Em formação

É possível determinar de qual tecido uma amostra de DNA veio com base apenas em sua sequência?


Todas as células possuem o mesmo genoma e diferem apenas pelo padrão de expressão. É possível determinar a origem do tecido de uma célula com base em sua sequência de DNA usando análise de repetição curta em tandem (STR) ou análise de variação do número de cópias (CNV)?


A resposta está na pergunta, mas suponho que você quisesse garantir que não faltaram algumas informações.

Responder

A sequência de DNA é a mesma em todas as células de um organismo multicelular. Apenas o padrão de expressão varia entre os tecidos. Portanto, é impossível dizer apenas pela sequência de DNA de que tecido vem uma célula.

Seria viável observando o transcriptoma ou o proteoma ou, eventualmente, observando as modificações epigenéticas.

Exceção potencial

Claro, ao falar sobre CNV, se você considerar que o número de cromossomos é parte da informação presente em uma sequência de DNA, então as células haplóides (espermatozóides e óvulos) são uma exceção e você poderia diferenciá-las. Da mesma forma, células anucleadas seriam uma exceção, pois não contêm DNA nuclear.

Outras exceções potenciais são explicadas por @tsttst em seu comentário.


Teve um artigo na Science, em agosto deste ano (desculpas ao autor por não lembrar o nome). Eles elaboraram um protocolo para o sequenciamento de bissulfito de célula única e, por meio do uso de genes marcadores conhecidos, conseguiram identificar vários subtipos neuronais com base na metilação não-CpG nos corpos dos genes.

A metilação não-CpG entre os corpos dos genes é frequentemente vista como inversamente correlacionada à expressão do gene, por meio disso você pode inferir um perfil de expressão de genes marcadores conhecidos, dando a você um toque sólido em um tipo de célula com apenas uma sequência de DNA.

(Editar: assumindo que isso seja verdadeiro em tecidos fora do córtex)


prefiro começar com a suposição de que não duas células no corpo humano têm o mesmo genoma. As mutações ocorrem com freqüência; a maioria deles é consertada, mas alguns permanecem sem conserto. O corpo humano é um mosaico genético.

Abyzov et al. (Genome Research, 2017):

Estimamos que, em média, uma célula de fibroblasto em crianças tem 1.035 SNVs de mosaico principalmente benigno. (...) Essas descobertas revelam um grande grau de mosaicismo somático em tecidos humanos saudáveis, vinculam mutações de novo e cancerígenas ao mosaicismo somático e unem o mosaicismo somático à proliferação celular.


https://www.ncbi.nlm.nih.gov/pubmed/28235832


SEQUENCIAMENTO DE DNA

Introdução

O sequenciamento de DNA é um grande negócio. Aproximadamente US $ 3 bilhões foram gastos em 2003 em reagentes e enzimas de sequenciamento, e em equipamentos e softwares analisadores para aquisição automática de sequências. A maior parte dessa saída de sequência foi determinada usando a tecnologia de eletroforese capilar (CE), que se desenvolveu de forma proporcional e rápida nos últimos 10 anos. O CE oferece alta resolução e alto rendimento, operação automática e aquisição de dados, com detecção online de corantes ligados a produtos de extensão de DNA. Avanços operacionais, como campo pulsado e campos elétricos graduados e programas automatizados de rampa térmica à medida que a execução avança, resultam em resolução de base mais alta e leituras de sequência mais longas. Algoritmos avançados de chamada de base e aditivos de marcador de DNA que utilizam marcos de dimensionamento de fragmentos conhecidos também podem ajudar a melhorar a chamada de base de fragmento, aumentando a precisão da chamada e os comprimentos de leitura em 20-30%. Apesar da alta eficiência dos sequenciadores CE, o delineamento completo do genoma humano e sua implicação para a análise de todo o genoma para medicina personalizada está conduzindo o desenvolvimento de dispositivos e produtos químicos capazes de aumentar massivamente o rendimento da sequência, em comparação com os sequenciadores CE convencionais. A miniaturização do CE em dispositivos baseados em chip fornece todas as facilidades acima - uma melhoria significativa na velocidade e automação aprimorada da análise. Novos dispositivos de sequenciamento baseados em array também prometem um aumento quântico na eficiência. Cada um desses novos dispositivos fornece um rendimento extremamente alto, dados de alta qualidade e custos de processo baixos. Este artigo também examina a automação e o aprimoramento dos processos de sequenciamento, processos de amplificação de DNA e abordagens alternativas para o sequenciamento.


O risco de contaminação de qualquer cena de crime pode ser reduzido limitando a atividade incidental. É importante que todos os encarregados da aplicação da lei na cena do crime façam um esforço consciente para evitar fumar, comer, beber, jogar lixo ou qualquer outra ação que possa comprometer a cena do crime. Como a evidência de DNA é mais sensível do que outros tipos de evidência, o pessoal da aplicação da lei deve estar especialmente ciente de suas ações no local para evitar a contaminação inadvertida das evidências.

A cadeia de custódia das provas é um registro de indivíduos que tiveram a posse física das provas. A documentação é crítica para manter a integridade da cadeia de custódia. Manter a cadeia de custódia é vital para qualquer tipo de evidência. Além disso, se a análise laboratorial revelar que a evidência de DNA foi contaminada, pode ser necessário identificar as pessoas que manipularam essa evidência.

No processamento da evidência, quanto menos pessoas lidarem com a evidência, melhor. Há menos chance de contaminação e uma cadeia de custódia mais curta para as audiências de admissibilidade nos tribunais.


Materiais e métodos

Espécimes

Todos os espécimes de mariposa pertencem à espécie Euxoa Messoria. Eles foram coletados ao longo de um período de 45 anos (Tabela 1) e foram preservados com alfinetes sem conservante adicional. Espécimes de três espécies diferentes de rãs (Tabela 2) foram coletados como parte da pesquisa em andamento não relacionada a este estudo e preservados usando métodos padrão (por exemplo, Lit. [25]). As rãs foram mortas com solução aquosa de cloretona e, para as rãs adultas, uma amostra de tecido hepático foi preservada em etanol a 95%. As amostras adultas foram então fixadas em formaldeído tamponado com neutro 3,7% durante a noite e depois transferidas para etanol 70% para armazenamento a longo prazo. Em grandes espécimes (por exemplo, Astylosternus), um pequeno volume (

1 mililitro) foi injetado na cavidade corporal durante a fixação. Para girinos, um pequeno pedaço da cauda (principalmente músculo) foi excisado e armazenado em etanol 95% seguindo a prática comum, o espécime restante foi fixado e armazenado em formaldeído 3,7%. Os procedimentos de cuidado com os animais são aprovados pelo Comitê Permanente da Faculdade de Artes e Ciências da Universidade de Harvard sobre o uso de animais em pesquisa e ensino. Uma declaração de Garantia de Bem-Estar Animal está arquivada no Office for Laboratory Welfare (OLAW) da universidade.

Após retornar do campo, as amostras de tecido em etanol 95% foram armazenadas a -80 ° C. Para este estudo, outro pedaço do mesmo tecido (ou seja, fígado ou cauda) foi excisado de todas as amostras preservadas, essas amostras de tecido foram transferidas para etanol a 95%. Para avaliar qualitativamente o efeito do tempo de armazenamento e reduzir o efeito da espécie ou do estágio de desenvolvimento em nossos resultados, analisamos tecidos de adultos coletados em dois anos diferentes, bem como girinos da mesma espécie. Essas amostras que foram armazenadas ou fixadas com formaldeído serão referidas como expor para formaldeído.

Extração de DNA

Pequenas alíquotas de tecido de rã (1–3 mg) foram obtidas das amostras preservadas em março de 2007. O tecido foi lisado e o DNA foi purificado usando o kit DNeasy (Qiagen) seguindo o protocolo do fabricante. O DNA extraído foi armazenado em tampão TE a 4 ° C.

Uma perna de cada espécime de mariposa foi usada para extração de DNA, usando o kit NucleoSpin96 (Macherey-Nagel). A eluição foi realizada com 40 μl de água. O eluato foi armazenado a -20 ° C.

Análise de fragmentos por eletroforese capilar

Uma alíquota de 1-5 μl de DNA extraído foi marcada com Fluorescein-12-ddATP (PerkinElmer, Boston, MA) usando Terminal Transferase (NEB, Ipswich, MA) de acordo com o protocolo de acompanhamento, resultando em um volume de reação de 10 μL. A reação foi incubada a 37 ° C durante 1 h, depois aplicada a uma coluna Centri-Sep (Princeton Separations) [26].

Para a remoção dos fosfatos terminais nos fragmentos de DNA, alíquotas de 3 μl de DNA foram tratadas com 5U de Fosfatase Antártica (NEB) em um volume total de reação de 10 μl. A reação foi incubada a 37 ° C por 1 h, seguida pela inativação da fosfatase a 65 ° C por 5 min. Seguiu-se a marcação com TdT conforme descrito acima.

Uma alíquota de 1–2 μl do eluato foi misturada com 9 μl Hi-Di (Applied Biosystems) e 0,5 ml GENESCAN LIZ1200 tamanho padrão (Applied Biosystems). As amostras foram analisadas em um analisador genético 3130xl (Applied Biosystems), usando um array de 36 cm, polímero POP7, um tempo de injeção de 10 se um tempo total de execução de 6200 s. Um exemplo dos dados brutos usados ​​para a determinação do tamanho do fragmento é mostrado na Figura 1c para a amostra de mariposa 3.

O painel A mostra a distribuição de tamanho do DNA extraído de amostras de mariposas. Consulte os métodos para obter detalhes sobre a determinação do tamanho. O painel B mostra os dados brutos dos fragmentos de DNA marcados com FAM, em média para cada ano. Os dados foram dimensionados para a mesma altura para comparação. Observe a diminuição da largura do pico com a idade da amostra. O painel C mostra os dados brutos obtidos para a amostra de traça 3 de uma corrida de eletroforese capilar. A rotulagem do DNA sem qualquer tratamento anterior resulta na distribuição do fragmento mostrada aqui em vermelho. Uma alíquota da mesma amostra foi tratada com Fosfatase Antártica antes da reação de marcação TdT, mostrada em azul. A distribuição do tamanho dos fragmentos não muda, enquanto a intensidade é aumentada por um fator de 2–15 para amostras diferentes. O padrão de tamanho LIZ1200 é mostrado em laranja, os números indicam o tamanho do fragmento em bases.

Os dados brutos foram importados para Origin7.5 (Microcal) para análise detalhada. Para a determinação do tamanho do fragmento mais abundante de uma amostra, a curva de dados para a fluorescência FAM foi submetida à suavização, utilizando o método da média adjacente acima de 500 pontos. A curva suavizada foi ajustada a uma função de pico, equação 1, para determinar a posição do máximo (em números de varredura).

w: largura, xc: centro, y 0 : deslocamento, A: Amplitude

Para converter isso em pares de bases, os tempos de eluição dos fragmentos padrão de tamanho (em números de varredura) foram plotados contra o tamanho conhecido de cada fragmento do padrão LIZ1200 e ajustados a uma curva de crescimento sigmoidal, equação 2.

UMA 1 : valor inicial, A 2 : valor final, x 0 : centro, dx: constante de tempo

O resultado do ajuste para o padrão de tamanho juntamente com o pico da fluorescência FAM foram usados ​​para determinar o tamanho mais abundante dos fragmentos de DNA em uma determinada amostra. Para a distribuição dos tamanhos dos fragmentos, foi usada a largura do pico (largura total na metade da altura), conforme determinado a partir do ajuste da equação 1.

Para a quantificação do conteúdo total de DNA, uma linha de base foi ajustada ao sinal FAM total, o sinal foi então integrado usando esta linha de base. Como um teste para a linearidade de detecção em nosso CE, usamos o Φ X174 DNA ladder (NEB) em uma diluição serial. Encontramos uma correlação linear entre a integral dos dados e a concentração da amostra na faixa de 2–20 ng / μl (R = 0,997, dados não mostrados).

Digestão de DNA

O DNA extraído foi digerido usando um método publicado [27] com modificações. Alíquotas de 1–10 μl de DNA extraído foram incubadas com 1 μl de DNase I (2U / μl, NEB), 10 μl de Fosfodiesterase de veneno de cobra (0,26 mU / μl, Sigma-Aldrich) e 2 μl de Fosfatase Antártica (5U / μl, NEB ) a 37 ° C durante a noite. Usando este procedimento, o DNA não modificado foi completamente digerido ao nível de mononucleosídeo conforme avaliado por HPLC (dados não mostrados).

Separação de HPLC

As amostras de DNA digeridas foram analisadas em um sistema Agilent 1100 HPLC equipado com uma coluna Develosil RP-Aqueous C30 (Nomura Chemical Co.). O solvente A era água MilliQ contendo ácido fórmico a 1% (v / v) e o solvente B era metanol de grau gradiente contendo 0,25% (v / v) de ácido fórmico. Um perfil de eluição foi usado de 2–20% B ao longo de 30 min, aumentando para 98% ao longo de outros 20 min, em seguida, 98% B por 10 min e, finalmente, retornando a 2% B ao longo de 20 min. A taxa de fluxo foi ajustada para 20 μl / min e o eluato monitorado a 254 nm. Normalmente, 4 μl de cada amostra foram injetados usando o amostrador de placa de poço.

Análise espectrométrica de massa

Para análise de espectrometria de massa, o sistema de HPLC descrito acima foi conectado diretamente à entrada de amostra de um espectrômetro de massa Agilent ESI-TOF. Os dados espectrais de massa foram registrados no modo de íon positivo ao longo de toda a duração da execução de HPLC. Os dados foram analisados ​​usando Analyst QS (Agilent).

Eletroforese em gel de agarose de campo pulsado

Para a detecção de grandes fragmentos de DNA, alíquotas do DNA de rã foram carregadas em um gel de agarose a 1% e separadas por 15 h com um tempo de troca de 1–12 se uma voltagem de 6 V / cm. O marcador era o marcador PFG N0350 (NEB).

Uma peça de 500 bp do Euxoa messoa A sequência de código de barras foi amplificada usando os iniciadores pJZ-moth1-se TTAGGTAATCCAGGATCTTTAATTG e pJZ-moth1-as ATGATAATAATAATAAAAATGCAGT. A amplificação foi realizada com Taq DNA polimerase (NEB), com uma desnaturação inicial a 95 ° C por 2 min., Em seguida, 30 ciclos de 95 ° C por 15 s, 55 ° C por 10 s, 72 ° C por 30 s, e uma extensão final a 72 ° C por 5 min.

As sequências de primer para a PCR do RNA ribossômico 16S mitocondrial de sapo correspondem às de Darst e Cannatella [28]. Os iniciadores para o primeiro exão do gene nuclear da rodopsina são ACGGAACAGAAGGTCCCAAC (iniciador 5 ') e AGCGAAGAAGCCTTCAAAGT (iniciador 3'). As reações de PCR foram realizadas com Phusion DNA polimerase (NEB), com desnaturação inicial a 98 ° C por 30 s, depois 30 ciclos de 98 ° C por 10 s, 60 ° C por 10 s, 72 ° C por 45 s, e uma extensão final a 72 ° C por 10 min.

Modelagem de corte de DNA

Um algoritmo foi escrito em C para simular a fragmentação de DNA de fita dupla por repetidos eventos de corte. A simulação exigiu quatro parâmetros de entrada: duração do período de tempo simulado (t) em anos, o tamanho do DNA (eu) em megabases, taxa de nick (n) em nicks por megabase por dia e proximidade de nicks de fita oposta (p) que resulta em uma quebra de fita dupla dada em bases. O programa inicia a função do gerador de números aleatórios da biblioteca C para que as chamadas repetidas para o gerador retornem números inteiros aleatórios uniformemente distribuídos entre 1 e 2 *eu* 10 6. O número aleatório r representará um nick na résima posição da vertente frontal se r & lteu* l0 6, caso contrário, o programa atribui o nick na posição rc = r - eu* l0 6 na fita reversa. A sequência imaginária é "cortada" n*eu*365*y vezes nas posições indicadas pelos números aleatórios retornados de chamadas consecutivas para o gerador de números aleatórios. Em seguida, o programa identifica onde os cortes de fita oposta ocorrem dentro p bases e registra quebras de fita dupla. As distâncias entre quebras consecutivas, medidas na fita dianteira do DNA, fornecem os comprimentos dos fragmentos. Eles são tabulados e relatados em uma lista classificada por tamanho. A simulação é executada com diferentes combinações de parâmetros de entrada.


DNA Technology in Forensic Science (1992)

"Tipagem de DNA" é um termo genérico para uma ampla gama de métodos de estudo de variações genéticas. Cada método tem suas próprias vantagens e limitações, e cada um está em um estado diferente de desenvolvimento técnico. Cada método de tipagem de DNA envolve três etapas:

Análise laboratorial de amostras para determinar seus tipos de marcadores genéticos em vários locais de variação potencial.

Comparação dos tipos de marcadores genéticos das amostras para determinar se os tipos correspondem e, portanto, se as amostras podem ter vindo da mesma fonte.

Se os tipos corresponderem, análise estatística da frequência populacional dos tipos para determinar a probabilidade de que tal combinação possa ter sido observada ao acaso em uma comparação de amostras de pessoas diferentes.

Antes que qualquer método específico de tipagem de DNA seja usado para fins forenses, é essencial que procedimentos precisos e cientificamente confiáveis ​​sejam estabelecidos para a execução de todas as três etapas. Este capítulo discute as duas primeiras análises de laboratório e comparação de padrões e o Capítulo 3 se concentra na análise estatística.

Não há controvérsia científica sobre a validade dos princípios gerais subjacentes à tipagem de DNA: os cientistas concordam que o DNA varia substancialmente entre os humanos, que a variação pode ser detectada em laboratório e que a comparação do DNA pode fornecer uma base para distinguir amostras de pessoas diferentes. No entanto, um determinado método de tipagem de DNA pode ou não ser cientificamente apropriado para uso forense. Antes que um método possa ser ac-

tida como válida para uso forense, deve ser rigorosamente caracterizada em ambientes de pesquisa e forense para determinar as circunstâncias sob as quais produzirá ou não resultados confiáveis. Não faz sentido falar da confiabilidade da tipagem de DNA em geral & mdashi.e., Sem especificar um método particular. Alguns estados adotaram estatutos vagamente redigidos sobre a admissibilidade dos resultados de tipagem de DNA, sem especificar os métodos a serem cobertos. Obviamente, tais leis tinham como objetivo cobrir apenas a análise RFLP convencional de sondas de locus único em Southern blots - o único método de uso comum no momento da aprovação da legislação. Confiamos que os tribunais reconhecerão as limitações inerentes a tais estatutos.

A análise forense de DNA deve ser regida pelos mais altos padrões de rigor científico em análise e interpretação. Esses altos padrões são apropriados por duas razões: o poder probatório da tipagem de DNA pode ser tão grande que pode superar todas as outras evidências em um julgamento e os procedimentos para a tipagem de DNA são complexos, e os juízes e júris não podem pesar e avaliar adequadamente as conclusões com base em padrões diferentes de rigor.

O comitê não pode fornecer descrições técnicas abrangentes para a tipagem de DNA neste relatório: muitos métodos existem ou estão planejados, e muitas questões devem ser abordadas em detalhes para cada método. Em vez disso, nosso principal objetivo é fornecer uma estrutura geral para a avaliação de qualquer método de tipagem de DNA.

ESSENCIAIS DE UM PROCEDIMENTO FORENSE DE TIPAGEM DE DNA

Fundamentos Científicos

O uso forense de tipagem de DNA é uma conseqüência de seu uso diagnóstico médico e mdasanálise de genes causadores de doenças com base na comparação do DNA de um paciente com o de membros da família para estudar padrões de herança de genes ou com padrões de referência para detectar mutações. Para entender os desafios envolvidos em tal transferência de tecnologia, é instrutivo comparar a tipagem forense de DNA com os diagnósticos de DNA.

O diagnóstico de DNA geralmente envolve amostras de tecido limpo de fontes conhecidas. Geralmente, pode ser repetido para resolver ambigüidades. Envolve a comparação de alternativas discretas (por exemplo, qual dos dois alelos um filho herdou de um pai?) E, portanto, inclui verificações de consistência integradas contra artefatos. Não requer nenhum conhecimento da distribuição de padrões na população em geral.

A tipagem forense de DNA geralmente envolve amostras degradadas, contaminadas ou de várias fontes desconhecidas. Às vezes, não pode ser repetido, porque há muito pouca amostra. Freqüentemente, envolve a combinação de amostras de uma ampla gama de alternativas presentes na população e, portanto, carece de verificações de consistência integradas. Exceto nos casos em que a evidência de DNA

exclui um suspeito, avaliar a significância de um resultado requer uma análise estatística das frequências da população.

Apesar dos desafios da tipagem forense de DNA, acreditamos que seja possível desenvolver sistemas confiáveis ​​de tipagem forense de DNA, desde que os devidos cuidados científicos sejam tomados para definir e caracterizar os métodos. Descrevemos a seguir as principais questões que devem ser abordadas para cada procedimento de tipagem de DNA.

Protocolo de Laboratório Escrito

Um elemento essencial de qualquer método de tipagem de DNA clínico ou forense é um protocolo de laboratório escrito detalhado. Esse protocolo não deve apenas especificar etapas e reagentes, mas também fornecer instruções precisas para a interpretação dos resultados, o que é crucial para avaliar a confiabilidade de um método. Além disso, o protocolo completo deve ser disponibilizado gratuitamente para que possa ser submetido ao escrutínio científico.

Procedimento para identificar padrões

Deve haver um procedimento objetivo e quantitativo para identificar o padrão de uma amostra. Embora a imprensa popular às vezes compare os padrões de DNA a códigos de barras, os resultados laboratoriais da maioria dos métodos de teste de DNA não são dados discretos, mas sim dados contínuos. Normalmente, esses resultados consistem em uma imagem & mdashs como um autorradiograma, uma fotografia, manchas em uma tira ou os traçados fluorométricos de uma sequência de DNA & mdashand a imagem deve ser analisada quantitativamente para determinar o genótipo ou genótipos representados na amostra. A quantificação é especialmente importante em aplicações forenses, devido à possibilidade sempre presente de amostras misturadas.

Os padrões devem ser identificados separada e independentemente em amostras suspeitas e evidências. Não é permitido decidir quais características de uma amostra de evidência contar e quais descontar com base em uma comparação com uma amostra suspeita, porque isso pode enviesar a interpretação de alguém.

Procedimento para declarar uma correspondência

Quando os padrões individuais de DNA na amostra de evidência e na amostra suspeita forem identificados, é hora de fazer comparações para determinar se eles correspondem. Se essa etapa é fácil ou difícil depende do poder de resolução do sistema para distinguir alelos. Alguns métodos de tipagem de DNA envolvem pequenas coleções de alelos que podem ser perfeitamente distinguidos uns dos outros & mdashe.g., Um sistema RFLP de dois alelos baseado em um polimorfismo em um único locus. Outros métodos envolvem grandes coleções de alelos semelhantes que são imperfeitamente distinguidos uns dos outros & mdashe.g., O VNTR hipervariável

sistemas de uso forense comum, nos quais uma única amostra pode produzir tamanhos de alelos um tanto diferentes em medições repetidas. 1 É fácil determinar se duas amostras correspondem no primeiro caso (assumindo que os padrões foram identificados corretamente), mas o último caso requer um critério de correspondência & mdashi.e., Uma regra objetiva e quantitativa para decidir se duas amostras correspondem. Por exemplo, um critério de correspondência para sistemas VNTR pode declarar uma correspondência entre duas amostras se os tamanhos dos fragmentos de restrição estiverem dentro de 3% um do outro.

O critério de correspondência deve ser baseado na variabilidade real na medição observada em experimentos de teste apropriados conduzidos em cada laboratório de teste. O critério deve ser objetivo, preciso e aplicado de maneira uniforme. Se duas amostras estiverem fora da regra de correspondência, elas devem ser declaradas "inconclusivas" ou "não correspondentes". Uma controvérsia considerável surgiu nos primeiros casos sobre o uso de regras de correspondência subjetivas (por exemplo, comparação visual) e a falha em aderir a uma regra de correspondência declarada.

Identificação de artefatos potenciais

Todos os procedimentos laboratoriais estão sujeitos a artefatos potenciais, que podem levar a interpretações incorretas se não forem reconhecidos. Consequentemente, cada método de tipagem de DNA deve ser rigorosamente caracterizado com relação aos tipos de artefatos possíveis, as condições em que eles podem ocorrer, os controles científicos para detectar sua ocorrência e as etapas a serem tomadas quando eles ocorrem, que podem variar desde a reinterpretação dos resultados até a correção da presença de artefatos, a repetição de alguma parte do experimento ou a decisão de que as amostras podem ser usadas de forma confiável.

Independentemente do método de tipagem de DNA específico, os artefatos podem alterar um padrão de três maneiras: o Padrão A pode ser transformado no Padrão B, o Padrão A pode ser transformado no Padrão A + B e o Padrão A + B pode ser transformado no Padrão B. É importante identificar as circunstâncias em que cada transformação pode ocorrer, porque só então os controles e as correções podem ser planejados. Por exemplo, a análise de RFLP está sujeita a artefatos como deslocamento de banda, em que as amostras de DNA migram em velocidades diferentes e produzem padrões alterados (A & rarrB) e digestão incompleta, em que a falha de uma enzima de restrição em clivar em todos os locais de restrição resulta em bandas adicionais (A & rarrA + B).

Alguns problemas potenciais podem ser identificados com base na química do DNA e no mecanismo de detecção no sistema de tipagem genética. A antecipação de fontes potenciais de erro de tipagem de DNA permite uma investigação empírica sistemática para determinar se existe um problema na prática. Nesse caso, a gama de condições nas quais um ensaio está sujeito a artefato deve ser caracterizada. Em ambos os casos, os resultados do teste de artefatos devem ser documentados. O teste empírico é necessário, quer se esteja considerando um novo método, um novo locus, um novo conjunto de reagentes (sonda ou enzima) para um

locus pré-existente ou um novo dispositivo. Em algumas circunstâncias, mesmo pequenas mudanças no procedimento podem alterar o padrão dos artefatos.

Uma vez que os artefatos potenciais tenham sido identificados, é necessário projetar controles científicos para servir como verificações internas em cada experimento para testar se os artefatos ocorreram. Uma vez que os controles apropriados são identificados, os analistas devem usá-los consistentemente ao interpretar os resultados dos testes. Se o controle apropriado não tiver sido executado, nenhum resultado deve ser relatado. Quando um controle indica irregularidades em um experimento, os resultados em questão devem ser considerados inconclusivos, se possível, o experimento deve ser repetido. Um teste de tipagem de DNA bem planejado deve ser uma questão de análise padronizada e objetiva.

Sensibilidade à Quantidade, Mistura e Contaminação

As amostras de evidências podem conter muito pouco DNA, podem conter uma mistura de DNA de várias fontes e podem estar contaminadas com produtos químicos que podem interferir na análise. É essencial compreender os limites de cada método de tipagem de DNA em tais circunstâncias.

Fundação Experiencial

Antes que um novo método de tipagem de DNA possa ser usado, ele requer não apenas uma base científica sólida, mas também uma base sólida de experiência em aplicação forense. Tradicionalmente, os cientistas forenses aplicam cinco etapas para a implementação de sistemas de marcadores genéticos: 2, 3

Ganhe familiaridade com um sistema usando amostras novas.

Teste a sobrevivência do marcador em manchas secas (por exemplo, manchas de sangue).

Teste o sistema em amostras de evidências simuladas que foram expostas a uma variedade de condições ambientais.

Estabeleça competência básica no uso do sistema por meio de testes cegos.

Teste o sistema em amostras de evidências não probatórias cuja origem seja conhecida, como uma verificação de confiabilidade.

Quando uma técnica é desenvolvida inicialmente, todas as cinco etapas devem ser seguidas cuidadosamente. Como os laboratórios adotam a técnica, nem sempre será necessário que eles repitam todas as etapas, mas devem demonstrar familiaridade e competência seguindo as etapas 1, 4 e 5. 4

Mais importante, não há substituto para testes de proficiência externa rigorosos por meio de testes cegos. Esses ensaios de proficiência constituem a confirmação científica de que a implementação de um método por um laboratório é válida não apenas na teoria, mas também na prática. Nenhum laboratório deve permitir que seus resultados com um novo método de tipagem de DNA sejam usados ​​no tribunal, a menos que tenha passado por tais testes de proficiência por meio de testes cegos. (Consulte o Capítulo 4 para uma discussão sobre os testes de proficiência.)

Publicação e escrutínio científico

Se um novo método de tipagem de DNA (ou uma variação substancial de um existente) for usado no tribunal, a publicação e o escrutínio científico são muito importantes. Uma extensa caracterização empírica deve ser realizada. Os resultados devem ser publicados em periódicos científicos apropriados. A publicação é o mecanismo que inicia o processo de confirmação científica e eventual aceitação ou rejeição de um método.

Algumas das controvérsias a respeito do uso forense da tipagem de DNA podem ser atribuídas à falha em publicar uma explicação detalhada e justificativa dos métodos. Sem o benefício do escrutínio científico aberto, alguns laboratórios de teste inicialmente usaram métodos (para etapas fundamentais como identificar padrões, declarar correspondências, fazer comparação com um banco de dados e corrigir o deslocamento de banda) que, mais tarde, concordaram que não tinham suporte experimental. Em alguns casos, esses erros resultaram na exclusão de provas de DNA ou na rejeição de acusações.

QUESTÕES TÉCNICAS NA ANÁLISE DE RFLP

Escolha de sondas

Uma sonda de DNA usada em aplicações forenses deve ter as seguintes propriedades:

Ele deve reconhecer um único locus (ou sítio) humano, de preferência um cuja localização cromossômica tenha sido determinada.

Deve detectar um número constante de bandas por alelo na maioria dos humanos.

Deve ser caracterizado na literatura publicada, incluindo sua gama típica de alelos e sua tendência de reconhecer DNA de outras espécies.

Deve estar prontamente disponível para estudo científico por qualquer pessoa interessada.

O comitê não recomenda o uso forense de sondas multilocus, que detectam muitos fragmentos por pessoa. Como tais sondas podem detectar fragmentos com intensidades bastante diferentes, é difícil saber se alguém detectou todos os fragmentos em uma amostra - especialmente com amostras forenses pequenas e degradadas - e difícil de reconhecer artefatos e misturas. Esses problemas aumentam a dificuldade de interpretação do padrão. As sondas multilocus aumentam o risco de interpretação incorreta, e várias sondas de locus único, que não apresentam tais problemas, estão disponíveis. O uso de sondas de locus único suficiente ganha as vantagens das sondas multilocus simples sem problemas de interpretação.

Preparação Southern Blot

O protocolo básico para a preparação de Southern blots é razoavelmente padrão, mas os laboratórios de teste variam em questões como escolha da enzima de restrição, comprimento e composição do gel e condições de eletroforese. Essas diferenças não afetam fundamentalmente a confiabilidade do método geral, mas algumas enzimas podem requerer caracterização (por exemplo, cada enzima de restrição deve ser caracterizada quanto à sensibilidade aos inibidores, à tendência de corte em locais de reconhecimento anômalos sob algumas condições & mdash frequentemente chamado de "atividade estelar" & mdashand para a tendência de produzir digestões parciais), e as diferenças nas condições de géis e eletroforese afetarão a resolução de fragmentos e a retenção de pequenos fragmentos.

Surgiram dúvidas em relação ao uso do brometo de etídio, um corante fluorescente que se liga ao DNA e assim permite sua visualização. Alguns laboratórios incorporam brometo de etídio em géis analíticos antes da eletroforese, outros coram os géis com brometo de etídio após a eletroforese. O comitê recomenda fortemente o último, por duas razões:

O brometo de etídio liga-se ao DNA de uma maneira dependente da concentração e demonstrou alterar a mobilidade dos fragmentos em altas concentrações de DNA, diminuindo assim a confiabilidade das medições do tamanho do fragmento.

A coloração após a eletroforese requer quantidades menores de brometo de etídio, e isso é preferível, porque o corante é um carcinógeno conhecido e, portanto, apresenta problemas de exposição e descarte.

Como existem várias vantagens e nenhuma desvantagem para a coloração após a eletroforese, concluímos que não há justificativa atual para o uso de brometo de etídio em géis analíticos.

Identificação de padrões de DNA

Identification of the DNA pattern of each sample should be carried out very carefully. When analyzed with a single-locus probe, each lane will ideally show at the most fragments derived from two alleles and nothing else. However, complications can arise. To interpret such complications properly, an examiner requires considerable knowledge and skill and might need to examine control experiments.

Examination of a Control Pattern

Every Southern blot procedure should be applied to a known DNA sample (in addition to the evidence samples in question), to verify that the hybridization was performed correctly. If this control sample does not yield

a clean result that shows the correct pattern for a particular hybridization, the result of the test hybridization should be discounted.

Single-Band Patterns

Sometimes, only a single band will be detected when two distinct alleles are present. That might occur because the second allele is so small that it has migrated off the end of the gel, because the second allele is similar in size to the first allele and thus is not resolved, or because the second allele is much larger, and larger fragments are preferentially lost in partially degraded samples.

When only a single band is found, the interpretation should always include the possibility that a second band has been missed&mdashi.e., that the pattern is actually of a heterozygote, not a homozygote. (For statistical interpretation, the frequency of a single-band pattern should be taken to be the sum of the frequencies of all patterns containing this band. This is approximately twice the allele frequency of the band.) In some cases, it could be important to interpret the absence of a second larger fragment&mdashe.g., when two samples match in a smaller band, but the questioned sample lacks a second larger band. That could arise either because the samples are from different persons or because the samples come from the same person but the questioned sample is partially degraded. Ideally, to distinguish these alternatives, one should determine whether a second larger band poderia have been detected in the questioned sample by hybridizing the membrane with a single-copy probe that detects an even larger monomorphic fragment&mdashi.e., one that is constant in all humans. In contrast, it would not be sufficient simply to estimate the degree of degradation from the ethidium bromide staining pattern of the sample.

Anomalous Bands

A sample might show more than two bands for various reasons. E.g., the hybridization conditions were improper and caused the probe to hybridize to incorrect fragments the probe was contaminated with another sequence, which caused it to recognize other fragments the membrane was incompletely stripped after a previous use, so a pattern seen on the previous hybridization is still being detected the restriction digestion did not proceed to completion, so the region recognized by the probe is present in incompletely cut fragments of multiple sizes or the sample actually contains a mixture of multiple DNAs. The last example is extremely important to recognize, because it can bear importantly on a case. Whenever extra bands are observed, their origin should be determined.

The following clues provide a partial decision tree:

If the hybridization conditions were improper or the probe contaminated, the pattern in the control DNA should be seen to be incorrect the hybridization should be repeated.

If the membrane was improperly stripped, the extra bands will be in the same location as in the previous hybridization and might be present in the control sample the hybridization should be repeated.

If the restriction digestion was incomplete, one should see additional bands, even with the use of monomorphic probes that typically give only a single constant band. To ascribe extra bands to incomplete digestion, one should therefore perform such a hybridization. If incomplete digestion has occurred, the sample ideally should be re-extracted and redigested, and a new Southern blot should be prepared. If that is not possible, because there is too little sample, it will usually be difficult to get a reliable result.

If the samples are mixtures from more than one person, one should see additional bands for all or most polymorphic probes, but not for a single-copy monomorphic probe. Mixed samples can be very difficult to interpret, because the components can be present in different quantities and states of degradation. It is important to examine the results of multiple RFLPs, as a consistency check. Typically, it will be impossible to distinguish the individual genotypes of each contributor. If a suspect's pattern is found within the mixed pattern, the appropriate frequency to assign such a "match" is the sum of the frequencies of all genotypes that are contained within (i.e., that are a subset of) the mixed pattern.

Another possible cause of extra bands is leakage between adjacent sample lanes or misloading of two samples in a single lane. Such an occurrence can be exceedingly difficult to detect and could result in an incorrect conclusion. It is therefore important to leave a blank lane between a suspect sample and an evidence sample, so that leakage can be detected and will not lead to false-positive results.

Reporting of Anomalies

Examiners should document their interpretations of samples thoroughly in writing. They should note all observed bands and any questionable densities that they do not consider to be bands. Anomalous bands should be explained on the basis of appropriate control experiments of the sorts described above.

Measurement of Fragments

Molecular-weight measurements of fragments should initially be made by comparing band positions with known molecular-weight standards run in separate lanes on the same gel (so-called external molecular-weight stan-

dards). Measurements should be performed with a computer-assisted or computer-automated system, in which the operator identifies the positions of the bands with a digitizing pen or similar device that directly records them, visually inspects them, or both. Computer-based procedures ensure appropriate documentation of the measurement and promote objectivity.

External molecular-weight standards alone, however, are not sufficient, because anomalies in electrophoresis can lead to errors in RFLP typing caused by band shifting. 5 Such anomalies can be due to differences in salt or DNA concentrations among samples (which could be corrected by repeated extraction) or to covalent or noncovalent modifications of the DNA (which might be irreversible). Band shifting could cause two DNA samples from one person to show different patterns or DNA samples from two different persons to show the same pattern. Band shifting also makes it impossible to measure fragment sizes relative to external molecular-weight standards, because the standards have migrated at a different speed.

Band shifting is easy to detect by hybridizing the Southern blot with monomorphic probes&mdashthat is, probes that detect constant-length fragments that are always in the same position in all people. If several monomorphic fragments are in the same position in both lanes, it is safe to assume that no band shifting has occurred. If the monomorphic fragments are in different positions, band shifting is present. The committee considers it desirable for all samples to be tested for band shifting by hybridization with monomorphic probes that cover a wide range of fragment sizes in the gel. That approach will eliminate the rare production of a match by shifting of bands in an evidence sample to the same positions as in a suspect sample. Testing laboratories now investigate the possibility of band shifting only when they find two samples with patterns that appear to be similar but shifted relative to one another. (Multiple monomorphic probes might not be available for some systems and might need to be developed.)

Testing for band shifting is easy, but correcting it is harder. The best approach is to clean the samples (by re-extraction, dialysis, or other measures) and repeat the experiment in the hope of avoiding band shifting. When that is impossible because too little sample is available or it fails (perhaps because of covalent modification of the DNA), it is possible in principle to determine the molecular weights of polymorphic fragments in a sample by comparing them with monomorphic human bands in the same lane&mdashso-called internal molecular-weight standards. These monomorphic fragments are expected to have undergone the same band shift, so they should provide an accurate internal ruler for measurement. (Note that the polymorphic fragments and the internal molecular-weight standards are visualized on separate hybridizations, but can be superimposed on one another, if the external molecular-weight standards are used to align the gels.)

In practice, however, the use of internal standards presents serious dif-

ficulties. Accurate size determination requires a number of internal standards. If band shifting caused all fragments to change their mobility by the same percentage, one would need only a single monomorphic fragment to determine the extent of shift. But band shifting appears to be more complex than that. Different regions of the gel shift by different amounts.

Little has been published on the nature of band shifting, on the number of monomorphic internal control bands needed for reliable correction, and on the accuracy and reproducibility of measurements made with such correction. For the present, several laboratories have decided against attempting quantitative corrections samples that lie outside the match criterion because of apparent band shifting are declared to be "inconclusive." The committee urges further study of the problems associated with band shifting. Until testing laboratories have published adequate studies on the accuracy and reliability of such corrections, we recommend that they adopt the policy of declaring samples that show apparent band shifting to be "inconclusive." The committee recommends that all measurement data be made readily available, including the computer-based images and records. Any analytical software for image processing or molecular-weight determination should also be readily available. All fragment sizes for both known and questioned samples should be clearly listed on the formal report of the testing laboratory.

Match Criteria

Current RFLP-based tests use VNTR probes that have dozens of closely spaced alleles. On the one hand, the high degree of polymorphism increases the power of the test to detect differences among persons. On the other hand, the large number of alleles increases the complexity of matching samples, because gels have little ability to resolve nearby alleles (which can differ by as little as 9 basepairs, so that, for practical purposes, the distribution of alleles can appear to be continuous).

Because of the limited resolution, two samples from a single person will often lead to slightly different measurements&mdashe.g., 3.00 and 2.45 kilo-bases (kb) in one case, 3.03 and 2.40 kb in another. To decide whether two samples match, each laboratory must have a match criterion. 6 The match criterion should provide an objective and quantitative rule for deciding whether two patterns match&mdashe.g., all fragments must lie within 2% of one another. When samples fall outside the match criterion, they should be declared to be "inconclusive" or "nonmatching."

The match criterion must be based on reproducibility studies that show the actual degree of variability observed when multiple samples from the same person are separately prepared and analyzed under typical forensic


Materiais e métodos

Definition of DNAm age using a penalized regression model

Using the training data sets, I used a penalized regression model (implemented in the R package glmnet [45]) to regress a calibrated version of chronological age on 21,369 CpG probes that a) were present both on the Illumina 450K and 27K platform and b) had fewer than 10 missing values. The alpha parameter of glmnet was chosen to 0.5 (elastic net regression) and the lambda value was chosen using cross-validation on the training data (lambda = 0.0226). DNAm age was defined as predicted age. Mathematical details are provided in Additional file 2.

Short description of the healthy tissue data sets

All data are publicly available (Additional file 1). Many data sets involve normal adjacent tissue from TCGA. Details on the individual data sets can be found in Additional file 2. To give credit to the many researchers who generated the data, I briefly mention relevant citations. Data sets 1 and 2 (whole blood samples from a Dutch population) were generated by Roel Ophoff and colleagues [14]. Data set 3 (whole blood) consists of whole blood samples from a recent large scale study of healthy individuals [24]. The authors used these and other data to estimate human aging rates and developed a highly accurate predictor of age based on blood data. Data set 4 consists of leukocyte samples from healthy male children from Children’s Hospital Boston [46]. Data set 5 consists of peripheral blood leukocyte samples [47]. Data set 6 consists of cord blood samples from newborns [30]. Data set 7 consists of cerebellum samples, which were provided by C Liu and C Chen (Gene Expression Omnibus (GEO) identifier GSE38873). Data sets 8, 9, 10, and 13 consist of cerebellum, frontal cortex, pons, and temporal cortex samples, respectively, obtained from the same subjects [48]. Data set 11 consists of prefrontal cortex samples from healthy controls [22]. Data set 12 consists of neuron and glial cell samples from [49]. Data set 14 consists of normal breast tissue samples [50]. Data set 15 consists of buccal cells from 109 15-year-old adolescents from a longitudinal study of child development [51]. Data set 16 consists of buccal cells from eight different subjects [15]. Data set 17 consists of buccal cells from monozygotic (MZ) and dizygotic (DZ) twin pairs from the Peri/postnatal Epigenetic Twins Study (PETS) cohort [52]. Data set 18 consists of cartilage (chondrocyte) samples from [53]. Data set 19 normal consists of adjacent colon tissue from TCGA. Data set 20 consists of colon mucosa samples from [54]. Data set 21 consists of dermal fibroblast samples from [21]. Data set 22 consists of epidermis samples from [55]. Data set 23 consists of gastric tissue samples from [56]. Data set 24 consists of head/neck normal adjacent tissue samples from TCGA (HNSC data). Data set 25 consists of heart tissue samples from [57]. Data set 26 consists of normal adjacent renal papillary tissue from TCGA (KIRP data). Data sets 27 consists of normal adjacent tissue from TCGA (KIRC data). Data set 28 consists of normal adjacent liver samples from [58]. Data set 29 consists of normal adjacent lung tissue from TCGA (LUSC data). Data set 30 consists of normal adjacent lung tissue samples from TCGA (LUAD data). Data set 31 is from TCGA (LUSC). Data set 32 consists of mesenchymal stromal cells isolated from bone marrow [59]. Data set 33 consists of placenta samples from mothers of monozygotic and dizygotic twins [60]. Data set 34 consists of prostate samples from [61]. Data set 35 consists of normal adjacent prostate tissue from TCGA (PRAD data). Data set 36 consists of male saliva samples from [62]. Data set 37 consists of male saliva samples from [23]. Data set 38 consists of stomach from TCGA (STAD data). Data set 39 consists of thyroid TCGA (THCA data). Data set 40 consists of whole blood from type 1 diabetics [10, 63]. Data set 41 consists of whole blood from [15]. Data sets 42 and 43 consist of involve whole blood samples from women with ovarian cancer and healthy controls, respectively these are the samples from the United Kingdom Ovarian Cancer Population Study [10, 63]. Data set 44 consists of whole blood from [64]. Data set 45 consists of leukocytes from healthy children of the Simons Simple Collection [46]. Data set 46 consists of peripheral blood mononuclear cells from [65]. Data set 47 consists of peripheral blood mononuclear cells from [66]. Data set 48 consists of cord blood samples from newborns provided by N Turan and C Sapienza (GEO GSE36812). Data set 49 consists of cord blood mononuclear cells from [67]. Data set 50 consists of cord blood mononuclear cells from [60]. Data set 51 consists of CD4 T cells from infants [68]. Data set 52 consists of CD4+ T cells and CD14+ monocytes from [15]. Data set 53 consists of immortalized B cells and other cells from progeria, Werner syndrome patients, and controls [69]. Data sets 54 and 55 are brain samples from [70]. Data sets 56 and 57 consist of breast tissue from TCGA (27K and 450K platforms, respectively). Data set 58 consists of buccal cells from [71]. Data set 59 consists of colon from TCGA (COAD data). Data set 60 consists of fat (adipose) tissue from [72]. Data set 61 consists of human heart tissue from [27]. Data set 62 consists of kidney (normal adjacent) tissue from TCGA (KIRC). Data set 63 consists of liver (normal adjacent tissue) from TCGA (LIHC data). Data set 64 consists of lung from TCGA. Data set 65 consists of muscle tissue from [72]. Data set 66 consists of muscle tissue from [73]. Data set 67 consists of placenta samples from [74]. Data set 68 consists of female saliva samples [62]. Data set 69 consists of uterine cervix samples from [50, 75]. Data set 70 consists of uterine endometrium (normal adjacent) tissue from TCGA (UCEC data). Data set 71 consists of various human tissues from the ENCODE/HAIB Project (GEO GSE40700). Data set 72 consists of chimpanzee and human tissues from [27]. Data set 73 consists of great ape blood samples from [28]. Data set 74 consists of sperm samples from [76]. Data set 75 consists of sperm samples from [77]. Data set 76 consists of vascular endothelial cells from human umbilical cords from [60]. Data sets 77 and 78 (special cell types) involve human embryonic stem cells, iPS cells, and somatic cell samples measured on the Illumina 27K array and Illumina 450K array, respectively [78]. Data set 79 consists of reprogrammed mesenchymal stromal cells from human bone marrow (iP-MSC), initial mesenchymal stromal cells, and embryonic stem cells [79]. Data set 80 consists of human ES cells and normal primary tissue from [80]. Data set 81 consists of human ES cells from [81]. Data set 82 consists of blood cell type data from [82].

Description of the cancer data sets

An overview of the cancer tissue and cancer cell line data sets is provided in Additional file 12. More details can be found in Additional file 2.

All data are publicly available as can be seen from the column that reports GSE identifiers from the GEO database and other online resources. Most cancer data sets came from TCGA. Data set 3, GBM from [44] data set 4, breast cancer from [83] data set 5, breast cancer from [84] data set 6, breast cancer from [50] data set 10, colorectal cancer from [39] data set 23, prostate cancer from [61] data set 30, urothelial carcinoma from [85].

DNA methylation profiling and normalization steps

All of the public Illumina DNA data were generated by following the standard protocol of Illumina methylation assays, which quantifies DNA methylation levels by the β value. A detailed description of the pre-processing and data normalization steps is provided in Additional file 2.

Meta analysis for measuring pure age effects (irrespective of tissue type)

I used the metaAnalysis R function in the WGCNA R package [86] to measure pure age effects (Additional file 9) as detailed in Additional file 2.

Analysis of variance for measuring tissue variation

To measure tissue effects in the training data (Additional file 8), I used analysis of variance (ANOVA) to calculate an F statistic as follows. First, a multivariate regression model was used to regress each CpG (dependent variable) on age and tissue type. The analysis adjusted for age since the different data sets have very different mean ages (Additional file 1). Next, ANOVA based on the multivariate regression model was used to calculate an F statistic, F.tissueTraining, for measuring the tissue effect in the training data. This F statistic measures the tissue effect after adjusting for age in the training data sets. I did not translate the F statistic into a corresponding P-value since the latter turned out to be extremely significant for most CpGs. Additional file 8D shows that F.tissueTraining is highly correlated with an independent measure of tissue variance (defined using adult somatic tissues from data set 77).

Characterizing the CpGs using sequence properties

I studied occupancy counts for Polycomb-group target (PCGT) genes since they have an increased chance of becoming methylated with age compared to non-targets [10]. Toward this end, I used the occupancy counts of Suz12, Eed, and H3K27me3 published in [87]. To obtain the protein binding site occupancy throughout the entire nonrepeat portion of the human genome, Lee et al. [87] isolated DNA sequences bound to a particular protein of interest (for example, Polycomb-group protein SUZ12) by immunoprecipitating that protein (chromatin immunoprecipitation) and subsequently hybridizing the resulting fragments to a DNA microarray. More details on the chromatin state data from [29] can be found in Additional file 2.


For more information about genetic testing procedures:

The National Society of Genetic Counselors offers an overview of the genetic testing process.

A brief overview of how genetic testing is done is also available from The National Cancer Institute.

The Genetic Science Learning Center at the University of Utah provides an interactive animation of DNA extraction techniques.


Conceitos-chave e resumo

Grupos funcionais are structural units within organic compounds that are defined by specific bonding arrangements between specific atoms. Organic chemist learn to correlate functional groups to the chemistry that they do. For example, any molecule that contains a carboxylic acid, will be able to do an acid-base reaction when mixed with a base. This allows the organic chemist to have a sense of the various chemistry a compound can or cannot do based on the functional groups that are present in the structure.

Activity

Make yourself a stack of small sized Qcards. On one side have the name of the functional group (e.g. alcohol) and on the other side have its structure (see Table 1). Make a complete set of all the functional groups you should know (see Table 1). You can even include some compounds like those below in exercise 1 – on one side of the card have the compound, on the other the names of the functional groups. Then use these Qcards to quiz yourself. This will help you recognize the functional groups in larger compounds.

Exercises

1. Answer the following questions for each of these compounds.

a) Name the circled functional groups: A = ?, B =?, C = ?

b) What is the chemical formula of the compound?

c) How many lone pairs are there in the compound?

Phenylpropanolamine is a psychoactive drug which is used as a stimulant and decongestant in prescription and over-the-counter cough and cold medicines.

Triiodothyronine is a thyroid hormone which affects many physiological processes in the body, such as growth, metabolism and heart rate.

Aldosterona is a hormone which is involved in the function of the kidneys.

Efedrina is a drug commonly used as a stimulant, decongestant and also as a concentration aid.

Clomifene is mainly used for ovarian stimulation in female infertility which is due to anomulation.

2. Among the five compounds listed in question 1, which would do an acid-base reaction when mixed with sodium hydroxide (which is a base).

Phenylpropanolamine:

a) A = Primary Amine, B = Secondary Alcohol, C = Arene

c) 3 lone pairs – one on the nitrogen and two on the oxygen

Triiodothyronine:

a) A = Carboxylic Acid, B = Ether, C = Primary Amine

c) 18 lone pairs – one on each nitrogen, two on each oxygen, and three on each iodine

Aldosterone:

a) A = Secondary Alcohol, B = Aldehyde, C = Ketone

c) 10 lone pairs – two on each oxygen

a) A = Secondary Amine, B = Secondary Alcohol, C = Arene

c) 3 lone pairs – one on the nitrogen and two on the oxygen

a) A = Arene, B = Ether, C = Tertiary Amine

c) 6 lone pairs – one on the nitrogen, two on the oxygen, and three on the chlorine

2. Any molecule that contains a carboxylic acid, will be able to do an acid-base reaction when mixed with a base. Therefore among the five compounds in question 1, the only one that has a carboxylic acid is Triiodothyronine.


Applications of DNA fingerprinting:

Using the DNA fingerprinting method, the biological identity of a person can be revealed. For validating one’s identity, there is no other better option than DNA fingerprinting.

Badly damaged dead bodies can be identified.

It is used to detect maternal cell contamination.

One of the major drawbacks of prenatal diagnosis is maternal cell contamination. The amniotic fluid or CVS sample contains the maternal DNA or maternal tissue, sometimes.

Contamination increases the chance of false-positive results, especially in the case of carrier identification.

Using VNTRs and STRs markers with PCR-gel electrophoresis, maternal cell contamination can be identified during pregnancy genetic testing.

The image represents the VNTR profile for a family to know the maternal cell contamination.

One of the most important applications of the present technique is in the crime scene investigation and criminal verification.

The sample is collected from the crime site which could be saliva, blood, hair follicle, or semen. DNA is extracted and analyzed against the suspect, using the two markers we explained above. By matching DNA band patterns criminal’s link to crime can be established.

Different countries have different criteria to use STRs. 13, 11 and 12 STRs are commonly used in criminal verification in the USA, UK, and India, respectively. As the number of STR markers increases the accuracy of the result also increases.

Identification of blood relatives:

No two individuals are genetically identical. To establish or to know blood relation between two unrelated individuals, the present method is adopted.

Besides these, the present method is often employed for checking graft rejection in case of organ transplantation. Known as HLA typing, different markers of HLA region genes are amplified and matched between donor and recipient.

The exact match score indicates graft acceptance. This means an organ can be transplanted.

Moreover, scientists use the present method to screen inherited & non-inherited disease, to find genetic abnormalities, to detect any genetic disorders or mutations, and to create phylogeny between various organisms.


Identification of linked traits

It is often possible to correlate, or link, an allele of a molecular marker with a particular disease or other trait of interest. One way to make this correlation is to obtain genomic DNA samples from hundreds of individuals with a particular disease, as well as samples from a control population of healthy individuals. The genotype of each individual is scored at hundreds or thousands of molecular marker loci (e.g. SNPs), to find alleles that are usually present in persons with the disease, but not in healthy subjects. The molecular marker is presumed to be tightly linked to the gene that causes the disease, although this protein-coding gene may itself be as yet unknown. The presence of a particular molecular polymorphism may therefore be used to diagnose a disease, or to advise an individual of susceptibility to a disease.

Molecular markers may also be used in a similar way in agriculture to track desired traits. For example, markers can be identified by screening both the traits and molecular marker genotypes of hundreds of individuals. Markers that are linked to desirable traits can then be used during breeding to select varieties with economically useful combinations of traits, even when the genes underlying the traits are not known.


Assista o vídeo: Teste de Paternidade - Flashdica #37 - Maratona Enem - Prof. Gui (Janeiro 2022).