Em formação

Como pode haver uma correspondência um a um entre RNA e genes?


Pelo que eu sei, várias fitas de DNA formam um gene, então como pode para cada gene haver apenas um RNA correspondente a ele e vice-versa? Meu conhecimento está incorreto?


Muito poucas coisas são tão claras em biologia. Há três coisas principais a serem consideradas aqui.

1. Gene para RNA

A maioria dos genes eucarióticos são combinados. Este é basicamente um processo pelo qual um único gene pode ser transcrito para vários e diferentes mRNAs, cada um dos quais será então traduzido para uma proteína diferente.

Portanto, geralmente (alguns genes não são emendados) não existe uma correspondência um-para-um entre um gene e os mRNAs que ele pode produzir.

2. RNA para gene

O próximo problema é que alguns genes existem em múltiplas cópias semelhantes no genoma. Para tais genes, nem sempre é possível saber qual das duplicatas foi realmente lida para produzir um determinado mRNA.

Portanto, nem sempre há uma correspondência direta um a um entre um mRNA e o gene do qual foi transcrito. Isso, no entanto, é muito menos comum do que o problema de emenda mencionado acima e pode, na maioria dos casos, ser ignorado.

3. Cada gene está apenas em uma única fita

Cada gene está em apenas uma única fita de DNA. Sim, o DNA é de fita dupla, mas cada gene reside em apenas uma das duas fitas (a outra fita será o complemento reverso do gene).


Apesar dos pontos apresentados acima, geralmente é possível mapear uma molécula de mRNA para o gene que a produziu. No caso de genes duplicados, você obterá apenas vários acertos. Os programas que existem para fazer esse tipo de análise podem lidar principalmente com splicing. Então, por exemplo, se você tem a sequência do cromossomo humano 21 e a sequência de mRNA do gene ERG, você pode fazer (em um sistema * nix comexonerarinstalado):

exonerar -m coding2genome -t chr21.fasta -q dscam.fasta> out

Que irá produzir:

Linha de comando: [exonerar -m est2genome -n 1 -t chr21.fasta -q erg.fasta] Nome do host: [orégano] Alinhamento C4: ------------ Consulta: gi | 609878487 | ref | NM_001291391.1 | Homo sapiens ERG, fator de transcrição ETS (ERG), variante 8 da transcrição, mRNA Alvo: gi | 528476536 | ref | NC_018932.2 | Homo sapiens cromossomo 21, montagem alternativa CHM1_1.1, sequência shotgun do genoma inteiro: [revcomp] Modelo: est2genome Pontuação bruta: 7669 Intervalo de consulta: 0 -> 1546 Intervalo de destino: 39594417 -> 39332536 1: GTTTTCACTTGGTCGGAATGGGGAGAGTGTGCAAGCAGATCGAcctG|CTG|ctGcbGAcc: 54GCTG. | | | | | | 39594417: GTTTTCACTTGGTCGGAATGGGGAGAGTGTGCAAGAGATCGCTGCGGGACAGGT: 39594364 55: TCCTAGAGATCGCTCCGGGACGGTCGTGACGGCCCCCGAGGGACATGAGAGAAGGT: 39594364 55: TCCTAGAGATCGCTCCGGGACGGTCGTGACGGCCCCCGAGGGACATGAGAGAGAAGGTM: |||||||||||||||| 39594363: TCCTAGAGATCGCTCCGGGACGGTCGTGACGGCCCCCGAGGGACATGAGAGAAG: 39594310 109: AGGAGCGGCGCTCAG >>>> Target Intron 1 >>>> GTTATTCCAG: 133 |||||||||||||p| ||| 39594309: AGGAGCGGCGCTCAGgt… agGTTATTCCAG: 39517600 134: GATCTTTGGAGACCCGAGGAAAGCCGTGTTGACCAAAAGCAAGACAAATGACTC: 187 | |||||||||||||||||| 39517599: GATCTTTGGAGACCCGAGGAAAGCCGTGTTGACCAAAAGCAAGACAAATGACTC: 39517546 188: ACAGAGAAAAAAGATGGCAGAACCAAGGGCAACTAAAG >>>> Alvo em: 226|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||. |||| ++ 9093 39517545: ACAGAGAAAAAAGATGGCAGAACCAAGGGCAACTAAAGgt…: 39517505 227: tron ​​2 >>>> CCGTCAGGTTCTGAACAGCTGGTAGATGGGCTGGCTTACTG: 266bp||||||||| ||||||||||||||||||||| 39517504:… agCCGTCAGGTTCTGAACAGCTGGTAGATGGGCTGGCTTACTG: 39508374 267: AAGGACATGATTCAGACTGTCCCGGACCCAGCAGCTCATATCAAG >>>> Ta: 312 | |||||||||||| ++ 39508373: AAGGACATGATTCAGACTGTCCCGGACCCAGCAGCTCATATCAAGgt…: 39508326 313: rget Intron 3 >>>> GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGT: 34503||| |||||||||||||||||||||| 39508325:… agGAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGT: 39377955 346: TGTTTGAGTGTGCCTACGGAACGCCACACCTGGCTAAGACAGAGATGACCGCGT: 399 ||||||||||||||||||||||||||||||||||||||||||||||||||||||. ||||||||||||||||| 39377954: TGTTTGAGTGTGCCTACGGAACGCCACACCTGGCTAAGACAGAGATGACCGCGT: 39377901 400: CCTCCTCCAGCGACTATGGACAGACTTCCAAGATGAGCCCACGCGTCCCTCAGC: 453 |||||||||||||||||||||||||||||||||||||||| |||||||||||||||| 39377900: CCTCCTCCAGCGACTATGGACAGACTTCCAAGATGAGCCCACGCGTCCCTCAGC: 39377847 454: AGGATTGGCTGTCTCAACCCCCCCAGCCAGGGTCACCATCAAAATGGAATGTAACCATCAAAATGGAATGTAACCATCAAAT|||||||||||||||||||||||||||| | |||||||||||||||| 39377846: AGGATTGGCTGTCTCAACCCCCAGCCAGGGTCACCATCAAAATGGAATGTAACC: 39377793 508: CTAGCCAGGTGAATGGCTCAAG >>>> Target Intron 4 >>>> GAA: 532 |||||pc ||| 39377792: CTAGCCAGGTGAATGGCTCAAGgt… agGAA: 39356027 533: CTCTCCTGATGAATGCAGTGTGGCCAAAGGCGGGAAGATGGTGGGCAGCCCAGA: 586 |||||||||| | |||||||||||||||||| 39356026: CTCTCCTGATGAATGCAGTGTGGCCAAAGGCGGGAAGATGGTGGGCAGCCCAGA: 39355973 587: CACCGTTGGGATGAACTACGGCAGCTACATGGGAGGAGAAGCACATGCCACCCAGA: 39355973 587: CACCGTTGGGATGAACTACGGCAG. |||||||||||||||| 39355972: CACCGTTGGGATGAACTACGGCAGCTACATGGAGGAGAAGCACATGCCACCCCC: 39355919 641: AAACATGACCACGAACGAGCGCAGAGTTATCGTGCCAGCAGCACATGCCACCCCC: 39355919 641: AAACATGACCACGAACGAGCGCAGAGTTATCGTGCCAGCAG >>>> Alvo: 682||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||. ||||||| ++ 19 39355918: AAACATGACCACGAACGAGCGCAGAGTTATCGTGCCAGCAGgt…: 39355875 683: Intron 5 >>>> ATCCTACGCTATGGAGTACAGACCATGTGCGGCAGTGG: 7|19|||||| ||||||||||||||||||||| 39355874:… agATCCTACGCTATGGAGTACAGACCATGTGCGGCAGTGG: 39336142 720: CTGGAGTGGGCGGTGAAAGAATATGGCCTTCCAGACGTCAACATCTTGTTATTC: 773 ||||||||||| | ||||||||||||||||| 39336141: CTGGAGTGGGCGGTGAAAGAATATGGCCTTCCAGACGTCAACATCTTGTTATTC: 39336088 774: CAGAACATCGATGGGAAGGAACTGTGCAAGATGACCAAGGACGACTTCCAGAGG: 39336088 774: CAGAACATCGATGGGAAGGAACTGTGCAAGATGACCAAGGACGACTTCCAGAGGG: 39336088 774: CAGAACATCGATGGGAAGGAACTGTGCAAGATGACCAAGGACGACTTCCAGAGGG: 39336088 774: CAGAACATCGATGGGAAGGAACTGTGCAAGATGACCAAGGACGACTTCCAGAGGG: 8 | |||||||||||||||| 39336087: CAGAACATCGATGGGAAGGAACTGTGCAAGATGACCAAGGACGACTTCCAGAGG: 39336034 828: CTCACCCCCAGCTACAACGCCGACATCCTTCTCTCACATCTCCACTACCTCAGA: 881|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||. |||||||||||||||| 39336033: CTCACCCCCAGCTACAACGCCGACATCCTTCTCTCACATCTCCACTACCTCAGA: 39335980 882: GAGA >>>> Alvo Intron 6 >>>> CTCCTCTTCCACATTTGACTT: 906 |||| ++ 867 bp |||||||||||| ||| 39335979: GAGAgt… agCTCCTCTTCCACATTTGACTT: 39335088 907: CAGATGATGTTGATAAAGCCTTACAAAACTCTCCACGGTTAATGCATGCTAGAA: 960 | |||||||||||||||||| 39335087: CAGATGATGTTGATAAAGCCTTACAAAACTCTCCACGGTTAATGCATGCTAGAA: 39335034 961: ACACAG >>>> Alvo Intron 7 >>>> GGGGTGCAGCTTTTATTTTT: 985 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| buscá ||| 39335033: ACACAGgt ... agGGGGTGCAGCTTTTATTTT: 39333098 986: CCCAAATACTTCAGTATATCCTGAAGCTACGCAAAGAATTACAACTAGGCCAGG: 1039 |||||||||||||||||||||||||||||||||||||| |||||||||||||||||| 39333097: CCCAAATACTTCAGTATATCCTGAAGCTACGCAAAGAATTACAACTAGGCCAGG: 39333044 1040: TACGAAAACACACCCCTGTGTGATCTCTCTTCATTGAGAGACATCCCAGATGTCCTGC: 1093 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||. |||||||||||||||| 39333043: TACGAAAACACCCCTGTGTGATCTCTTCATTGAGAGACATCCCAGATGTCCTGC: 39332990 1094: TGAGATCCGTGCCCTAAGTCACGTGATACAAAGAGAGCTGATCCCGGAGAGCTGAA: 1147|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||. |||||||||||||||| 39332989: TGAGATCCGTGCCCTAAGTCACGTGATACAAAGAGAGCTGATCCCGGAGCTGAA: 39332936 1148: GCCAGTCCCAGACAGTCTTATTCTGCCTCTCTGTTGATTTGGAGACTAAATCCACT: 1201|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||. |||||||||||||||| 39332935: GCCAGTCCCAGACAGTCTTATTCTGCCTCTGTTGATTTGGAGACTAAATCCACT: 39332882 1202: CAAACCATTTCATTCAAAGACCACACACTAAAGGAATTAAGAGCAGATTAGCCCTTTGGGAGACTAAATCCACT: 39332882 1202: CAAACCATTTCATTCAAAGACCACACACTAAAGGAATTAAGAGCAGATTAGACCCTT. |||||||||||||||| 39332881: CAAACCATTTCATTCAAAGACCACACTAAAGGAATTAAGAGCAGATTAGCCCTT: 39332828 1256: TAACTAGCTTTTCAGAAAGACAGATGGGCAAAGAAGGCATCCTGGATGCCTGGC: 1309 | |||||||||||||||| 39332827: TAACTAGCTTTTCAGAAAGACAGATGGGCAAAGAAGGCATCCTGGATGCCTGGC: 39332774 1310: AGTTAGGAATAGGCCGACTTTTGAACTAACAGAAGGATCTGTCCCTCCTCGGGGGC: 39332774 1310: AGTTAGGAATAGGCCGACTTTTGAACTAACAGAAGGATCTGTCCCTCCTCGGGGG: 1310: AGTTAGGAATAGGCCGACTTTTGAACTAACAGAAGGATCTGTCCCTCCTCGGGGG: 1310 | |||||||||||||||| 39332773: AGTTAGGAATAGGCCGACTTTTGAACTAACAGAAGGATCTGTCCCTCCTCGGGG: 39332720 1364: GAAGAGCACAAAACAAGGACACTCCCCAGATTCACAGTGACCGATTATCAGTAT: 1417 |||||||||||||||||||||||||||||||||||||||| |||||||||||||||| 39332719: GAAGAGCACAAAACAAGGACACTCCCCAGATTCACAGTGACCGATTATCAGTAT: 39332666 1418: GTCACAAGAAGCCAGTCTTGCAGAGCAGAAGCATGCAACCAGTAGTATTTACAT: 39332666 1418: GTCACAAGAAGCCAGTCTTGCAGAGCAGAAGCATGCAACCAGTAGTATTTACAT: 1471 | |||||||||||||||| 39332665: GTCACAAGAAGCCAGTCTTGCAGAGCAGAAGCATGCAACCAGTAGTATTTACAT: 39332612 1472: CTGAATCTTACTGCCTGTCCTCCAAATGATTTAATTAGGTAATAAATTTACATG: 39332612 1472: CTGAATCTTACTGCCTGTCCTCCAAATGATTTAATTAGGTAATAAATTTACATG | |||||||||||||||| 39332611: CTGAATCTTACTGCCTGTCCTCCAAATGATTTAATTAGGTAATAAATTTACATG: 39332558 1526: CCATTCATGCAAAAAAAAAAA: 1546 |||||||||||||||| ||| | 39332557: CCATTCATGCAAAAATAAACA: 39332537 vulgar: gi | 609878487 | ref | NM_001291391.1 | 0 1546 + gi | 528476536 | ref | NC_018932.2 | 39594417 39332536 - 7669 M 123 123 5 0 2 I 0 76681 3 0 2 M 102 102 5 0 2 I 0 9089 3 0 2 M 86 86 5 0 2 I 0 130336 3 0 2 M 218 218 5 0 2 I 0 21737 3 0 2 M 152 152 5 0 2 I 0 19694 3 0 2 M 204 204 5 0 2 I 0 863 3 0 2 M 81 81 5 0 2 I 0 1907 3 0 2 M 580 580 - análise de exoneração concluída

Alternativamente, você pode usar um recurso online como a página BLAT do UCSC para alinhar o mRNA contra o genoma. Você pode ver os resultados aqui e na imagem abaixo:

Como você pode ver, nossa sequência de mRNA de consulta (NM_001291391.1) se sobrepõe perfeitamente ao gene ERC.


Não há correspondência um a um entre o RNA e os genes, mas não tanto pelo motivo que você parece ter em mente (embora eu não tenha certeza do que você tem em mente).

Você deve ler o artigo da Wikipedia sobre splicing de RNA, ele vai te ensinar muito do que você precisa para obter a resposta que você pode estar procurando.

Você também pode querer seguir um curso introdutório, como a série DNA para RNA para proteína da Khan Academy.


Câncer: como um tipo de RNA pode ser o futuro do tratamento

Alguns longos RNAs não codificantes facilitam a multiplicação das células cancerosas. Crédito: nobeastsofierce / Shutterstock

As células são os blocos básicos de construção de todos os seres vivos. Portanto, para tratar ou curar quase qualquer doença ou condição - incluindo o câncer - você primeiro precisa ter uma compreensão fundamental da biologia celular.

Embora os pesquisadores tenham um bom entendimento do que cada componente de uma célula faz, ainda existem coisas que não sabemos sobre eles - incluindo o papel que algumas moléculas de RNA desempenham em uma célula. Encontrar a resposta para isso pode ser a chave para o desenvolvimento de novos tratamentos contra o câncer, que é o que nossa pesquisa procurou descobrir.

Três tipos de moléculas carregam informações em uma célula, e cada uma dessas moléculas desempenha sua própria função importante. O primeiro é o DNA, que contém informações genéticas integradas (como um livro de instruções). O segundo, RNA, é uma cópia temporária de uma instrução particular derivada do DNA. Por último, estão as proteínas produzidas graças às informações fornecidas pelo RNA. Essas proteínas são os "cavalos de batalha" das células, que desempenham funções específicas, como ajudar as células a se mover, reproduzir e gerar energia.

De acordo com esse modelo, o RNA há muito é visto como nada mais do que um intermediário entre o DNA e as proteínas. Mas os pesquisadores estão começando a descobrir que o RNA é muito mais do que um intermediário. Na verdade, essa molécula esquecida pode conter o segredo da progressão do câncer.

Nosso grupo de pesquisa descobriu recentemente um novo tipo de RNA que impulsiona a progressão do câncer sem produzir nenhuma proteína. Acreditamos que esse tipo de descoberta pode abrir caminho para uma forma inteiramente nova de direcionar as células cancerosas. Mas para entender como isso é possível, primeiro é importante conhecer os diferentes tipos de RNA que temos em nosso corpo.

Apenas cerca de 1% do DNA é copiado em RNAs que produzem proteínas. Outros RNAs ajudam na produção de proteínas. O restante (conhecido como RNAs não codificantes) foi considerado por muito tempo como não tendo nenhuma função no corpo humano. Mas estudos recentes estão desafiando essas suposições, mostrando que esses RNAs "inúteis" realmente desempenham um propósito muito específico. Na verdade, esses RNAs "não codificantes" regulam as funções de muitos genes, controlando assim aspectos-chave da vida das células (como sua capacidade de se mover).

O tipo mais abundante de RNAs não codificantes são os RNAs não codificantes longos (lncRNAs). Estas são moléculas longas que interagem com muitas moléculas diferentes na célula. E, como os pesquisadores descobriram agora, essas estruturas complexas permitem que muitas funções diferentes ocorram entre as células.

Como as células transformam DNA em proteína. Crédito: Fancy Tapis / Shutterstock

Por exemplo, alguns lncRNAs "agarram" proteínas diferentes e as reúnem para trabalhar em um espaço celular específico - como o mesmo segmento gênico. Essa função é essencial para controlar a inativação de alguns genes durante o desenvolvimento.

Mas, ao contrário de outras proteínas no corpo, não podemos identificar a função de uma molécula de lncRNA simplesmente observando sua sequência de DNA. Não saber sua função normal também significa que não podemos estudar o papel dessa molécula em causar doenças, incluindo o câncer.

Nosso grupo de pesquisa - e outros - estão começando a compreender as muitas funções importantes dos lncRNAs na progressão do câncer. Por exemplo, sabemos que alguns lncRNAs facilitam a multiplicação das células cancerosas, a interação com as células próximas e a fuga do sistema imunológico do corpo. Ao contrário das proteínas, que estão presentes em diferentes tipos de células, cada lncRNA está presente em um tipo específico de célula e pode ser detectado em fluidos corporais, como o sangue. Essas características os tornam ferramentas diagnósticas e terapêuticas muito atraentes.

Em nosso último trabalho, identificamos um lncRNA que está presente na forma mais agressiva de câncer de próstata. Para descobrir este lncRNA específico, analisamos perfis de RNA de centenas de pacientes com câncer de próstata. Descobrimos que esse lncRNA estava frequentemente associado apenas às formas mais agressivas.

Também descobrimos que esse lncRNA tem duas funções distintas: uma no núcleo (o "núcleo" das células, contendo o DNA) e uma no citoplasma (a parte externa de uma célula, contendo diferentes organelas (como as mitocôndrias). No núcleo da célula, o lncRNA se liga a uma proteína e a direciona para um trecho específico do DNA, onde pode ativar um gene. Esse mecanismo aumenta a capacidade das células do câncer de próstata de se espalharem para outros tecidos. No citoplasma, o O lncRNA se liga a outro RNA e ajuda as células cancerosas a se multiplicarem.

Como esse lncRNA estava ligado à progressão do câncer, decidimos projetar um novo tipo de medicamento que pudesse ter como alvo. Fizemos isso usando moléculas chamadas "oligonucleotídeos antisense", que atualmente estão sendo testados em ensaios clínicos. Esses são pequenos trechos de DNA sintético que se ligam ao RNA alvo e desencadeiam sua decomposição. Ao usar essas moléculas, descobrimos que, ao direcionar o lncRNA, fomos capazes de interromper o crescimento e a disseminação do câncer. Esperamos usar essas moléculas no futuro para tratar outros cânceres que expressam um lncRNA específico.

LncRNAs, que eram virtualmente desconhecidos há algumas décadas, assumindo mais destaque como uma ferramenta vital para entender a biologia do câncer. Curiosamente, alguns lncRNAs são expressos apenas em alguns tecidos (como o cérebro) e podem ser responsáveis ​​por características específicas dos humanos, por exemplo, o desenvolvimento aumentado de certas áreas do cérebro. Por esse motivo, os lncRNAs também são uma área ativa de investigação em doenças neurodegenerativas, como a demência.

Esperamos que a pesquisa sobre esse fenômeno biológico antes obscuro logo se traduza em melhores tratamentos para doenças incuráveis.

Mais Informações: Rebecca L. Mather et al. O RNA não codificante longo evolutivamente conservado LINC00261 conduz a proliferação e metástase do câncer de próstata neuroendócrino por meio de mecanismos nucleares e citoplasmáticos distintos, Oncologia Molecular (2021). DOI: 10.1002 / 1878-0261.12954

Este artigo foi republicado de The Conversation sob uma licença Creative Commons. Leia o artigo original.Esta história faz parte do Science X Dialog, onde os pesquisadores podem relatar as descobertas de seus artigos de pesquisa publicados. Visite esta página para obter informações sobre o ScienceX Dialog e como participar.


Conteúdo

Estrutura

tRNA tem estrutura primária, estrutura secundária (geralmente visualizada como o estrutura de trevo) e estrutura terciária (todos os tRNAs têm uma estrutura 3D em forma de L semelhante que permite que eles se encaixem nos locais P e A do ribossomo).

  1. O grupo fosfato 5'-terminal.
  2. A haste aceitadora é uma haste de 7 pb feita pelo emparelhamento de bases do nucleotídeo do terminal 5 'com o nucleotídeo do terminal 3' (que contém o grupo CCA do terminal 3 'usado para anexar o aminoácido). A haste aceitadora pode conter pares de bases não Watson-Crick.
  3. A cauda CCA é uma sequência CCA na extremidade 3 'da molécula de tRNA. Esta sequência é importante para o reconhecimento de tRNA por enzimas críticas na tradução. Em procariotos, a sequência CCA é transcrita. Em eucariotos, a sequência CCA é adicionada durante o processamento e, portanto, não aparece no gene tRNA.
  4. O braço D é uma haste de 4 bp terminando em uma alça que geralmente contém diidrouridina.
  5. O braço do anticódon é uma haste de 5 bp cuja alça contém o anticódon.
  6. O braço T é uma haste de 5 bp contendo a sequência TΨC onde Ψ é uma pseudouridina.
  7. As bases que foram modificadas, especialmente por metilação, ocorrem em várias posições fora do anticódon. A primeira base anticódon é às vezes modificada para inosina (derivada da adenina) ou pseudouridina (derivada do uracil).

Anticodonte

Um anticódon [1] é uma unidade composta por três nucleotídeos que correspondem às três bases do códon no mRNA. Cada tRNA contém uma sequência tripla anticódon específica que pode emparelhar com um ou mais códons para um aminoácido. Por exemplo, um códon para lisina é AAA, o anticódon de um tRNA de lisina pode ser UUU. Alguns anticódons podem emparelhar com mais de um códon devido a um fenômeno conhecido como pareamento de base oscilante. Freqüentemente, o primeiro nucleotídeo do anticódon é um dos dois não encontrados no mRNA: inosina e pseudouridina, que podem se ligar por hidrogênio a mais de uma base na posição do códon correspondente. No código genético, é comum que um único aminoácido ocupe todas as quatro possibilidades da terceira posição, por exemplo, o aminoácido glicina é codificado pelas sequências de códons GGU, GGC, GGA e GGG.

Para fornecer uma correspondência um-para-um entre moléculas de tRNA e códons que especificam aminoácidos, seriam necessárias 61 moléculas de tRNA por célula. No entanto, muitas células contêm menos de 61 tipos de tRNAs porque a base oscilante é capaz de se ligar a vários, embora não necessariamente a todos, os códons que especificam um determinado aminoácido. [2]

Aminoacilação

Aminoacilação é o processo de adição de um grupo aminoacil a um composto. Ele produz moléculas de tRNA com suas extremidades CCA 3 'ligadas covalentemente a um aminoácido.

Cada tRNA é aminoacilado (ou carregada) com um aminoácido específico por uma aminoacil ARNt sintetase. Normalmente há uma única aminoacil tRNA sintetase para cada aminoácido, apesar do fato de poder haver mais de um tRNA e mais de um anticódon para um aminoácido. O reconhecimento do tRNA apropriado pelas sintetases não é mediado apenas pelo anticódon, e a haste aceptora freqüentemente desempenha um papel proeminente.

Ligação ao Ribossomo

O ribossomo tem três sítios de ligação para moléculas de tRNA: os sítios A, P e E. Durante a tradução, o local A se liga a um aminoacil-tRNA de entrada, conforme direcionado pelo códon que atualmente ocupa este local. Este códon especifica o próximo aminoácido a ser adicionado à cadeia crescente do peptídeo. O sítio A só está funcionando depois que o primeiro aminoaciado-tRNA se anexou ao sítio P. O códon P-site é ocupado por peptdil-tRNA que é um tRNA com vários aminoácidos anexados como uma cadeia longa. O sítio P é, na verdade, o primeiro a se ligar ao aminoacil tRNA. Este tRNA no sítio P carrega a cadeia de aminoácidos que já foi sintetizada. O sítio E é ocupado pelo tRNA vazio quando está prestes a sair do ribossomo.


Tempo de desenvolvimento

Interesse nos genes que controlam o tempo de desenvolvimento em C. elegans (Ambros e Horvitz, 1984 Chalfie et al., 1981 Horvitz e Sulston, 1980) levou à clonagem do primeiro microRNA, lin-4miRNA (Lee et al., 1993), e a identificação do primeiro microRNA alvo, lin-14 mRNA (Wightman et al., 1993). O tempo de desenvolvimento, ou via heterocrônica, regula processos específicos do estágio durante C. elegans desenvolvimento larval. Para uma revisão recente e detalhada desse caminho, consulte Rougvie (Rougvie, 2005). Um foco do estudo da via heterocrônica em C. elegans tem sido o destino de desenvolvimento de várias células-tronco na hipoderme lateral, conhecidas coletivamente como células de costura. As células da costura sofrem um padrão de divisão celular que é sincronizado com as quatro mudas larvais do animal (Fig. 1A). Apenas na fase adulta as células da emenda sairão da mitose e se diferenciarão terminalmente. No lin-4 animais mutantes, as células da emenda repetem o padrão de divisão celular que caracteriza o primeiro estágio larval (L1) e não conseguem se diferenciar. Este fenótipo mutante foi interpretado como uma alteração heterocrônica com o relógio de desenvolvimento parado no estágio L1, resultando em 'retardo' do desenvolvimento. Mutações de ganho de função no lin-4 alvo miRNA lin-14 levam a um fenótipo idêntico, enquanto as mutações de perda de função em lin-14 resultam em um fenótipo oposto, "precoce", onde as células da emenda pulam a divisão celular do primeiro estágio larval. o lin-4 e lin-14 produtos gênicos, portanto, atuam como um interruptor de desenvolvimento que controla a transição de L1 para L2 (Fig. 1A, B).

Três microRNAs do let-7 família, mir-48, mir-84 e mir-241 agir redundantemente para controlar a próxima transição de desenvolvimento, do estágio L2 para o estágio L3 (Fig. 1B) (Abbott et al., 2005 Lau et al., 2001 Lin et al., 2005 Reinhart et al., 2000). Mutações de perda de função nesses três microRNAs levam à repetição do padrão de divisão celular do segundo estágio larval, enquanto uma mutação de ganho de função em mir-48 resulta em um fenótipo precoce. Um provável alvo de mir-48, mir-84 e mir-241durante esta transição é o C. elegans corcunda ortólogo hbl-1. O microRNA let-7, o segundo microRNA a ser identificado (Reinhart et al., 2000), controla a transição do quarto estágio larval para o estágio adulto, e dois de seus alvos na via heterocrônica são os lin-41 e hbl-1 genes, sendo que ambos também são genes heterocrônicos (Abrahante et al., 2003 Lin et al., 2003 Slack et al., 2000). Mais recentemente, dois adicionais let-7 genes alvo, os genes do fator de transcrição daf-12 e pha-4, foram identificados usando uma combinação de previsão baseada em bioinformática e análises de RNAi (Grosshans et al., 2005). daf-12 é também um regulador da via heterocrônica que controla o destino das células de costura (Antebi et al., 1998). Finalmente, os dois let-7 família microRNAs mir-48 e mir-84 também controlar a interrupção do ciclo de muda larval na fase adulta, com mir-48 mir-84 animais mutantes duplos submetidos a muda supranumerária na fase adulta (Fig. 1A, B) (Abbott et al., 2005).

É impressionante que pelo menos duas famílias de microRNAs e pelo menos quatro microRNAs estejam envolvidos no controle do tempo de desenvolvimento em C. elegans. Enquanto o lin-4 e let-7 Famílias de microRNAs são conservadas, eles podem desempenhar papéis semelhantes em outros organismos. Esta noção é apoiada pela regulação temporal de let-7 expressão em várias espécies (Pasquinelli et al., 2000). No entanto, pelo menos uma função potencial para let-7microRNAs familiares fora da via heterocrônica foram relatados, conforme discutido abaixo (Johnson et al., 2005).

MicroRNAs controlam o tempo de desenvolvimento. (UMA) C. elegans diagrama de linhagem celular para as células de junção V1-V4 e V6. O tempo de desenvolvimento é o eixo vertical. 1 a 4, estágios larvais L1 a L4 A, estágios adultos. As cores referem-se ao estágio de desenvolvimento. H, célula fundida à hipoderme. Linha preta tripla, diferenciação terminal significada pela asa lateral. Linhas pontilhadas, divisão celular continuada de acordo com o mesmo padrão. (B) Via genética simplificada dos genes heterocrônicos em C. elegans. A linha tracejada representa possível função atrasada para mir-48, mir-84 e mir-241 durante o desenvolvimento.

MicroRNAs controlam o tempo de desenvolvimento. (UMA) C. elegans diagrama de linhagem celular para as células de junção V1-V4 e V6. O tempo de desenvolvimento é o eixo vertical. 1 a 4, estágios larvais L1 a L4 A, estágios adultos. As cores referem-se ao estágio de desenvolvimento. H, célula fundida à hipoderme. Linha preta tripla, diferenciação terminal significada pela asa lateral. Linhas pontilhadas, divisão celular continuada de acordo com o mesmo padrão. (B) Via genética simplificada dos genes heterocrônicos em C. elegans. A linha tracejada representa possível função atrasada para mir-48, mir-84 e mir-241 durante o desenvolvimento.


Conteúdo

Enquanto a sequência de nucleotídeos específica de um mRNA especifica quais aminoácidos são incorporados no produto de proteína do gene a partir do qual o mRNA é transcrito, o papel do tRNA é especificar qual sequência do código genético corresponde a qual aminoácido. [3] O mRNA codifica uma proteína como uma série de códons contíguos, cada um dos quais é reconhecido por um tRNA particular. Uma extremidade do tRNA corresponde ao código genético em uma sequência de três nucleotídeos chamada anticódon. O anticódon forma três pares de bases complementares com um códon no mRNA durante a biossíntese de proteínas.

Na outra extremidade do tRNA está uma ligação covalente ao aminoácido que corresponde à sequência anticódon. Cada tipo de molécula de tRNA pode ser anexado a apenas um tipo de aminoácido, portanto, cada organismo tem muitos tipos de tRNA. Como o código genético contém vários códons que especificam o mesmo aminoácido, existem várias moléculas de tRNA com diferentes anticódons que carregam o mesmo aminoácido.

A ligação covalente à extremidade 3 'do tRNA é catalisada por enzimas chamadas aminoacil tRNA sintetases. Durante a síntese de proteínas, os tRNAs com aminoácidos anexados são entregues ao ribossomo por proteínas chamadas fatores de alongamento, que auxiliam na associação do tRNA com o ribossomo, na síntese do novo polipeptídeo e na translocação (movimento) do ribossomo ao longo do mRNA. Se o anticódon do tRNA corresponder ao mRNA, outro tRNA já ligado ao ribossomo transfere a cadeia polipeptídica crescente de sua extremidade 3 'para o aminoácido ligado à extremidade 3' do tRNA recém-entregue, uma reação catalisada pelo ribossomo. Um grande número de nucleotídeos individuais em uma molécula de tRNA pode ser modificado quimicamente, muitas vezes por metilação ou desamidação. Essas bases incomuns às vezes afetam a interação do tRNA com os ribossomos e às vezes ocorrem no anticódon para alterar as propriedades de emparelhamento de bases. [4]

A estrutura do tRNA pode ser decomposta em sua estrutura primária, sua estrutura secundária (geralmente visualizada como o estrutura de trevo), e sua estrutura terciária [6] (todos os tRNAs têm uma estrutura 3D em forma de L semelhante que permite que eles se encaixem nos locais P e A do ribossomo). A estrutura em folha de trevo torna-se a estrutura em forma de L 3D por meio do empilhamento coaxial das hélices, que é um motivo comum de estrutura terciária de RNA. Os comprimentos de cada braço, bem como o 'diâmetro' do laço, em uma molécula de tRNA variam de espécie para espécie. [6] [7] A estrutura do tRNA consiste no seguinte:

  • Um grupo fosfato 5 '-terminal.
  • A haste aceitadora é uma haste de 7 a 9 pares de bases (bp) feita pelo emparelhamento de bases do nucleotídeo do terminal 5 'com o nucleotídeo do terminal 3' (que contém o grupo CCA 3 'do terminal usado para anexar o amino ácido). Em geral, tais estruturas semelhantes a tRNA do terminal 3 'são referidas como' marcadores genômicos '. A haste aceitadora pode conter pares de bases não Watson-Crick. [6] [8]
  • A cauda CCA é uma sequência de citosina-citosina-adenina na extremidade 3 'da molécula de tRNA. O aminoácido carregado no tRNA por aminoacil tRNA sintetases, para formar aminoacil-tRNA, está covalentemente ligado ao grupo 3'-hidroxila na cauda do CCA. [9] Esta sequência é importante para o reconhecimento do tRNA por enzimas e crítica na tradução. [10] [11] Em procariotos, a sequência CCA é transcrita em algumas sequências de tRNA. Na maioria dos tRNAs procarióticos e tRNAs eucarióticos, a sequência CCA é adicionada durante o processamento e, portanto, não aparece no gene do tRNA. [12]
  • O braço D é uma haste de 4 a 6 bp terminando em uma alça que geralmente contém diidrouridina. [6]
  • O braço do anticódon é uma haste de 5 bp cuja alça contém o anticódon. [6] A estrutura primária do tRNA 5 'para 3' contém o anticódon, mas em ordem reversa, uma vez que a direcionalidade 3 'para 5' é necessária para ler o mRNA de 5 'para-3'.
  • O braço T é uma haste de 4 a 5 pb contendo a sequência TΨC onde Ψ é pseudouridina, uma uridina modificada. [6]
  • As bases que foram modificadas, especialmente por metilação (por exemplo, tRNA (guanina-N7 -) - metiltransferase), ocorrem em várias posições ao longo do tRNA. A primeira base anticódon, ou posição oscilante, é às vezes modificada para inosina (derivada de adenina), queuosina (derivada de guanina), ácido uridina-5-oxiacético (derivado de uracil), 5-metilaminometil-2-tiouridina (derivado de uracila) ou lisidina (derivada da citosina). [13]

Um anticódon [14] é uma unidade de três nucleotídeos correspondentes às três bases de um códon de mRNA. Cada tRNA tem uma sequência tripla anticódon distinta que pode formar 3 pares de bases complementares para um ou mais códons para um aminoácido. Alguns anticódons emparelham com mais de um códon devido ao emparelhamento de base oscilante. Freqüentemente, o primeiro nucleotídeo do anticódon é aquele não encontrado no mRNA: inosina, que pode se ligar por hidrogênio a mais de uma base na posição do códon correspondente. [4]: 29.3.9 No código genético, é comum que um único aminoácido seja especificado por todas as quatro possibilidades da terceira posição, ou pelo menos por ambas as pirimidinas e purinas, por exemplo, o aminoácido glicina é codificado pelo sequências de códons GGU, GGC, GGA e GGG. Outros nucleotídeos modificados também podem aparecer na primeira posição do anticódon - às vezes conhecida como "posição oscilante" - resultando em mudanças sutis no código genético, como por exemplo nas mitocôndrias. [15] Por célula, 61 tipos de tRNA são necessários para fornecer correspondência um a um entre as moléculas de tRNA e códons que especificam aminoácidos, pois há 61 códons de sentido do código genético padrão. No entanto, muitas células têm menos de 61 tipos de tRNAs porque a base oscilante é capaz de se ligar a vários, embora não necessariamente a todos, os códons que especificam um determinado aminoácido. São necessários pelo menos 31 tRNAs para traduzir, inequivocamente, todos os 61 códons de sentido. [3] [16]

Aminoacilação é o processo de adição de um grupo aminoacil a um composto. Ele liga covalentemente um aminoácido à extremidade CCA 3 'de uma molécula de tRNA. Cada tRNA é aminoaciclado (ou carregada) com um aminoácido específico por uma aminoacil ARNt sintetase. Normalmente existe uma única aminoacil tRNA sintetase para cada aminoácido, apesar do fato de poder haver mais de um tRNA e mais de um anticódon para um aminoácido. O reconhecimento do tRNA apropriado pelas sintetases não é mediado apenas pelo anticódon, e a haste aceptora freqüentemente desempenha um papel proeminente. [17] Reação:

Certos organismos podem ter uma ou mais sintetases de aminofosfato-tRNA ausentes. Isso leva à carga do tRNA por um aminoácido quimicamente relacionado e, pelo uso de uma enzima ou enzimas, o tRNA é modificado para ser carregado corretamente. Por exemplo, Helicobacter pylori tem glutaminil tRNA sintetase ausente. Assim, a glutamato tRNA sintetase carrega tRNA-glutamina (tRNA-Gln) com glutamato. An amidotransferase then converts the acid side chain of the glutamate to the amide, forming the correctly charged gln-tRNA-Gln.

Intriguingly it becoming clear that interference with aminoacylation can have therapeutic benefits in the combat of disease, especially viral reproduction and cancer may be relatively vulnerable to disturbed aminoacylation as compared to healthy cells. The protein synthesis associated with cancer and viral biology is often very dependent on specific tRNA molecules. For instance, for liver cancer charging tRNA-Lys-CUU with lysine sustains liver cancer cell growth and metastasis, whereas healthy cells have a much lower dependence of on this tRNA to support cellular physiology. [18] Similarly, hepatitis E virus requires a tRNA landscape that substantially differs from that associated with uninfected cells. [19] Hence, inhibition of aminoacylation of specific tRNA species is considered a promising novel avenue for the rational treatment of a plethora of diseases

The ribosome has three binding sites for tRNA molecules that span the space between the two ribosomal subunits: the A (aminoacyl), [21] P (peptidyl), and E (exit) sites. In addition, the ribosome has two other sites for tRNA binding that are used during mRNA decoding or during the initiation of protein synthesis. These are the T site (named elongation factor Tu) and I site (initiation). [22] [23] By convention, the tRNA binding sites are denoted with the site on the small ribosomal subunit listed first and the site on the large ribosomal subunit listed second. For example, the A site is often written A/A, the P site, P/P, and the E site, E/E. [22] The binding proteins like L27, L2, L14, L15, L16 at the A- and P- sites have been determined by affinity labeling by A. P. Czernilofsky et al. (Proc. Natl. Acad. Sci, USA, pp. 230–234, 1974).

Once translation initiation is complete, the first aminoacyl tRNA is located in the P/P site, ready for the elongation cycle described below. During translation elongation, tRNA first binds to the ribosome as part of a complex with elongation factor Tu (EF-Tu) or its eukaryotic (eEF-1) or archaeal counterpart. This initial tRNA binding site is called the A/T site. In the A/T site, the A-site half resides in the small ribosomal subunit where the mRNA decoding site is located. The mRNA decoding site is where the mRNA codon is read out during translation. The T-site half resides mainly on the large ribosomal subunit where EF-Tu or eEF-1 interacts with the ribosome. Once mRNA decoding is complete, the aminoacyl-tRNA is bound in the A/A site and is ready for the next peptide bond to be formed to its attached amino acid. The peptidyl-tRNA, which transfers the growing polypeptide to the aminoacyl-tRNA bound in the A/A site, is bound in the P/P site. Once the peptide bond is formed, the tRNA in the P/P site is acylated, or has a free 3’ end, and the tRNA in the A/A site dissociates the growing polypeptide chain. To allow for the next elongation cycle, the tRNAs then move through hybrid A/P and P/E binding sites, before completing the cycle and residing in the P/P and E/E sites. Once the A/A and P/P tRNAs have moved to the P/P and E/E sites, the mRNA has also moved over by one codon and the A/T site is vacant, ready for the next round of mRNA decoding. The tRNA bound in the E/E site then leaves the ribosome.

The P/I site is actually the first to bind to aminoacyl tRNA, which is delivered by an initiation factor called IF2 in bacteria. [23] However, the existence of the P/I site in eukaryotic or archaeal ribosomes has not yet been confirmed. The P-site protein L27 has been determined by affinity labeling by E. Collatz and A. P. Czernilofsky (FEBS Lett., Vol. 63, pp. 283–286, 1976).

Organisms vary in the number of tRNA genes in their genome. For example, the nematode worm C. elegans, a commonly used model organism in genetics studies, has 29,647 [24] genes in its nuclear genome, of which 620 code for tRNA. [25] [26] The budding yeast Saccharomyces cerevisiae has 275 tRNA genes in its genome.

In the human genome, which, according to January 2013 estimates, has about 20,848 protein coding genes [27] in total, there are 497 nuclear genes encoding cytoplasmic tRNA molecules, and 324 tRNA-derived pseudogenes—tRNA genes thought to be no longer functional [28] (although pseudo tRNAs have been shown to be involved in antibiotic resistance in bacteria). [29] Regions in nuclear chromosomes, very similar in sequence to mitochondrial tRNA genes, have also been identified (tRNA-lookalikes). [30] These tRNA-lookalikes are also considered part of the nuclear mitochondrial DNA (genes transferred from the mitochondria to the nucleus). [30] [31] The phenomenon of multiple nuclear copies of mitochondrial tRNA (tRNA-lookalikes) has been observed in many higher organisms from human to the opossum [32] suggesting the possibility that the lookalikes are functional.

As with all eukaryotes, there are 22 mitochondrial tRNA genes [33] [ full citation needed ] in humans. Mutations in some of these genes have been associated with severe diseases like the MELAS syndrome.

Cytoplasmic tRNA genes can be grouped into 49 families according to their anticodon features. These genes are found on all chromosomes, except the 22 and Y chromosome. High clustering on 6p is observed (140 tRNA genes), as well on 1 chromosome. [28]

The HGNC, in collaboration with the Genomic tRNA Database (GtRNAdb) and experts in the field, has approved unique names for human genes that encode tRNAs.

Evolution Edit

The top half of tRNA (consisting of the T arm and the acceptor stem with 5′-terminal phosphate group and 3′-terminal CCA group) and the bottom half (consisting of the D arm and the anticodon arm) are independent units in structure as well as in function. The top half may have evolved first including the 3′-terminal genomic tag which originally may have marked tRNA-like molecules for replication in early RNA world. The bottom half may have evolved later as an expansion, e.g. as protein synthesis started in RNA world and turned it into a ribonucleoprotein world (RNP world). This proposed scenario is called genomic tag hypothesis. In fact, tRNA and tRNA-like aggregates have an important catalytic influence (i. e. as ribozymes) on replication still today. These roles may be regarded as 'molecular (or chemical) fossils' of RNA world. [34]

Genomic tRNA content is a differentiating feature of genomes among biological domains of life: Archaea present the simplest situation in terms of genomic tRNA content with a uniform number of gene copies, Bacteria have an intermediate situation and Eukarya present the most complex situation. [35] Eukarya present not only more tRNA gene content than the other two kingdoms but also a high variation in gene copy number among different isoacceptors, and this complexity seem to be due to duplications of tRNA genes and changes in anticodon specificity [ citação necessária ] .

Evolution of the tRNA gene copy number across different species has been linked to the appearance of specific tRNA modification enzymes (uridine methyltransferases in Bacteria, and adenosine deaminases in Eukarya), which increase the decoding capacity of a given tRNA. [35] As an example, tRNAAla encodes four different tRNA isoacceptors (AGC, UGC, GGC and CGC). In Eukarya, AGC isoacceptors are extremely enriched in gene copy number in comparison to the rest of isoacceptors, and this has been correlated with its A-to-I modification of its wobble base. This same trend has been shown for most amino acids of eukaryal species. Indeed, the effect of these two tRNA modifications is also seen in codon usage bias. Highly expressed genes seem to be enriched in codons that are exclusively using codons that will be decoded by these modified tRNAs, which suggests a possible role of these codons—and consequently of these tRNA modifications—in translation efficiency. [35]

TRNA-derived fragments Edit

tRNA-derived fragments (or tRFs) are short molecules that emerge after cleavage of the mature tRNAs or the precursor transcript. [36] [37] [38] [39] Both cytoplasmic and mitochondrial tRNAs can produce fragments. [40] There are at least four structural types of tRFs believed to originate from mature tRNAs, including the relatively long tRNA halves and short 5’-tRFs, 3’-tRFs and i-tRFs. [36] [40] [41] The precursor tRNA can be cleaved to produce molecules from the 5’ leader or 3’ trail sequences. Cleavage enzymes include Angiogenin, Dicer, RNase Z and RNase P. [36] [37] Especially in the case of Angiogenin, the tRFs have a characteristically unusual cyclic phosphate at their 3’ end and a hydroxyl group at the 5’ end. [42] tRFs appear to play a role in RNA interference, specifically in the suppression of retroviruses and retrotransposons that use tRNA as a primer for replication. Half-tRNAs cleaved by angiogenin are also known as tiRNAs. The biogensis of smaller fragments, including those that function as piRNAs, are less understood. [43]

tRFs have multiple dependencies and roles such as exhibiting significant changes between sexes, among races and disease status. [40] [44] [45] Functionally, they can be loaded on Ago and act through RNAi pathways, [38] [41] [46] participate in the formation of stress granules, [47] displace mRNAs from RNA-binding proteins [48] or inhibit translation. [49] At the system or the organismal level, the four types of tRFs have a diverse spectrum of activities. Functionally, tRFs are associated with viral infection, [50] cancer, [41] cell proliferation [42] and also with epigenetic transgenerational regulation of metabolism. [51]

tRFs are not restricted to humans and have been shown to exist in multiple organisms. [41] [52] [53] [54]

Two online tools are available for those wishing to learn more about tRFs: the framework for the interactive exploration of mitochondrial and nuclear tRNA fragments (MINTbase) [55] [56] and the relational database of Transfer RNA related Fragments (tRFdb). [57] MINTbase also provides a naming scheme for the naming of tRFs called tRF-license plates (or MINTcodes) that is genome independent the scheme compresses an RNA sequence into a shorter string.

Engineered tRNAs Edit

Artificial suppressor elongator tRNAs are used to incorporate unnatural amino acids at nonsense codons placed in the coding sequence of a gene. Engineered initiator tRNAs (tRNA fMet2 with CUA anticodon encoded by metY gene) have been used to initiate translation at the amber stop codon UAG. This type of engineered tRNA is called a nonsense suppressor tRNA because it suppresses the translation stop signal that normally occurs at UAG codons. The amber initiator tRNA inserts methionine [58] and glutamine [59] at UAG codons preceded by a strong Shine-Dalgarno sequence. An investigation of the amber initiator tRNA showed that it was orthogonal to the regular AUG start codon showing no detectable off-target translation initiation events in a genomically recoded E. coli cepa. [58]

In eukaryotic cells, tRNAs are transcribed by RNA polymerase III as pre-tRNAs in the nucleus. [60] RNA polymerase III recognizes two highly conserved downstream promoter sequences: the 5′ intragenic control region (5′-ICR, D-control region, or A box), and the 3′-ICR (T-control region or B box) inside tRNA genes. [2] [61] [62] The first promoter begins at +8 of mature tRNAs and the second promoter is located 30–60 nucleotides downstream of the first promoter. The transcription terminates after a stretch of four or more thymidines. [2] [62]

Pre-tRNAs undergo extensive modifications inside the nucleus. Some pre-tRNAs contain introns that are spliced, or cut, to form the functional tRNA molecule [63] in bacteria these self-splice, whereas in eukaryotes and archaea they are removed by tRNA-splicing endonucleases. [64] Eukaryotic pre-tRNA contains bulge-helix-bulge (BHB) structure motif that is important for recognition and precise splicing of tRNA intron by endonucleases. [65] This motif position and structure are evolutionarily conserved. However, some organisms, such as unicellular algae have a non-canonical position of BHB-motif as well as 5′- and 3′-ends of the spliced intron sequence. [65] The 5′ sequence is removed by RNase P, [66] whereas the 3′ end is removed by the tRNase Z enzyme. [67] A notable exception is in the archaeon Nanoarchaeum equitans, which does not possess an RNase P enzyme and has a promoter placed such that transcription starts at the 5′ end of the mature tRNA. [68] The non-templated 3′ CCA tail is added by a nucleotidyl transferase. [69] Before tRNAs are exported into the cytoplasm by Los1/Xpo-t, [70] [71] tRNAs are aminoacylated. [72] The order of the processing events is not conserved. For example, in yeast, the splicing is not carried out in the nucleus but at the cytoplasmic side of mitochondrial membranes. [73]

Nonetheless, In March 2021, researchers reported evidence suggesting that a preliminary form of transfer RNA could have been a replicator molecule in the very early development of life, or abiogenesis. [74] [75]

The existence of tRNA was first hypothesized by Francis Crick, based on the assumption that there must exist an adapter molecule capable of mediating the translation of the RNA alphabet into the protein alphabet. Paul C Zamecnik and Mahlon Hoagland discovered tRNA [76] Significant research on structure was conducted in the early 1960s by Alex Rich and Don Caspar, two researchers in Boston, the Jacques Fresco group in Princeton University and a United Kingdom group at King's College London. [77] In 1965, Robert W. Holley of Cornell University reported the primary structure and suggested three secondary structures. [78] tRNA was first crystallized in Madison, Wisconsin, by Robert M. Bock. [79] The cloverleaf structure was ascertained by several other studies in the following years [80] and was finally confirmed using X-ray crystallography studies in 1974. Two independent groups, Kim Sung-Hou working under Alexander Rich and a British group headed by Aaron Klug, published the same crystallography findings within a year. [81] [82]


Informação sobre o autor

Afiliações

John S. Mattick is at the Garvan Institute of Medical Research, Sydney, New South Wales, Australia, and St Vincent's Clinical School, University of New South Wales, Sydney, New South Wales, Australia.

John L. Rinn is at the Department of Stem Cell and Regenerative Biology, the Department of Pathology, Harvard University, Cambridge, Massachusetts, USA, Beth Israel Deaconess Medical Center, Boston, Massachusetts, USA, and the Broad Institute of MIT and Harvard, Cambridge, Massachusetts, USA.


Early Replicons: Origin and Evolution*

CONCLUDING REMARKS

The results on replicons and their evolution reported here are recapitulated in terms of a comprehensive model for evolution considered at the molecular level, which was introduced ten years ago ( Schuster, 1997a , 1997b ). In most previous models phenotypes were considered only in terms of parameters contained in the kinetic equations and therefore an attempt to include phenotypes as integral parts of the model was made. Mutation and recombination act on genotypes whereas the target of selection, the fitness, is a property of phenotypes. The relations between genotypes and phenotypes are thus an intrinsic part of evolution and no theory can be complete without considering them. The complex process of evolution is partitioned into three simpler phenomena ( Figure 1.16 ): (i) biochemical kinetics, (ii) migration of populations, and (iii) genotype–phenotype mapping. Conventional biochemical kinetics as well as replicator dynamics including quasispecies theory are modeled by differential equation and therefore miss all stochastic aspects. In the current model kinetics is extended by two more aspects: (i) population support dynamics describing the migration of populations through sequence space and (ii) genotype–phenotype mapping providing the source of the parameters for biochemical kinetics. In general, phenotypes and their formation from genotypes are so complex that they cannot be handled appropriately. In reactions of simple replicons and test-tube evolution of RNA, however, the phenotypes are molecular structures. Then, genotype and phenotype are two features of the same molecule. In these simplest known cases the relations between genotypes and phenotypes boil down to the mapping of RNA sequences onto structures. Folding RNA sequences into structures can be considered explicitly provided a coarsegrained version of structure, the secondary structure, is used ( Schuster, 2006 ). This RNA model is self-contained in the sense that it is based on the rules of RNA secondary structure formation, the kinetics of replication and mutation as well as the structure of sequence space, and it needs no further inputs. The three processes shown in Figure 1.16 are indeed connected by a cyclic mutual dependence in which each process is driven by the previous one in the cycle and provides the input for the next one: (i) folding sequences into structures yields the input for biochemical kinetics, (ii) biochemical kinetics describes the arrival of new genotypes through mutation and the disappearance of old ones through selection, and determines thereby how and where the population migrates, and (iii) migration of the population in sequence space eventually creates the new genotypes that are to be mapped into phenotypes thereby completing the cycle. The model of evolutionary dynamics has been applied to interpret the experimental data on molecular evolution and it was implemented for computer simulations of neutral evolution and RNA optimization in the flow reactor ( Huynen et al., 1996 Fontana and Schuster, 1998a , 1998b ). Computer simulations allow to follow the optimization process at the molecular level in full detail. What is still needed is a comprehensive mathematical description combining the three processes.

FIGURE 1.16 . A comprehensive model of molecular evolution. The highly complex process of biological evolution is partitioned into three simpler phenomena: (i) biochemical kinetics, (ii) migration of populations, and (iii) genotype–phenotype mapping. Biochemical kinetics describes how optimal genotypes with optimal genes are chosen from a given reservoir by natural (or artificial) selection. The basis of population genetics is replication, mutation, and recombination mostly modeled by kinetic differential equations. In essence, kinetics is concerned with selection and other evolutionary phenomena occurring on short time-scales. Population support dynamics describes how the genetic reservoirs change when populations migrate in the huge space of all possible genotypes. Issues are the internal structure of populations and the mechanisms by which the regions of high fitness are found in sequence or genotype space. Support dynamics is dealing with the long-time phenomena of evolution, for example, with optimization and adaptation to changes in the environment. Genotype–phenotype mapping represents a core problem of evolutionary thinking since the dichotomy between genotypes and phenotypes is the basis of Darwin's principle of variation and selection: Variations and their results are uncorrelated in the sense that a mutation yielding a fitter phenotype does not occur more frequently because of the increase in fitness.

The work with RNA replicons has had a pioneering character. Both the experimental approach to evolution in the laboratory and the development of a theory of evolution are much simpler for RNA than in case of proteins or viruses. On the other hand, genotype and phenotype are more closely linked in RNA than in any other system. The next logical step in theory and experiment consists of the development of a coupled RNA–protein system that makes use of both replication and translation. This achieves the effective decoupling of genotype and phenotype that is characteristic for all living organisms: RNA is the genotype, protein the phenotype and thus, genotype and phenotype are no longer housed in the same molecule. The development of a theory of evolution in the RNA–protein world requires, in addition, an understanding of the notoriously difficult sequence–structure relations in proteins. Issues that are becoming an integral part of research on early replicons are (i) primitive forms of metabolism that can provide the material required for replication (and translation) and (ii) spatial isolation in vesicles or some amphiphilic material that forms compartments.

Molecular evolution experiments with RNA molecules and the accompanying theoretical descriptions made three important contributions to evolutionary biology:

The role of replicative units in the evolutionary process has been clarified, the conditions for the occurrence of error thresholds have been laid down, and the role of neutrality has been elucidated.

The Darwinian principle of (natural) selection has shown to be no privilege of cellular life, since it is valid also in serial transfer experiments, flow-reactors, and other laboratory assays such as SELEX.

Evolution in molecular systems is faster than organismic evolution by many orders of magnitude and thus enables researchers to observe optimization, adaptation, and other evolutionary phenomena on easily accessible time-scales, i.e. within days or weeks.

The third issue made selection and adaptation subjects of laboratory investigations. In all these model systems the coupling between different replicons is weak: in the simplest case there is merely competition for common resources, for example, the raw materials for replication. With more realistic chemical reaction mechanisms a sometimes substantial fraction of the replicons is unavailable as long as templates are contained in complexes. None of these systems, however, comes close to the strong interactions and interdependencies characteristic for co-evolution or real ecosystems. Molecular models for co-evolution are still in their infancy and more experimental work is needed to set the stage for testing the theoretical models available at present.

Virus life cycles represent the next logical step in increasing complexity of genotype–phenotype interactions. The pioneering paper by Weissmann (1974) has shown the way to proceed in the case of an RNA phage that is among the most simple candidates, and indeed the development of phages in bacterial cells can be modeled with sufficient accuracy. A lot of elegant work has been done since then and a wealth of data and models is available but many more experiments and more detailed theories are necessary to decipher the complex interactions of host–pathogen systems on the molecular level.


The long and short of a DNA-damage response

Ultraviolet light can damage DNA, triggering a general shutdown of gene transcription — yet some genes are activated by UV light. An investigation of this counter-intuitive behaviour reveals a surprising gene-regulation mechanism.

DNA damage can lead to mutations, cancer and even cell death, and activates several biological processes 1,2 . These include: DNA repair that removes lesions from the double helix checkpoints that arrest cell-cycle progression to prevent the transmission of damaged DNA to daughter cells apoptosis, a form of cell death that eliminates cells with heavily damaged genomes and a transcription response that changes the cellular RNA profile. Much is known about how cells orchestrate these processes, but the transcription response is arguably the least well understood of the four. Escrevendo em Célula, Williamson et al. 3 describe a mechanism for the transcription response to DNA damage caused by ultraviolet light. Their findings reveal a remarkable circuit that triggers the formation of non-coding RNA molecules from a gene. Moreover, these molecules oppose the action of the protein that is produced from the same gene in the absence of UV damage.

DNA-damaging agents induce the transcription of specific gene classes. Several genes can be induced by more than one DNA-damaging agent, whereas others are induced mainly by one agent. The resulting gene products are associated with many different cellular processes, including DNA repair, intercellular signalling and responses to oxidative stress.

Irradiation by UV light elicits a response from a large subset of damage-induced genes, through a series of intracellular processes that starts at or near the cell membrane 4 . But a general shutdown of transcription also occurs soon after UV irradiation. This is because UV exposure causes chemical modifications in DNA known as pyrimidine dimers (PDs). When present on the transcribed strand of a gene, PDs stall the enzyme RNA polymerase II (RNAPII), which elongates nascent RNA chains. A process called transcription-coupled nucleotide excision repair rapidly removes these defects, allowing fast resumption of transcription. Cells that fail to resume transcription are eliminated by the ultimate DNA damage-response pathway: apoptosis 5,6 .

How can some genes be activated by UV light if transcription in general has been shut down by PDs? It is tempting to speculate that PDs on the transcribed strand of UV-activated genes are repaired particularly quickly, or that fewer PDs form in those genes. The number of PDs that form in a gene is usually proportional to gene size, because PDs form almost randomly in typical DNA sequences. It is therefore interesting that the genes activated by cytotoxic doses of UV light are compact, and contain a small number of short introns 7 (non-coding sequences).

Williamson et al. now reveal a regulatory mechanism for UV-activated genes. They report that the transcription of several such genes by RNAPII proceeds slowly after UV exposure, and is restricted to regions of DNA that are close to promoters (promoter sequences are those that initiate gene transcription). Intriguingly, these changes in RNAPII behaviour correlate with the emergence of alternative splicing — that is, with a change in the way that nascent RNA is processed. This triggers the formation of short, non-coding transcripts, rather than the formation of longer, protein-encoding messenger RNAs (Fig. 1).

uma, The enzyme RNA polymerase II (RNAPII) normally transcribes DNA to produce nascent RNA molecules that are processed (spliced) to form messenger RNA. In the case of the ASCC3 gene, the mRNA is translated to form a protein that represses transcription. Red, yellow and blue DNA regions correspond to protein-coding sequences grey regions are non-coding sequences (introns). The purple region is not an intron, but is excluded from the mRNA by splicing. b, Williamson et al. 3 report that UV irradiation slows transcription by RNAPII, resulting in the formation of shorter RNA molecules through a process called alternative splicing. The shorter RNA molecules formed from ASCC3 are non-coding and activate transcription — opposing the action of the ASCC3 protein produced in uma. (Adapted from ref. 3.)

The authors focused their efforts on the ASCC3 gene, which researchers from the same group had previously implicated in the UV-damage response 8 . The ASCC3 protein encoded by the long mRNA transcribed from this gene suppresses transcription in the late stages of the response. Unexpectedly, the authors found that the short ASCC3 transcript produced by alternative splicing is a regulatory non-coding RNA that is required for the recovery of transcription.

The mechanisms by which the ASCC3 protein regulates transcription are poorly understood. However, Williamson et al. provide some clues by showing that ASCC3 interacts with both RNAPII and a transcription-repair coupling factor. The researchers have thus uncovered a regulatory circuit of the UV response, in which one RNA transcript produces a protein, whereas the other, shorter transcript resulting from alternative splicing opposes that protein's activity.

Future studies of the function of short RNA molecules promise to be fascinating, because our current understanding of such RNAs as activators of transcription is in its infancy. Williamson et al. say they are now screening for genes that encode factors required for transcription shutdown after DNA damage. It will be interesting to see how these factors modulate transcription — is there a connection with transcription-coupled repair, or do they belong to an as-yet-unknown pathway? And what is their function in cell survival?

The authors report that almost 80% of the transcripts that undergo processing in response to UV light can be accounted for by a simple model in which alternative splicing occurs unusually close to the promoter. But the remaining 20% or so include sequences from farther along the gene, and are not easily explained by a model based solely on slow versus fast RNAPII rates.

Another challenge will therefore be to determine the mechanisms underlying the formation of this minor population of mRNAs. Factors beyond simple RNAPII speed that might affect the choice of splice sites include compaction of the gene (chromatin structure) and competition between the folding of newly transcribed RNA and the binding of proteins that control splice-site choice 9 . In the meantime, Williamson et al. have added a new level of understanding to the mechanisms used by mammalian cells to regulate gene expression in response to UV irradiation. The discovery of RNA-processing circuitry that responds to cellular stress opens up the possibility that analogous gene-regulatory pathways have roles in the response to other cellular cues. Footnote 1


Resumo

Single-cell sequencing technologies, including transcriptomic and epigenomic assays, are transforming our understanding of the cellular building blocks of neural circuits. By directly measuring multiple molecular signatures in thousands to millions of individual cells, single-cell sequencing methods can comprehensively characterize the diversity of brain cell types. These measurements uncover gene regulatory mechanisms that shape cellular identity and provide insight into developmental and evolutionary relationships between brain cell populations. Single-cell sequencing data can aid the design of tools for targeted functional studies of brain circuit components, linking molecular signatures with anatomy, connectivity, morphology, and physiology. Here, we discuss the fundamental principles of single-cell transcriptome and epigenome sequencing, integrative computational analysis of the data, and key applications in neuroscience.


CONCLUSIONS

Solving the limitations of traditional RNA sequence alignments described above requires a new view of an 𠇊lignment,” the 𠇌orresponds to” relation, and the elements of RNA structure that can correspond to one another. This work, in conjunction with the existing RNA structure ontology efforts, will ultimately lead to an alignment ontology that enables the development of new representations of RNA data and software tools to resolve the problems with current RNA sequence alignments, and to facilitate the integration of secondary and 3D structural and other experimental information to create more accurate and useful alignments. Here, we have proposed a prototype RNA correspondence relation to initiate discussion on how best to resolve these issues. In order for the perspective on RNA structure alignments outlined above to be useful, further development should be undertaken by RNA scientists in as broad a range of specialities as possible.


Assista o vídeo: RNA e Genes (Janeiro 2022).