivelmente de maior qualidade.

Embora não tenhamos encontrado nenhum efeito de sombra ou rega no número de flores CH, frutos CH e frutos CL, identificamos um efeito de sombra na fenologia de todas essas estruturas, embora em diferentes aspectos. Como resposta à sombra, a produção de flores CH foi encurtada e a produção de frutas CH terminou mais cedo em relação às plantas em subparcelas abertas. Por outro lado, os frutos do CL (e, portanto, as flores do CL) foram produzidos mais cedo em plantas sob condições de sombra do que nas plantas em subparcelas abertas. Em contraste com estudos anteriores relatando que condições subótimas aumentam a produção de flores CL em relação às flores CH (Culley e Klooster, 2007), nossos resultados mostraram que R. nudiflora produz um número semelhante de flores ou frutos CH e CL, independentemente das condições ambientais. Em vez disso, os padrões temporais de produção de flores e frutos CH e CL são influenciados de forma diferente pela disponibilidade de luz. Uma produção anterior de flores CL (e subsequentemente frutos) e um período mais curto de produção de flores CH podem ser vantajosos em condições de sombra, mesmo se o número total de flores ou frutos permanecer constante. Ruellia nudiflora inicia a sua reprodução com flores CL seguida da produção de flores CH, e volta a produzir flores CL no final da estação reprodutiva. Esta sequência não foi afetada pela disponibilidade de água ou luz, portanto, uma produção anterior de flores e frutos CL na verdade representa um início mais precoce da estação reprodutiva. A floração precoce é geralmente correlacionada positivamente com o sucesso reprodutivo nas plantas (Munguía-Rosas et al., 2011) e este pode ser o caso para as nossas espécies de estudo. Por outro lado, um período mais curto de produção de flores CH em condições de sombreamento, mas em quantidade semelhante àquelas em condições mais ótimas, pode favorecer a atração do polinizador e, portanto, o sucesso da polinização, pois apresenta uma maior exibição floral. Nosso estudo também mostrou que R. nudiflora aloca mais recursos para flores que recebem cargas de pólen maiores, e isso pode resultar em uma progênie mais vigorosa e potencialmente mais bem-sucedida em ambientes abaixo do ideal. Este trabalho revela a importância de observar mudanças em escala fina na fenologia de flores e frutos CH e CL usando métodos quantitativos adequados. Até agora, estudos anteriores observando a fenologia de plantas cleistogâmicas focaram apenas na produção total de flores CH e CL ou em padrões temporais qualitativos (por exemplo, Jasieniuk e Lechowicz, 1987 Sigrist e Sazima, 2002 Imaizumi et al., 2008) e não foram capazes de detectar pequenas variações na fenologia em resposta às variáveis ​​ambientais.

Foi sugerido que as plantas cleistogâmicas anuais e perenes diferem em sua fenologia reprodutiva (Oakley et al., 2007). Segundo esses autores, nas anuais as estruturas CL são produzidas primeiro (em alguns casos também no final), seguidas pela produção simultânea de CL e CH. Em contraste, as plantas perenes geralmente produzem sequencialmente estruturas CH e CL em alguns casos, a produção de estruturas CL ocorre após CH, mas nunca antes (Oakley et al., 2007). Ruellia nudiflora não segue o padrão previsto para plantas perenes: invariavelmente, as estruturas CL são produzidas primeiro, independentemente das condições ambientais. Embora alguns estudos anteriores tenham mostrado que a umidade do solo afeta a produção de flores CH e CL (por exemplo, Bell e Quinn, 1987), não identificamos nenhum efeito da irrigação na fenologia ou na alocação de recursos. Nosso experimento foi conduzido em condições de campo e, portanto, existem algumas limitações, como a incapacidade de evitar ou reduzir a chuva natural em subparcelas específicas sem perturbar a disponibilidade de luz. Mesmo assim, sabemos que as subparcelas sem irrigação estiveram em condições subótimas ou estressantes de disponibilidade de água por um período mais longo do que as plantas nas subparcelas irrigadas (Dados Suplementares Fig. S2). No entanto, não podemos descartar completamente a possibilidade de que a fenologia de R. nudiflora pode responder a um déficit hídrico ainda mais forte.

Condições subótimas (sombreadas) afetaram não apenas a fenologia das estruturas reprodutivas em R. nudiflora, mas também padrões de alocação de recursos entre frutas CL e frutas CH de flores que recebem maiores cargas de pólen. Avaliações anteriores sugeriram que, em geral, as estruturas CL têm prioridade sobre as estruturas CH em condições subótimas (por exemplo, Oakley et al., 2007). Sob condições sombreadas R. nudiflora as plantas alocaram recursos mais cedo para produzir flores e frutos do CL; no entanto, o número total dessas estruturas e a biomassa alocada para as sementes do CL não foram afetados pela sombra ou irrigação. Curiosamente, nossos resultados sugerem que, em condições subótimas, as sementes geradas de flores CH que recebem pólen extra também podem ser priorizadas em plantas cleistogâmicas. Sementes de CL, como sugerido anteriormente, podem garantir a reprodução em condições desvantajosas (Campbell et al., 1983 Culley e Klooster, 2007), mas também, sementes CH de boa qualidade podem produzir mudas altamente competitivas em condições abaixo do ideal. Sementes geradas de maiores cargas de pólen não são apenas mais pesadas (Richardson e Stephenson, 1992), mas seu tamanho também está positivamente correlacionado com o desempenho em algumas espécies (Richardson e Stephenson, 1992, Bernard e Toft, 2007), incluindo algumas espécies cleistogâmicas (por exemplo, Trapp e Hendrix, 1988 (Berg e Redbo-Torstensson, 2000). Portanto, um desempenho superior de sementes geradas de flores CH suplementadas com pólen é provável em R. nudiflora. Pesquisas na área de estudo revelaram que R. nudiflora tem alta diversidade genética (78% dos loci polimórficos Ortegón-Campos, 2010) e uma alta taxa de outrossing (tm = 0 · 9 Marrufo, UADY, Mérida, México, não publicado. res.), o que sugere que é o tamanho da carga de pólen e não a origem (ou seja, autofecundada vs. cruzada) que está afetando a alocação preferencial de recursos para flores CH suplementadas com pólen. Possivelmente, as plantas não alocaram mais recursos para flores CH suplementadas com pólen em subparcelas abertas porque essas plantas não têm recursos limitados e, portanto, essas plantas são capazes de alocar recursos para flores CH igualmente, independentemente do tamanho da carga de pólen. É improvável que nossos resultados em termos de alocação de recursos (ou seja, maior alocação para flores CH suplementadas com pólen sob condições sombreadas) seriam um artefato introduzido pela limitação no serviço do polinizador devido ao pano de sombra. Em primeiro lugar, o pano foi colocado a cerca de 1 m do solo, o que permitiu aos visitantes mover-se livremente por baixo do pano, bem como voar sobre subparcelas abertas. Em segundo lugar, não identificamos qualquer efeito da sombra no peso por semente como um único fator, ou seja, todas as flores CH não manipuladas produziram sementes de peso semelhante em subparcelas abertas e sombreadas (Fig. 2). Estudos anteriores documentaram que, quando aplicada a um subconjunto de flores, a suplementação de pólen não é indicativa de limitação de pólen, é útil para avaliar a realocação de recursos (Parra-Tabla et al. Cavaleiro de 1998 et al., 2005, 2006).

Em conclusão, nosso estudo sugere que os padrões temporais na produção de estruturas CH e CL são afetados diferencialmente pela sombra. As estruturas CL são produzidas mais cedo em condições de sombra, enquanto as estruturas CH são produzidas por períodos mais curtos. No entanto, além de uma produção anterior de estruturas CL, R. nudiflora também aloca preferencialmente recursos para aquelas flores CH que recebem maiores cargas de pólen. A produção anterior de sementes CL e sementes CH potencialmente mais vigorosas pode ser uma estratégia mista para enfrentar ambientes imprevisíveis se a produção anterior de estruturas CL e o tamanho das sementes CH estiverem positivamente correlacionados com o sucesso subsequente da muda resultante de cada tipo de semente. Se este for o caso, a progênie de CL pode fornecer garantia reprodutiva barata se as condições ambientais melhorarem. Em vez disso, as sementes CH geradas a partir de grandes cargas de pólen podem ser altamente competitivas se as condições abaixo do ideal persistirem. Desde a R. nudiflora é uma erva daninha invasora no México (Villaseñor e Espinosa-García, 2004 Cervera e Parra-Tabla, 2009), nossos resultados também podem ser úteis para compreender as estratégias reprodutivas que permitem que espécies invasoras colonizem novos habitats (Cheplick, 2006 Imaizumi et al., 2008). Estudos futuros que examinem o efeito do ambiente na alocação de recursos em qualquer planta cleistogâmica também devem considerar que o tamanho da carga de pólen pode produzir padrões diferenciais de alocação em sementes CH. Foi sugerido que a cleistogamia evoluiu como uma resposta à heterogeneidade ambiental (Schoen e Lloyd, 1984), portanto, alocação para flores, alocação para sementes e o desempenho da progênie podem produzir diferentes padrões em condições ótimas e subótimas.


Assista o vídeo: COMO TRASPLANTAR UNA CORONA DE CRISTO. How to transplant a crown of Christ. 2019 (Janeiro 2022).