Em formação

Ação da insulina e da leptina nos neurônios anorexígenos do hipotálamo?


Os receptores de insulina estão presentes no fígado, tecido adiposo e músculos. Além disso, existem receptores de insulina presentes no núcleo arqueado do hipotálamo, que influenciam os neurônios anorexogênicos por meio da sinalização de IRS2 e PI-3K. Eles também causam a inibição da ingestão de alimentos, aumentando a expressão de POMC e clivando sua proteína em hormônio estimulador alfa melanocortio (αMSH). Esta é, no entanto, a mesma resposta produzida pela liberação de "LEPTINA", que age nos neurônios anorexogênicos, e interrompe o comportamento alimentar - da mesma forma que a produção de insulina (αMSH).

Minha pergunta é: por que a insulina vai para o cérebro e produz esse efeito quando havia leptina disponível para fazer a mesma tarefa? Qual é o significado da ação da insulina aqui?


A insulina excita neurônios anorexigênicos pró-opiomelanocortina por meio da ativação de canais potenciais do receptor transiente canônico

Neurônios de proopiomelanocortina (POMC) dentro do núcleo arqueado do hipotálamo são neurônios anorexígenos vitais. Embora tanto os receptores de leptina quanto de insulina estejam acoplados à ativação da fosfatidilinositídeo 3 quinase (PI3K) em neurônios POMC, acredita-se que eles tenham ações díspares na excitabilidade de POMC. Usando o registro de células inteiras e ferramentas farmacológicas seletivas, descobrimos que, semelhante à leptina, a insulina purificada despolarizou POMC e neurônios kisspeptina adjacentes via ativação de canais TRPC5, que são altamente expressos nesses neurônios. Em contraste, a insulina hiperpolarizou e inibiu os neurônios NPY / AgRP via ativação de KATP canais. Além disso, o Zn 2+, que é encontrado em formulações de insulina em concentrações nanomolares, inibiu os neurônios POMC por meio da ativação de KATP canais. Finalmente, como previsto, a insulina administrada por via intracerebroventricamente inibiu a ingestão de alimentos e ativou a expressão de c-fos em neurônios POMC arqueados. Nossos resultados mostram que a insulina purificada excita os neurônios POMC no núcleo arqueado, o que propomos ser o principal mecanismo pelo qual a insulina regula a homeostase energética.


PI3K integra a ação da insulina e leptina nos neurônios hipotalâmicos

1 Departamentos de Genética e Pediatria, Escola de Medicina da Universidade de Stanford, Stanford, Califórnia, EUA. 2 Instituto de Pesquisa para Doenças Microbianas, Universidade de Osaka, Osaka, Japão. 3 Departamento de Medicina, Harborview Medical Center, University of Washington, Seattle, Washington, EUA.

Endereço para correspondência: Gregory S. Barsh, Departamentos de Genética e Pediatria, Escola de Medicina da Universidade de Stanford, Stanford, Califórnia, EUA. Telefone: (650) 723-5035 Fax: (650) 723-1399 E-mail: [email protected]

1 Departamentos de Genética e Pediatria, Escola de Medicina da Universidade de Stanford, Stanford, Califórnia, EUA. 2 Instituto de Pesquisa para Doenças Microbianas, Universidade de Osaka, Osaka, Japão. 3 Departamento de Medicina, Harborview Medical Center, University of Washington, Seattle, Washington, EUA.

Endereço para correspondência: Gregory S. Barsh, Departamentos de Genética e Pediatria, Escola de Medicina da Universidade de Stanford, Stanford, Califórnia, EUA. Telefone: (650) 723-5035 Fax: (650) 723-1399 E-mail: [email protected]

1 Departamentos de Genética e Pediatria, Escola de Medicina da Universidade de Stanford, Stanford, Califórnia, EUA. 2 Instituto de Pesquisa para Doenças Microbianas, Universidade de Osaka, Osaka, Japão. 3 Departamento de Medicina, Harborview Medical Center, University of Washington, Seattle, Washington, EUA.

Endereço para correspondência: Gregory S. Barsh, Departamentos de Genética e Pediatria, Escola de Medicina da Universidade de Stanford, Stanford, Califórnia, EUA. Telefone: (650) 723-5035 Fax: (650) 723-1399 E-mail: [email protected]

1 Departamentos de Genética e Pediatria, Escola de Medicina da Universidade de Stanford, Stanford, Califórnia, EUA. 2 Instituto de Pesquisa para Doenças Microbianas, Universidade de Osaka, Osaka, Japão. 3 Departamento de Medicina, Harborview Medical Center, University of Washington, Seattle, Washington, EUA.

Endereço para correspondência: Gregory S. Barsh, Departamentos de Genética e Pediatria, Escola de Medicina da Universidade de Stanford, Stanford, Califórnia, EUA. Telefone: (650) 723-5035 Fax: (650) 723-1399 E-mail: [email protected]

1 Departamentos de Genética e Pediatria, Escola de Medicina da Universidade de Stanford, Stanford, Califórnia, EUA. 2 Instituto de Pesquisa para Doenças Microbianas, Universidade de Osaka, Osaka, Japão. 3 Departamento de Medicina, Harborview Medical Center, University of Washington, Seattle, Washington, EUA.

Endereço para correspondência: Gregory S. Barsh, Departamentos de Genética e Pediatria, Escola de Medicina da Universidade de Stanford, Stanford, Califórnia, EUA. Telefone: (650) 723-5035 Fax: (650) 723-1399 E-mail: [email protected]

Encontre artigos de Schwartz, M. em: JCI | PubMed | Google Scholar

1 Departamentos de Genética e Pediatria, Escola de Medicina da Universidade de Stanford, Stanford, Califórnia, EUA. 2 Instituto de Pesquisa para Doenças Microbianas, Universidade de Osaka, Osaka, Japão. 3 Departamento de Medicina, Harborview Medical Center, University of Washington, Seattle, Washington, EUA.

Endereço para correspondência: Gregory S. Barsh, Departamentos de Genética e Pediatria, Escola de Medicina da Universidade de Stanford, Stanford, Califórnia, EUA. Telefone: (650) 723-5035 Fax: (650) 723-1399 E-mail: [email protected]

O controle central do balanço energético depende da capacidade dos neurônios hipotalâmicos da próopiomelanocortina (POMC) ou da proteína relacionada à cutia (Agrp) em sentir e responder às mudanças nos estoques de energia periféricos. A leptina e a insulina têm sido implicadas como indicadores circulantes de adiposidade, mas não está claro como as mudanças em seus níveis são percebidas ou integradas por subtipos neuronais individuais. Nós desenvolvemos camundongos nos quais um repórter fluorescente para a atividade de PI3K é direcionado para neurônios Agrp ou POMC e usamos microscopia de 2 fótons para medir a regulação dinâmica de PI3K pela insulina e leptina em fatias do cérebro. Mostramos que a leptina e a insulina atuam em paralelo para estimular PI3K em neurônios POMC, mas de maneiras opostas em neurônios Agrp. Esses resultados sugerem uma nova visão do circuito hipotalâmico, em que os efeitos da leptina e da insulina são integrados por neurônios anorexigênicos, mas não por orexígenos.

O controle da homeostase energética requer que o sistema nervoso central sinta e responda às mudanças nos estoques de energia periféricos. Entre os neurônios de primeira ordem sugeridos até o momento estão aqueles encontrados no núcleo arqueado do hipotálamo que expressam a proopiomelanocortina (POMC) ou a proteína agouti-relacionada (Agrp), neuropeptídeos que promovem balanço energético negativo e positivo, respectivamente. A atividade desses neurônios é regulada de forma recíproca pela leptina, um hormônio derivado dos adipócitos que transmite a entrada aferente da periferia para o cérebro em relação ao estado da energia corporal armazenada na forma de gordura (revisado nas referências 1, 2, 3).

A ação redutora de peso da leptina envolve tanto a inibição dos neurônios Agrp (que coexpressam o potente neuropeptídeo orexígeno Y) quanto a estimulação dos neurônios POMC anorexigênicos. Por outro lado, a sinalização de leptina deficiente em ob / ob ou db / db camundongos ativa os neurônios Agrp enquanto inibe os neurônios POMC, uma combinação que aumenta a ingestão de alimentos e reduz o gasto de energia, causando obesidade profunda. Pelo menos 1 componente a jusante da ativação do receptor de leptina envolve a fosforilação do fator de transcrição Stat3, e as manipulações genéticas que interferem neste processo causam obesidade (4 - 6), embora a importância relativa da ativação de Stat3 em diferentes subtipos neuronais não tenha sido abordada. Estudos anteriores de circuitos hipotalâmicos e balanço de energia focaram em mudanças no potencial de membrana (7, 8), ativação de Fos (2) ou modulação da plasticidade sináptica (9). No entanto, a questão fundamental de como a leptina ativa um tipo de célula, mas inibe outro, permanece sem resposta.

Aqui, relatamos o desenvolvimento de uma estratégia de genética molecular que permite a medição dinâmica e específica da célula da ativação de PI3K em neurônios POMC ou Agrp hipotalâmicos, usando uma preparação de fatia do cérebro e microscopia de 2 fótons com lapso de tempo. Nós nos concentramos na PI3K como um alvo potencial para a ação da leptina porque ela desempenha um papel central na transdução de eventos externos que afetam rapidamente o comportamento em uma variedade de tipos de células (10), incluindo neurônios hipotalâmicos (11), e é o principal alvo de ação de insulina, que se pensa funcionar de forma semelhante à leptina como um sinal central dos estoques periféricos de energia (12 - 14). Mais importante, a administração intracerebroventricular de inibidores de PI3K bloqueia a capacidade da leptina (15) e da insulina (13), mas não de outros compostos anorexigênicos, para reduzir a ingestão de alimentos, portanto, PI3K provavelmente se encontra a jusante da sinalização de leptina e insulina, direta ou indiretamente .

Conforme descrito abaixo, descobrimos que os efeitos da leptina e da insulina convergem nos neurônios POMC, onde cada hormônio ativa diretamente PI3K na ausência de transmissão sináptica. Em contraste, a leptina e a insulina têm efeitos opostos nos neurônios de Agrp, uma observação que se correlaciona com diferenças na fiação neuronal, de modo que o efeito da insulina nos neurônios de Agrp é direto, enquanto o efeito da leptina é, surpreendentemente, indireto. Esses resultados fornecem uma nova visão dos sinais de adiposidade humoral e dos circuitos de seus alvos hipotalâmicos.

Medição dinâmica da sinalização PI3K em camundongos transgênicos. Para obter medições dinâmicas da atividade PI3K em neurônios POMC ou Agrp vivos, empregamos uma proteína repórter fluorescente na qual a proteína fluorescente verde intensificada (EGFP) é fundida ao domínio de homologia de pleckstrina (PH) de Grp1 [EGFP-PH (Grp1)], que se transloca para a membrana celular ao se ligar ao trifosfato de fosfatidilinositol (PIP3), o produto da ativação de PI3K (16 - 18). Em células cultivadas, o sistema de proteína EGFP-PH (Grp1) fornece uma abordagem histoquímica robusta para medir a ativação de PI3K em resposta à insulina (18). Para atingir a expressão de EGFP-PH (Grp1) específico para neurônios POMC ou Agrp, construímos um vetor adenoviral no qual as sequências de codificação de EGFP-PH (Grp1) foram colocadas após um promotor forte (promotor de citomegalovírus) e um local de poliadenilação concatenado (4xpA) flanqueado por locais loxP (Figura 2A). Após a injeção do vetor adenoviral no hipotálamo mediobasal de camundongos portadores de um transgene Cre recombinase conduzido por elementos reguladores de qualquer Pomc (Tg.PomcCre) ou Agrp (Tg.AgrpCre), o repórter EGFP-PH (Grp1) foi ativado apenas em neurônios POMC ou Agrp devido à expressão específica do tipo de célula da recombinase Cre (Figura 2, A – C).

Sistema de imagem para medir a ativação dinâmica de PI3K em neurônios hipotalâmicos vivos. (UMA) Esboço do procedimento experimental. Prom de CMV, promotor de citomegalovírus. (B e C) Baixo- (B) e alta ampliação (C) imagens que ilustram a expressão adenoviral do repórter PI3K em um camundongo Tg.PomcCre +. (D) Resposta dose-dependente à insulina da translocação da membrana repórter PI3K em neurônios POMC. Imagens representativas de vários períodos de tempo são mostradas 0 minutos indica antes da adição de insulina ou após uma lavagem extensa após um tratamento anterior. As setas indicam a localização da membrana.

Tg.PomcCre e Tg. AgrpCre camundongos foram gerados colocando um cassete de cDNA Cre em um clone de cromossomo artificial bacteriano (BAC) que carrega o Pomc ou Agrp genes (Figura 1A) e produtores de camundongos transgênicos (Figura 1B). Usando o alelo repórter lacZ Gt (Rosa) 26Sor tm1Sor (R26R) para avaliar a especificidade (19), identificamos linhagens transgênicas em que o padrão de R26R a expressão correspondeu às localizações dos neurônios POMC e Agrp nas porções lateral e medial do núcleo arqueado, respectivamente (Figura 1C). A maioria dos transgênicos exibiu expressão no núcleo arqueado; entretanto, uma proporção substancial também exibiu expressão em outras regiões do cérebro (Tabela 1). Com base na coloração de X-gal, selecionamos linhas transgênicas que recapitulam o padrão de expressão endógena de POMC e Agrp para estudo posterior. Usamos coloração X-gal simultânea e imuno-histoquímica de neuropeptídeos para confirmar que a maioria dos neurônios que expressam lacZ nestes Tg.PomcCre ou Tg.AgrpCre linhas imunocoradas para neuropeptídeos POMC ou Agrp, respectivamente (Figura 1D).

Geração de camundongos transgênicos PomcCre, AgrpCre e camundongos knockout específicos para neurônios Stat3. (UMA) Diagramas de transgene nos quais as caixas azuis e vermelhas representam as regiões codificadoras de proteínas para os genes Pomc e Agrp, respectivamente. (B) Representação esquemática do repórter Rosa26 (superior) e Stat3 (inferior). (C) Coloração X-gal de seções do cérebro através do núcleo arqueado de camundongos R26R + transgênicos. (D) A coloração X-gal (azul) combinada com imunohistoquímica (marrom) para α-MSH e a imunocoloração do neuropeptídeo Agrp é distribuída por todos os corpos celulares neuronais e também em alguns terminais a coloração X-gal é um precipitado localizado dentro do citoplasma neuronal.

Geração de linhas transgênicas Tg.PomcCre e Tg.AgrpCre

Após a injeção do adenovírus recombinante portador de EGFP-PH ativável por Cre (Grp1) no hipotálamo médio-basal de Tg.PomcCre ou Tg.AgrpCre animais, uma seção coronal do cérebro (500 μm) foi tirada através do núcleo arqueado do hipotálamo e colocada em uma câmara de perfusão oxigenada para imagens de lapso de tempo com um microscópio de varredura a laser de 2 fótons (Figura 2, B e C). Para confirmar que EGFP-PH (Grp1) atua como uma proteína repórter PI3K em neurônios POMC ou Agrp hipotalâmicos, adicionamos 1, 10 ou 100 nM de insulina ao perfusato após um período de equilíbrio de 60 minutos. (Durante este período de equilíbrio no líquido cefalorraquidiano artificial [aCSF], ocasionalmente observamos a localização inicial da membrana da proteína repórter PI3K em ambos os neurônios POMC e Agrp, mas esse padrão invariavelmente difundiu-se e o repórter tornou-se uniformemente distribuído durante o equilíbrio.) Após o período de equilíbrio e a adição de insulina, observamos, como esperado, o acúmulo dependente da dose e do tempo de um sinal fluorescente em locais discretos ao longo da membrana plasmática neuronal (Figura 2D). A localização da membrana induzida por insulina era tipicamente aparente 30-60 segundos após a estimulação e frequentemente persistia por 10-15 minutos durante a exposição constante, mas então o repórter retornava gradualmente ao citoplasma. Um forte sinal fluorescente também foi observado no núcleo da célula, mas não estava relacionado ao tratamento com insulina ou à manipulação experimental, como foi relatado em estudos de células em cultura (17, 18). Confirmamos que a localização da membrana da proteína repórter foi um indicador de ativação de PI3K por pré-tratamento das fatias com qualquer um dos 2 inibidores farmacológicos de PI3K (LY294002 ou Wortmannin), cada um dos quais bloqueou totalmente o acúmulo de membrana induzida por insulina da proteína repórter (dados não mostrando).

Efeitos da leptina na atividade PI3K em subconjuntos neuronais. Para investigar a regulação da leptina da sinalização de PI3K em neurônios POMC e Agrp, desenvolvemos uma abordagem quantitativa para medir o acúmulo de membrana da proteína repórter PI3K. Seções ópticas de neurônios capturadas durante a imagem de 2 fótons foram analisadas com um algoritmo de detecção de borda MatLab, e a extensão da localização da membrana foi avaliada em cada ponto de tempo pelo número de pixels de borda por membrana celular.

Usando essa abordagem, descobrimos que a adição de 100 nM de leptina desencadeou o acúmulo de membrana da proteína repórter PI3K em 20 dos 29 neurônios POMC examinados. Tal como acontece com a insulina, a fluorescência da membrana desencadeada durante a exposição constante à leptina foi encontrada em manchas localizadas que variaram em diferentes neurônios durante o curso do experimento (consulte o material suplementar disponível online com este artigo doi: 10.1172 / JCI200524301DS1). Em algumas imagens confocais, a intensidade da fluorescência da membrana não apareceu tão brilhante quanto a induzida pela insulina, no entanto, as medições quantitativas demonstraram que a localização da membrana induzida por leptina da proteína repórter PI3K foi bloqueada completamente por pré-tratamento com LY294002 ou Wortmannin (Figura 3, A e C ) Assim, a ativação de PI3K mediada por leptina pode contribuir para o efeito estimulador bem documentado da leptina nos neurônios POMC (7, 20).

Regulação diferencial de PI3K pela leptina em neurônios POMC e Agrp. Exemplo de distribuição de repórter PI3K durante o tratamento com leptina de um neurônio POMC (UMA) e retirada de leptina de um neurônio Agrp (B) Os painéis superior e inferior mostram a imagem bruta e as bordas da membrana celular correspondentes, respectivamente. (C) Distribuição dos pixels da borda em função do tempo nas condições indicadas. (D) Distribuição cumulativa do tempo mais antigo em que os neurônios POMC responsivos (n = 19) ou Agrp (n = 18) manifestam a translocação repórter pela primeira vez. (E) Porcentagem de todos os neurônios examinados que responderam à adição de leptina (POMC, n = 29) ou retirada (Agrp, n = 21) cada ponto representa uma janela de 2 minutos.

Em fatias de cérebro de Tg.AgrpCre camundongos, descobrimos que a adição de leptina 100 nM ao perfusato falhou em estimular a localização da membrana da proteína repórter PI3K. No entanto, como a expressão de Agrp é ativada por condições caracterizadas por baixos níveis de leptina no plasma (como jejum), formulamos a hipótese de que nos neurônios de Agrp, a PI3K contribui para a ativação dos neurônios e é ativada pela ausência de leptina. Para investigar esta hipótese, nós pré-incubamos fatias de cérebro de Tg.AgrpCre camundongos em 100 nM de leptina durante o período de equilíbrio e, em seguida, removeu a leptina por perfusão com aCSF. Nessas condições, a retirada da leptina desencadeou o acúmulo de membrana do repórter PI3K em 18 dos 21 neurônios Agrp examinados (Figura 3B e Figura 4A). Assim, a regulação recíproca dos neurônios POMC e Agrp pela leptina se correlaciona com os efeitos recíprocos na ativação de PI3K.

Regulação da PI3K pela insulina nos neurônios Agrp e efeitos dos inibidores sinápticos nos neurônios POMC e Agrp. (UMA) Em neurônios Agrp, a retirada da leptina tem o mesmo efeito que a adição de insulina. Ambos os tratamentos estimulam a localização da membrana da proteína repórter PI3K. O exemplo mostrado representa o mesmo neurônio no qual uma fatia pré-incubada com leptina 100 nM por 60 minutos foi então perfundida com aCSF durante este tempo, a proteína repórter PI3K exibiu localização na membrana inicial seguida por um retorno ao citoplasma por 58 minutos. A adição de insulina 100 nM desencadeou a localização da membrana novamente. Em outros experimentos, a insulina 100 nM foi observada para causar a ativação de PI3K em neurônios Agrp que não haviam sido previamente expostos à leptina. As setas indicam a localização da membrana. (B) Exemplo da mesma experiência que em UMA mas realizado na presença de 1 μM TTX (que bloqueou a resposta anterior à retirada da leptina). (C e D) Porcentagem de POMC (C) e Agrp (D) neurônios responsivos à leptina com (aCSF) ou sem (baixo Ca ++ ou TTX) transmissão sináptica. * P & lt 0,05 ** P & lt 0,01 conforme determinado pela análise χ 2. (E e F) Porcentagem de POMC (E) e Agrp (F) neurônios responsivos à insulina com (aCSF) ou sem (baixo Ca ++) transmissão sináptica.

A maioria dos neurônios POMC ou Agrp respondeu à adição ou retirada de leptina, respectivamente, em 10 minutos (Figura 3D). No entanto, a duração da resposta variou, com alguns neurônios exibindo localização de membrana transitória por menos de 1 minuto e outros exibindo localização de membrana sustentada por mais de 10 minutos. No geral, o tempo de ativação de PI3K em resposta a uma mudança nos níveis de leptina foi semelhante nos neurônios POMC e Agrp, seja analisado de acordo com a distribuição cumulativa da resposta mais precoce (Figura 3D) ou a proporção de neurônios exibindo uma resposta dentro de uma janela de tempo particular ( Figura 3E).

Regulação de PI3K pela insulina e efeitos dos inibidores sinápticos. Conforme descrito acima, a leptina e a insulina tiveram efeitos semelhantes nos neurônios POMC: a adição de qualquer um dos compostos causou o acúmulo de membrana da proteína repórter PI3K (Figura 2D e Figura 3). Surpreendentemente, a leptina e a insulina tiveram efeitos opostos nos neurônios Agrp, com o acúmulo da proteína repórter na membrana inibido pela leptina, mas estimulado pela insulina (Figura 4A). O curso de tempo da ativação de PI3K induzida por insulina em neurônios Agrp parecia semelhante ao dos neurônios POMC, com o acúmulo de membrana evidente dentro de alguns minutos de adição de hormônio, diminuindo gradualmente ao longo de 30-60 minutos (Figura 2D e Figura 4A). Ao contrário dos neurônios POMC, no entanto, a ativação de PI3K pela insulina em neurônios Agrp foi o oposto do que seria previsto para um sinal de adiposidade fisiológica.

Para obter mais informações sobre os mecanismos subjacentes a esses efeitos, perguntamos se a resposta PI3K dos neurônios POMC e Agrp foi alterada por inibidores da transmissão sináptica. Isso foi realizado incubando fatias do cérebro em tetrodotoxina (TTX) ou cálcio extracelular reduzido (que bloqueia os canais de sódio dependentes de voltagem e a liberação de vesículas sinápticas dependentes de cálcio, respectivamente) antes de medir a localização da membrana da proteína repórter PI3K em resposta às mudanças na leptina ou insulina.

Nem TTX nem o cálcio extracelular reduzido afetaram a resposta dos neurônios POMC à adição de leptina (Figura 4C), mas ambos os tratamentos reduziram significativamente a resposta à retirada de leptina em neurônios Agrp (Figura 4D). Assim, a leptina ativa diretamente PI3K em neurônios POMC, mas o efeito da retirada da leptina na ativação de PI3K em neurônios Agrp requer transmissão sináptica e, portanto, deve ser mediado indiretamente. Também testamos se a transmissão sináptica era necessária para os efeitos da insulina na ativação de PI3K e descobrimos que nem o cálcio extracelular reduzido nem o TTX diminuíram a ativação de PI3K em neurônios POMC ou Agrp (Figura 4, B, E e F), de fato, cálcio extracelular reduzido causou um aumento pequeno, mas significativo, na proporção de neurônios POMC que exibiram ativação de PI3K induzida por insulina, possivelmente devido ao alívio da entrada inibitória tônica de neurônios Agrp adjacentes (7). Tomados em conjunto, esses resultados sugerem uma diferença fundamental na maneira como os neurônios POMC e Agrp modulam a atividade de PI3K em resposta à leptina, não apenas na direção, mas também no mecanismo subjacente, com a leptina tendo um efeito primário nos neurônios POMC, mas um efeito secundário em Agrp neurônios.

A ativação de PI3K induzida por leptina em neurônios POMC é independente da função Stat3. A via PI3K recebeu menos atenção do que a via JAK-STAT como efetor da ação da leptina, em parte porque a sinalização JAK-STAT é um protótipo para receptores de citocinas tipo I e em parte porque as manipulações genéticas que interferem com a fosforilação Stat3 induzida por leptina causam obesidade (4 - 6). No entanto, Stat3 atua principalmente como um fator de transcrição (21, 22), e a regulação da leptina de neurônios do núcleo arqueado claramente envolve ações que são independentes de mudanças na expressão gênica, incluindo a regulação da atividade elétrica e modulação de PI3K (7, 8, 11, 15, 23).

Como Stat3 também foi relatado como servindo como uma proteína adaptadora que recruta PI3K para o receptor de interferon tipo I ativado (24), determinamos se a ativação de PI3K induzida por leptina em neurônios POMC requer Stat3. Primeiro, geramos camundongos nos quais Stat3 funcional é removido especificamente de neurônios POMC que expressam Cre (Figura 1B), usando um loxP flanqueado previamente validado Stat3 alelo (25), e então injetamos nesses animais nosso adenovírus carregando o repórter PI3K ativável por Cre. Como a expressão da proteína repórter PI3K serve como um marcador autônomo da célula para eventos de recombinação mediada por Cre, a maioria das células fluorescentes teria sido submetida à excisão mediada por Cre de Stat3. Não encontramos nenhuma diferença na ativação de PI3K induzida por leptina entre específicas de POMC Stat3 animais mutantes e animais com intacta Stat3 expressão, medida como a proporção de neurônios ativados (Figura 5, A e B) ou o tempo de ativação (dados não mostrados). Assim, a ativação de PI3K pela leptina em neurônios POMC não requer Stat3 funcional.

A ativação de PI3K em neurônios POMC não requer a função Stat3. (UMA) Neurônio POMC deficiente em Stat3 representativo exposto a leptina 100 nM, no qual a localização da proteína repórter PI3K na membrana ocorre dentro de alguns minutos após a adição do hormônio. As setas indicam a localização da membrana. (B) Porcentagem de neurônios POMC responsivos à leptina na presença (+ / +) ou ausência (- / -) de Stat3. (C) Mecanismo de unificação para a modulação da leptina de neurônios do núcleo arqueado em que a atividade PI3K é um mediador e / ou marcador da ativação neuronal e liberação de neuropeptídeo em neurônios Agrp (rosa) e POMC (verde). Os efeitos da insulina na atividade da PI3K são diretos em ambos os subtipos neuronais, mas os efeitos da leptina na atividade da PI3K nos neurônios Agrp requerem transmissão sináptica do POMC ou de outros neurônios pré-sinápticos inibitórios (cinza). IR, receptor de insulina LepR, receptor de leptina.

Estudos eletrofisiológicos anteriores pintaram um quadro intrincado, mas complexo, dos circuitos de equilíbrio de energia hipotalâmico. Os neurônios POMC marcados com um transgene EGFP são despolarizados em resposta à leptina (7) e à glicose extracelular elevada (20), no entanto, um subconjunto de neurônios hipotalâmicos não marcados selecionados para o mesmo tipo de responsividade à glicose foi hiperpolarizado pela leptina (26) . Nossos resultados fornecem uma nova perspectiva com relação à natureza da resposta e do circuito, em que PI3K pode contribuir para a ativação de ambos os neurônios Agrp e POMC, mas a direção de sua regulação pela leptina depende se a ação é mediada diretamente ou indiretamente (Figura 5C). Assim, a regulação recíproca de PI3K pela leptina fornece uma hipótese unificadora para explicar como esse hormônio exerce efeitos opostos sobre a atividade desses 2 subconjuntos principais de neurônios.

Uma importante implicação de nossos achados tem a ver com a noção de que a insulina e a leptina desempenham papéis semelhantes como indicadores periféricos do balanço energético. Essa ideia foi inicialmente baseada em observações de que a insulina circula e entra no cérebro em um nível proporcional aos estoques de gordura corporal e foi apoiada por observações de que a administração central de insulina inibe a ingestão de alimentos e reduz o peso corporal (revisado nas refs. 1, 14) e que camundongos nocaute do receptor de insulina seletivo para neurônios desenvolvem obesidade moderada induzida por dieta (27).

Nossos resultados sugerem que os efeitos paralelos da leptina e da insulina no balanço energético podem ser integrados no nível dos neurônios POMC, onde ambos os hormônios ativam PI3K, e a leptina demonstrou causar despolarização da membrana e aumento da taxa de disparo. Embora estudos anteriores de Ashford e colegas (11, 26) tenham identificado um subconjunto de neurônios hipotalâmicos nos quais os efeitos da leptina ou da insulina na hiperpolarização da membrana poderiam ser bloqueados por inibidores de PI3K, nossos resultados não distinguem se as alterações no POMC PI3K são independentes de ou causalmente relacionado a mudanças na atividade elétrica do POMC. Ambos os fenômenos ocorrem rapidamente e podem contribuir para respostas agudas, como liberação de neuropeptídeos e mudanças rápidas no comportamento alimentar.

No entanto, nossa observação de que a insulina e a leptina têm efeitos opostos na atividade de PI3K em neurônios Agrp sugere que as funções desses 2 hormônios como sinais de equilíbrio de energia não se sobrepõem completamente. De fato, os efeitos diferenciais da leptina e da insulina na expressão de Agrp foram descritos anteriormente no contexto de diabetes induzido por estreptozotocina, em que a leptina, mas não a administração de insulina, normaliza a expressão de Agrp (28, 29). Além disso, os efeitos da insulina no crescimento neuronal e sobrevivência excedem o que poderia ser esperado para um sinal de adiposidade simples, com ampla expressão de receptores de insulina em muitas regiões do cérebro (30) e uma conexão entre a ação da insulina e neurodegeneração (31, 32). Finalmente, a leptina e o sistema de melanocortina são específicos para vertebrados, enquanto os efeitos da insulina no cérebro são conservados em todos os metazoários, com estudos genéticos em invertebrados apontando para um papel antigo da insulina no balanço energético, bem como no envelhecimento e no crescimento (33, 34 ) A partir dessa perspectiva, a leptina pode servir como um sinal de balanço de energia especializado inventado durante a evolução dos vertebrados, cujos efeitos se sobrepõem parcialmente a um papel mais antigo da insulina.

Além dos efeitos diferenciais da leptina na atividade de PI3K em neurônios POMC e Agrp, nossos resultados indicam que os circuitos subjacentes a esses efeitos também diferem, uma vez que o efeito inibitório da leptina sobre PI3K na maioria dos neurônios Agrp requer transmissão sináptica. No entanto, estudos neuroanatômicos anteriores realizados por nós e por outros demonstraram que um subconjunto de neurônios Agrp (ou neurônios Npy no núcleo arqueado) expressa a forma longa do receptor de leptina (35 - 39). Este aparente paradoxo - uma resposta indireta à leptina apesar da presença de receptores de leptina em alguns neurônios Agrp - poderia ser explicado se os neurônios Agrp precisassem de múltiplos sinais para ativar PI3K em resposta à retirada da leptina, alguns mediados autonomamente por meio de um receptor de leptina e outros que são mediados por meio de transmissão sináptica. Alternativamente, pode haver heterogeneidade funcional dentro dos neurônios Agrp se, por exemplo, o subconjunto de neurônios Agrp que expressa o receptor de leptina for distinto daqueles que ativam PI3K em resposta à retirada da leptina. Se assim for, este último grupo de neurônios pode receber sinais inibitórios mediados por leptina de POMC ou outros neurônios via ácido γ-aminobutírico (GABA) (40) ou outros neurotransmissores inibidores (Figura 5C).

A heterogeneidade dos neurônios POMC também pode ajudar a explicar a observação de que a ativação da leptina de PI3K em neurônios POMC não requer fosforilação Stat3. Um estudo neuroanatômico recente relatou que 37% das células POMC eram imunopositivas para fosfo-Stat3 após o tratamento com leptina (41), e em nosso sistema de imagem, a leptina ativou PI3K em aproximadamente 60% dos neurônios POMC. Assim, o envolvimento do receptor de leptina em subconjuntos distintos de neurônios POMC poderia ativar diferentes efetores a jusante. Independentemente disso, esses resultados, juntamente com trabalhos anteriores (7, 42), sugerem uma visão da sinalização da leptina na qual existem 2 tipos de efetores intracelulares diretos com ações diferentes e possivelmente diferentes mecanismos de ativação. Um tipo, exemplificado por Stat3, provavelmente medeia respostas que requerem mudanças na expressão gênica, enquanto um segundo tipo, exemplificado pelos efeitos diretos da leptina na ativação de PI3K e na atividade elétrica em neurônios POMC, provavelmente medeia respostas agudas, como neuropeptídeo liberação e mudanças rápidas no comportamento alimentar. Em contraste com Stat3, cujo mecanismo de ativação por engajamento do receptor de leptina é bem caracterizado (21, 42, 43), os mecanismos bioquímicos pelos quais a leptina ativa PI3K e modula o potencial de membrana em neurônios POMC ainda não estão claros. No entanto, os dois podem estar relacionados causalmente, uma vez que a despolarização de neurônios POMC pela leptina envolve um canal catiônico não seletivo (7) e PIP3 recentemente demonstrou ser capaz de modular os canais iônicos (44, 45). Além disso, o trabalho de Myers e colegas (6) mostrou que os animais portadores de um receptor de leptina modificado que não podem ativar Stat3, Lepr 1138Ser , desenvolvem um subconjunto das mesmas anormalidades fenotípicas causadas por um Lepr alelo, portanto, será interessante examinar os efeitos da leptina na ativação de PI3K e na atividade elétrica em neurônios POMC que carregam o Lepr 1138Ser mutação.

Optamos por nos concentrar nos neurônios POMC e Agrp por causa de trabalhos anteriores que sugerem que eles servem como sensores primários para os sinais de adiposidade circulantes. Balthasar et al. (46) recentemente demonstraram que os animais com POMC específico Lepr a deleção desenvolve uma leve obesidade e distúrbio metabólico. Na medida em que os resultados de diferentes estudos podem ser comparados, o efeito do POMC específico Lepr a exclusão parece ser menos dramática do que a de uma completa Pomc, Mc4r, ou Lepr supressão (47). Essas observações sugerem que os neurônios POMC usam mediadores e / ou mecanismos de sinalização além da leptina para controlar o peso corporal e, além disso, que o efeito da leptina no controle do peso corporal do SNC envolve neurônios além daqueles que expressam Pomc. A este respeito, a comparação de POMC específico Lepr ratos de deleção com POMC específico Stat3 camundongos de deleção podem revelar até que ponto a sinalização da leptina em neurônios POMC é mediada por Stat3 ou outros efetores, como PI3K.

A abordagem apresentada aqui - uma combinação de biologia transgênica e terapia genética que permite medições histoquímicas dinâmicas de sinalização de células neuronais registradas por microscopia multifotônica de fatias de cérebro - pode ser aplicada a eventos de sinalização adicionais e a diversos problemas fisiopatológicos nos quais o cérebro mede e responde a mudanças nos parâmetros ambientais, incluindo pH, temperatura, concentração de glicose e níveis de citocinas. Avanços no processamento e miniaturização de imagens devem permitir que eventos de vários neurônios sejam registrados simultaneamente em animais vivos, um avanço que pode ajudar na dissecção de eventos moleculares e celulares que fundamentam comportamentos complexos.

Recombinação e geração de camundongos transgênicos. O BAC que usamos, clone 389J9 (Research Genetics Inc.), continha aproximadamente 60 kb de 5 ′ e aproximadamente 30 kb de 3 ′ sequência flanqueadora e foi modificado por recombinação homóloga em bactérias usando o RecE de 2 etapas e recombinação mediada por RecT ( ET cloning) método de Stewart e colegas (48), em que um cassete de resistência à neomicina flanqueado por sítios alvo de FLP recombinase foi usado para seleção positiva e, em seguida, excisado por expressão transitória de FLP recombinase. Sequências codificantes de Cre recombinase modificadas para conter um local de iniciação traducional e sinal de localização nuclear ótimos foram derivadas de um plasmídeo originalmente construído por M. Lewandoski (Instituto Nacional do Câncer - Centro de Pesquisa e Desenvolvimento de Câncer Frederick, Frederick, Maryland, EUA), pML78. Um fragmento SalI-EcoRI de 1,1 kb de pML78 que inclui aproximadamente 35 nt de sequência não traduzida 5 'e aproximadamente 20 nt de sequência não traduzida 3' foi fundido a um fragmento EcoRI de 0,6 kb do gene da protamina 1 de camundongo que contém um íntron e sinal de poliadenilação ( 49), e este fragmento CreIVSpA foi então colocado a montante de uma cassete de resistência à neomicina flanqueada por FLP. Colocamos 50 bp Pomc braços de homologia em ambas as extremidades deste cassete, eletroporaram o fragmento linear em bactérias portadoras do clone BAC 389J9, rastrearam clones resistentes à neomicina por PCR e análise de digestão de restrição para direcionamento correto e, em seguida, removeu o cassete de neomicina com FLP recombinase. Os braços de homologia foram escolhidos de modo a inserir o cassete CreIVSpA dentro do exon 2 precisamente a montante do Pomc local de iniciação translacional, os braços de homologia 5 ′ e 3 ′ correspondem aos resíduos 102-151 e 152-201, respectivamente, do Pomc cDNA (número de acesso GenBank NM_00889) - o normal Pomc o local de iniciação da tradução está no resíduo 152-154.

Para Agrp, identificamos um BAC de uma biblioteca C57BL / 6J (Genome Systems Inc.), clone 171n11, que carregava aproximadamente 67 kb de 5 'e aproximadamente 37 kb de 3' a sequência de flanco. Usando a mesma estratégia de Pomc, direcionamos o cassete CreIVSpA precisamente a montante do normal Agrp sítio de iniciação translacional no exon 2, os braços de homologia 5 ′ e 3 ′ correspondem aos resíduos 107088027–107087978 e 107087977–107087928 na sequência do genoma de camundongo do cromossomo 8 (mm4, outubro de 2003, National Center for Biotechnology Information [NCBI] build 32) (Agrp é codificado em uma orientação reversa com um local de iniciação da tradução nos resíduos 107087977–107087975).

Para ambos Pomc e Agrp BACs, fragmentos lineares foram purificados para microinjeção uma vez que o esqueleto do vetor BAC, pBeloBac11, contém um local loxP. Para Pomc, toda a inserção foi liberada por digestão com a enzima de restrição NotI e purificada como um fragmento de aproximadamente 95 kb usando um gradiente de sacarose de 20–35%. Para Agrp, há 2 locais Not internos, e purificamos um fragmento NotI de 48,5 kb usando um gradiente de sacarose de 20-30% que contém aproximadamente 47 kb de 5 ′ e aproximadamente 0,7 kb de 3 ′ sequência de flanqueamento. Os fragmentos BAC lineares recuperados após a purificação do gradiente de sacarose foram trocados por tampão de microinjecção (Tris-HCl 10 mM, EDTA 0,1 mM, pH 7,4) e concentrados usando colunas centriprep-30 antes da microinjecção (a uma concentração de 0,6 μg / ml) em 1 - embriões de células produzidos por machos homozigotos para o acasalamento R26R alelo com fêmeas da linhagem consanguínea FVB / N padrão de camundongo. Os fundadores dos transgênicos foram identificados e confirmados por PCR e hibridização Southern blot. Descobrimos que 22 de 26 Tg.PomcCre linhas e 4 de 6 Tg.AgrpCre as linhas expressavam a Cre recombinase no núcleo arqueado do hipotálamo. Além disso, aproximadamente 30% dos animais portadores do transgene AgrpCre exibiram expressão embrionária precoce de Cre recombinase, conforme determinado por coloração generalizada de X-gal de múltiplos tecidos somáticos, esses animais não foram usados ​​para outros experimentos.

Coloração de X-gal e imuno-histoquímica. Para a coloração X-gal de fatias de cérebro, seções coronais de 500 μm foram preparadas a partir de cérebros recentemente dissecados usando uma matriz de cérebro adulto (Kent Scientific), fixada com paraformaldeído a 4% em PBS 100 mM e MgCl 2 mM2 (pH 7,4) durante 1 hora a 4 ° C, depois lavado 3 vezes, 10 minutos de cada vez, com PBS contendo Triton X-100 0,1% à temperatura ambiente. A coloração foi realizada durante a noite a 37 ° C em PBS que continha 5 mM de ferricianeto de potássio, 5 mM de ferrocianeto de potássio, 2 mM de MgCl2e 1 mg / ml de X-gal.

Para estudos de colocalização, camundongos carregando o alelo R26R e um transgene PomcCre ou AgrpCre foram primeiro injetados com 1 μl de colchicina (20 μg / μl) no terceiro ventrículo, então anestesiados e fixados por perfusão com paraformaldeído 4% em PBS 100 mM 48 horas mais tarde. Os cérebros foram removidos, colocados em fixador durante a noite e infiltrados com sacarose a 30% em PBS a 4 ° C e, em seguida, seções congeladas de 10 μm foram preparadas e montadas em lâminas Superfrost / Plus (Fisher). As secções foram lavadas com Triton X-100 0,1% em PBS (3 vezes, 10 minutos de cada vez), depois incubadas com tampão de coloração X-gal (ver acima) durante a noite a 37 ° C. Após a coloração de X-gal, as seções foram lavadas com 0,25% de Triton X-100 em PBS (3 vezes, 10 minutos de cada vez), incubadas em 0,3% de peróxido de hidrogênio e 0,3% de soro de cabra normal em PBS por 5 minutos em temperatura ambiente, lavadas em 0,25% de Triton em PBS, depois incubado em 10% de soro de cabra normal e 1% de BSA em PBS por 1 hora em temperatura ambiente. As seções foram subsequentemente imunocoradas com um anticorpo de hormônio estimulador de melanócito α policlonal de coelho (α-MSH) (ImmunoStar) em uma diluição de 1: 500 em tampão de bloqueio, ou um anticorpo AGRP policlonal de coelho criado contra AGRP humano (35) em um 1: Diluição 1000 durante 1 hora à temperatura ambiente. As seções foram lavadas com 0,25% de Triton X-100 em PBS (3 vezes, 10 minutos de cada vez), em seguida, incubadas com anticorpo secundário de cabra anti-coelho biotinilado (Jackson Immuno-Research Laboratories Inc.) na diluição de 1: 500 em tampão de bloqueio por 1 hora em temperatura ambiente. Após a lavagem com 0,25% de Triton em PBS (3 vezes, 10 minutos de cada vez), detectamos biotina usando um kit de detecção de peroxidase de rábano (Vector Laboratories).

Os limites das células dos neurônios Agrp imunocorados eram difíceis de avaliar devido à alta densidade de corpos celulares e fibras neuronais na porção medial do núcleo arqueado, o que impedia uma estimativa quantitativa para a co-localização. No entanto, os resultados de um estudo diferente usando a mesma linha transgênica AgrpCre indicaram que a recombinase Cre foi expressa na maioria dos neurônios Agrp (A.W. Xu e G.S. Barsh, dados não publicados). Neurônios POMC imunocorados foram distribuídos de forma que os limites das células individuais fossem prontamente aparentes em uma amostra de múltiplas seções de Tg.PomcCre camundongos (594 células contadas), 79,5% das células foram duplamente positivas para coloração de X-gal e imunorreatividade de MSH, 18,4% das células eram imunorreativas de MSH, mas não exibiam coloração de X-gal, e 2% das células eram X -gal positivo, mas não imunorreativo para MSH. Devido à natureza do repórter R26R, a expressão de lacZ fornece informações sobre a história e a linhagem celular de um neurônio. Assim, a porcentagem muito pequena de neurônios positivos para X-gal, mas negativos para MSH, pode incluir células que expressaram MSH no passado ou em células progenitoras.

Genética de camundongos. Animais carregando o R26R O alelo repórter lacZ foi obtido de P. Soriano (University of Washington, Seattle, Washington, EUA) e é mantido em nosso laboratório como homozigoto em um fundo misto que inclui contribuições de FVB / N, C57BL / 6J e 129 cepas. o Tg.PomcCre e Tg.AgrpCre as linhas foram mantidas como heterozigotos no mesmo fundo misto. Construção e aplicação do Stat3 condicional (Stat3 flox ) (25) e nulo (Stat3 null ) (50) alelos foram descritos anteriormente. Em resumo, os locais loxP flanqueiam o exon 22, que codifica um local de fosforilação que é necessário para a função Stat3 normal.

Animais com deleção de Stat3 específica de POMC foram gerados por cruzamento Tg.PomcCre + e Stat3 flox / null camundongos. Os 4 possiveis Stat3 alelos que resultam deste cruzamento (Stat3 + , Stat3 nulo , Stat3 flox , e Stat3 Δ ) foram distinguidos por Southern blotting (25) também Stat3 flox / null ou Stat3 flox / flox os animais foram usados ​​para estudos de imagem. Os experimentos neste estudo foram aprovados pelo Stanford Administrative Panel on Laboratory Animal Care.

Construção e produção do vetor adenoviral. Um cDNA que codifica EGFP-PH (Grp1) foi derivado de um plasmídeo fornecido por J. Pessin (University of Iowa, Iowa City, Iowa, EUA) (18), colocado atrás de um cassete de poliadenilação flanqueado por loxP (4xpA) derivado originalmente de pROSA26 -R (19), e então subclonado nos locais BglII e HindIII do vetor pShuttle-citomegalovírus (51). Este vetor foi usado para produzir adenovírus recombinante usando o sistema AdEasy baseado em bactérias como descrito anteriormente (51) e vírus de alto título (4,2 × 10 12 pfu / ml) produzidos por C. Rhodes (Adenovirus Vector Core, Pacific Northwest Research Institute, Seattle, Washington, EUA).

Injeção estereotáxica. As injeções foram administradas em animais anestesiados de 2 a 4 meses de idade usando um aparelho estereotáxico de alta precisão (SAS75 Cartesian Research). As coordenadas para injeção no núcleo arqueado foram –2,2 mm bregma, 0,15 mm lateral e –5,5 a –5,8 dorsal-ventral. Uma seringa Hamilton calibre 25 de 1 μl foi usada para a injeção, e um volume total de 1 μl foi injetado no núcleo arqueado a uma taxa de 1 nl / segundo usando uma Unidade de Microinjetor WPI Ump II (Pesquisa Cartesiana). A agulha foi deixada no local por 10 minutos antes da retirada.

Microscopia de varredura a laser de dois fótons. De 5 a 21 dias após a injeção estereotáxica do adenovírus, os animais foram sacrificados e os cérebros inteiros foram removidos e cada um colocado em aCSF consistindo em 119 mM NaCl, 2,5 mM KCl, 1 mM CaCl2, MgCl 3 mM2, NaH 1 mM2PO4, Glicose 11 mM e NaHCO 26,2 mM3, pH 7,4). Seções coronais de 500 µm através do hipotálamo foram imediatamente cortadas em gelo usando uma matriz de cérebro de camundongo adulto pré-resfriada (Kent Scientific). Fatias do cérebro contendo o núcleo arqueado foram colocadas em uma câmara de perfusão (RC-29 slice câmara Warner Instruments) que permite que a solução flua para a parte superior e inferior da preparação. A câmara foi montada em um palco aquecido e a imagem realizada em um microscópio confocal de varredura a laser Zeiss LSM510 mantido pela Stanford Cell Sciences Imaging Facility. Fatias de cérebro foram constantemente perfundidas com pré-aquecido (37 ° C) aCSF oxigenado com 95% de O2, 5% CO2 a uma taxa de 1,2 ml / min. Uma objetiva de imersão em água de ampliação de × 40 (Achroplan IR 40 × / 0,80 [Zeiss], distância de trabalho 3,60 mm) e uma objetiva de imersão de água de ampliação de × 63 (Achroplan IR 63 × / 0,90 [Zeiss], distância de trabalho de 2,20 mm) foram usadas para imagem. O repórter fluorescente EGFP-PH (Grp1) foi animado com um laser Coherent Mira 900 ajustável Ti: Sapphire de 2 fótons em 860-880 nm (Coherent Inc.) e emissão coletada por um detector não escaneado usando um filtro BP500-550. Imagens de 12 bits foram gravadas em um tamanho de quadro de 1024 × 1024 pixels e uma taxa de 6,40 μs / pixel.

Em todos os casos, as fatias do cérebro foram equilibradas por 1 hora em aCSF, durante a qual nenhuma translocação espontânea da membrana foi observada. Para examinar os efeitos da insulina (1nM-100 nM Sigma-Aldrich) ou leptina (100 nM R & ampD Systems) na localização da membrana do repórter fluorescente, adicionamos o hormônio diretamente ao tampão de perfusão após o equilíbrio, e as imagens foram registradas em intervalos de aproximadamente 30 segundos, começando com o momento em que o hormônio entrou na câmara de perfusão. Em alguns experimentos com Tg.PomcCre camundongos, tentamos níveis mais baixos de leptina e descobrimos que 4 de 7 neurônios responderam a leptina de 25 nM e 4 de 9 neurônios responderam a leptina de 50 nM. Para testar se a localização da membrana da proteína repórter era dependente de PI3K, usamos Wortmannin (100 nM Sigma-Aldrich) ou LY 294002 (10 μm Calbiochem), que foram adicionados ao tampão de perfusão 30-60 minutos antes do tratamento hormonal. Para examinar a necessidade de transmissão sináptica, usamos baixo cálcio (baixo Ca ++, 0,3 mM CaCl2), alto magnésio (MgCl 9 mM2), ou TTX (1 μM Sigma-Aldrich), que foram incluídos no início do período de equilíbrio. Para POMC, 29, 15, 13 e 13 neurônios foram examinados com aCSF, Ca ++ baixo, TTX e em camundongos de deleção Stat3 específicos de POMC, respectivamente para Agrp, 21, 12 e 16 neurônios foram examinados com aCSF, baixo Ca ++ e TTX, respectivamente.

Análise de dados. Os arquivos de imagem gerados durante a digitalização a laser foram convertidos em um formato TIFF e, em seguida, analisados ​​com o algoritmo de detecção de bordas Canny no MatLab (versão 6.5, release 13). Para cada série de imagens, um limite para detecção de bordas foi escolhido empiricamente para que não houvesse bordas detectadas na membrana citoplasmática em imagens tiradas antes do tratamento hormonal. Cada imagem foi então editada para remover as bordas ao redor da membrana nuclear e importada de volta para o MatLab para determinar o número total de pixels da borda.

Agradecemos J. Mulholland e K. Lee pela assistência com a imagem de S. Smith e K. Niswender pelo conselho e C. Rhodes, J. Pessin e B. Lowell pelos reagentes. Agradecemos ao N.G. Larsson por fornecer os ratos Tfam flox / flox. Este trabalho foi apoiado pelo NIH concede DK-48506 (para G.S. Barsh) e DK-68384 (para M.W. Schwartz) e pelo Stanford Bio-X Interdisciplinary Initiatives Program.

Abreviações não padronizadas usadas: aCSF, líquido cefalorraquidiano artificial Agrp, proteína relacionada à aguti BAC, cromossomo bacteriano artificial EGFP, proteína fluorescente verde aprimorada EGFP-PH (Grp1), proteína de fusão de EGFP e PH-Grp1 MSH, hormônio estimulador de melanócitos PIP3, fosfatidilinositol trifosfato POMC R26R, Gt (Rosa) 26Sor tm1Sor TTX, tetrodotoxina.

Conflito de interesses: Os autores declararam que não existe conflito de interesses.


Schwartz MW, Woods SC, Porte D Jr, Seeley RJ, Baskin DG (2000) Controle do sistema nervoso central da ingestão alimentar. Nature 404: 661-671

Ingalls AM, Dickie MM, Snell GD (1950) Obeso, uma nova mutação no camundongo doméstico. J Hered 41: 317–318

Hummel KP, Dickie MM, Coleman DL (1966) Diabetes, a new mutation in the mouse. Science 153: 1127-1128

Coleman DL (1973) Effects of parabiosis of obese with diabetes and normal mice. Diabetologia 9: 294–298

Coleman DL, Hummel KP (1969) Effects of parabiosis of normal with genetically diabetic mice. Am J Physiol 217: 1298-1304

Zhang Y, Proenca R, Maffei M, Barone M, Leopold L, Friedman JM (1994) Positional cloning of the mouse obese gene and its human homologue. Nature 372: 425-432

Farooqi IS, Jebb SA, Langmack G, Lawrence E, Cheetham CH, Prentice AM, Hughes IA, McCamish MA, O’Rahilly S (1999) Efeitos da terapia com leptina recombinante em uma criança com deficiência congênita de leptina. N Engl J Med 341: 879-884

Harris RB, Zhou J, Redmann SM Jr, Smagin GN, Smith SR, Rodgers E, Zachwieja JJ (1998) Um estudo de resposta à dose de leptina em camundongos obesos (ob / ob) e magros (+ /?). Endocrinologia 139: 8-19

Cohen P, Zhao C, Cai X, Montez JM, Rohani SC, Feinstein P, Mombaerts P, Friedman JM (2001) A deleção seletiva do receptor de leptina em neurônios leva à obesidade. J Clin Invest 108: 1113-1121

de Luca C, Kowalski TJ, Zhang Y, Elmquist JK, Lee C, Kilimann MW, Ludwig T, Liu SM, Chua SC Jr (2005) Resgate completo de obesidade, diabetes e infertilidade em camundongos db / db por LEPR específico de neurônio -B transgenes. J Clin Invest 115: 3484–3493

Tadokoro S, Ide S, Tokuyama R, Umeki H, Tatehara S, Kataoka S, Satomura K (2015) A leptina promove a cicatrização de feridas na pele. PLoS One 10: e0121242

Huynh FK, Levi J, Denroche HC, Gray SL, Voshol PJ, Neumann UH, Speck M, Chua SC, Covey SD, Kieffer TJ (2010) A interrupção da sinalização da leptina hepática protege os ratos da intolerância à glicose relacionada com a idade e dieta. Diabetes 59: 3032–3040

Marroqui L, Gonzalez A, Neco P, Caballero-Garrido E, Vieira E, Ripoll C, Nadal A, Quesada I (2012) Papel da leptina na célula beta pancreática: efeitos e vias de sinalização. J Mol Endocrinol 49: R9-17

Hoggard N, Mercer JG, Rayner DV, Moar K, Trayhurn P, Williams LM (1997) Localization of leptin receptor mRNA splice variantes in murine periféricos tecidos by RT-PCR and in situ hibridation. Biochem Biophys Res Commun 232: 383-387

Bado A, Levasseur S, Attoub S, Kermorgant S, Laigneau JP, Bortoluzzi MN, Moizo L, Lehy T, Guerre-Millo M, Le Marchand-Brustel Y, Lewin MJ (1998) O estômago é uma fonte de leptina. Nature 394: 790-793

Wang J, Liu R, Hawkins M, Barzilai N, Rossetti L (1998) Uma via de detecção de nutrientes regula a expressão do gene da leptina no músculo e na gordura. Nature 393: 684-688

Dessolin S, Schalling M, Champigny O, Lonnqvist F, Ailhaud G, Dani C, Ricquier D (1997) O gene da leptina é expresso em tecido adiposo marrom de rato no nascimento. FASEB J 11: 382-387

Cioffi JA, Van Blerkom J, Antczak M, Shafer A, Wittmer S, Snodgrass HR (1997) A expressão de leptina e seus receptores em folículos humanos pré-ovulatórios. Mol Hum Reprod 3: 467-472

Masuzaki H, Ogawa Y, Sagawa N, Hosoda K, Matsumoto T, Mise H, Nishimura H, Yoshimasa Y, Tanaka I, Mori T, Nakao K (1997) Produção de tecido não adiposo de leptina: leptina como um novo hormônio derivado da placenta em humanos. Nat Med 3: 1029–1033

Jin L, Burguera BG, Couce ME, Scheithauer BW, Lamsan J, Eberhardt NL, Kulig E, Lloyd RV (1999) Leptina e expressão do receptor de leptina na pituitária humana normal e neoplásica: evidência de um papel regulador para leptina na proliferação de células pituitárias. J Clin Endocrinol Metab 84: 2903–2911

Wilkinson M, Brown R, Imran SA, Ur E (2007) Adipokine gene expression in brain and pituitary gland. Neuroendocrinology 86: 191–209

Roubos EW, Dahmen M, Kozicz T, Xu L (2012) Leptina e o eixo de estresse hipotálamo-pituitária-adrenal. Gen Comp Endocrinol 177: 28-36

Matarese G, Moschos S, Mantzoros CS (2005) Leptin in immunology. J Immunol 174: 3137–3142

Chan JL, Mantzoros CS (2001) Leptina e a regulação hipotálamo-hipófise do eixo gonadotrofina-gonadal. Pituitária 4: 87-92

Houseknecht KL, Portocarrero CP (1998) Leptina e seus receptores: reguladores da homeostase de energia de corpo inteiro. Domest Anim Endocrinol 15: 457-475

Gotoda T, Manning BS, Goldstone AP, Imrie H, Evans AL, Strosberg AD, McKeigue PM, Scott J, Aitman TJ (1997) Variação do gene do receptor de leptina e obesidade: falta de associação em uma população masculina britânica branca. Hum Mol Genet 6: 869-876

Tartaglia LA, Dembski M, Weng X, Deng N, Culpepper J, Devos R, Richards GJ, Campfield LA, Clark FT, Deeds J, Muir C, Sanker S, Moriarty A, Moore KJ, Smutko JS, Mays GG, Wool EA , Monroe CA, Tepper RI (1995) Identification and expression cloning of a leptin receptor, OB-R. Cell 83: 1263-1271

Tartaglia LA (1997) The leptin receptor. J Biol Chem 272: 6093–6096

Devos R, Richards JG, Campfield LA, Tartaglia LA, Guisez Y, van der Heyden J, Travernier J, Plaetinck G, Burn P (1996) A proteína OB liga-se especificamente ao plexo coróide de camundongos e ratos. Proc Natl Acad Sci USA 93: 5668–5673

Friedman JM (1998) Leptina, receptores de leptina e o controle do peso corporal. Nutr Rev 56: S38-S46

Munzberg H, Bjornholm M, Bates SH, Myers MG Jr (2005) Ação do receptor de leptina e mecanismos de resistência à leptina. Cell Mol Life Sci 62: 642-652

Bates SH, Myers MG (2004) O papel da leptina → sinalização STAT3 na função neuroendócrina: uma perspectiva integrativa. J Mol Med (Berl) 82: 12-20

Maamra M, Bidlingmaier M, Postel-Vinay MC, Wu Z, Strasburger CJ, Ross RJ (2001) Geração de receptor de leptina solúvel humano por clivagem proteolítica de receptores ancorados à membrana. Endocrinology 142: 4389-4393

Baumann H, Morella KK, White DW, Dembski M, Bailon PS, Kim HK, Lai CF, Tartaglia LA (1996) O receptor de leptina de comprimento total tem capacidades de sinalização de receptores de citocinas do tipo 6 da interleucina. Proc Natl Acad Sci USA 93: 8374-8378

Rosenblum CI, Tota M, Cully D, Smith T, Collum R, Qureshi S, Hess JF, Phillips MS, Hey PJ, Vongs A, Fong TM, Xu L, Chen HY, Smith RG, Schindler C, Van der Ploeg LH ( 1996) A sinalização funcional STAT 1 e 3 pelo receptor de leptina (OB-R) reduziu a expressão do receptor de leptina gordurosa de rato em células transfectadas. Endocrinology 137: 5178–5181

Stahl N, Yancopoulos GD (1993) The alphas, betas, and kinases of cytokine receptor complexes. Cell 74: 587-590

Schindler C, Darnell JE Jr (1995) Transcriptional responses to polypeptide ligands: the JAK-STAT pathway. Annu Rev Biochem 64: 621-651

Ihle JN (1996) STATs: transdutores de sinal e ativadores de transcrição. Cell 84: 331-334

Kelesidis T, Kelesidis I, Chou S, Mantzoros CS (2010) Revisão narrativa: o papel da leptina na fisiologia humana: aplicações clínicas emergentes. Ann Intern Med 152: 93-100

Fong TM, Huang RR, Tota MR, Mao C, Smith T, Varnerin J, Karpitskiy VV, Krause JE, Van der Ploeg LH (1998) Localization of leptin binding domain in the leptin receptor. Mol Pharmacol 53: 234-240

Leinninger GM, Myers MG Jr (2008) Os sinais de LRb atuam em uma rede distribuída de neurônios responsivos à leptina para mediar a ação da leptina. Acta Physiol (Oxf) 192: 49-59

Murakami T, Yamashita T, Iida M, Kuwajima M, Shima K (1997) Uma forma curta de receptor de leptina realiza transdução de sinal. Biochem Biophys Res Commun 231: 26-29

Li Z, Ceccarini G, Eisenstein M, Tan K, Friedman JM (2013) Efeitos fenotípicos de uma mutação induzida da isoforma ObRa do receptor de leptina. Mol Metab 2: 364-375

Dam J, Jockers R (2013) Hunting for the functions of short leptin receiver isoforms. Mol Metab 2: 327-328

Akira S (1999) Funções funcionais das proteínas da família STAT: lições de camundongos knockout. Células-tronco 17: 138-146

Ghilardi N, Ziegler S, Wiestner A, Stoffel R, Heim MH, Skoda RC (1996) Defective STAT signaling by the leptin receiver in diabetic mice. Proc Natl Acad Sci USA 93: 6231–6235

Gong Y, Ishida-Takahashi R, Villanueva EC, Fingar DC, Munzberg H, Myers MG Jr (2007) A forma longa do receptor de leptina regula STAT5 e a proteína ribossomal S6 por meio de mecanismos alternativos. J Biol Chem 282: 31019–31027

Vaisse C, Halaas JL, Horvath CM, Darnell JE Jr, Stoffel M, Friedman JM (1996) Ativação da leptina de Stat3 no hipotálamo de camundongos do tipo selvagem e ob / ob, mas não camundongos db / db. Nat Genet 14: 95-97

Kim KW, Zhao L, Donato J Jr, Kohno D, Xu Y, Elias CF, Lee C, Parker KL, Elmquist JK (2011) O fator esteroidogênico 1 dirige programas que regulam a termogênese induzida por dieta e a ação da leptina no núcleo hipotalâmico medial ventral. Proc Natl Acad Sci USA 108: 10673–10678

Bates SH, Stearns WH, Dundon TA, Schubert M, Tso AWK, Wang YP, Banks AS, Lavery HJ, Haq AK, Maratos-Flier E, Neel BG, Schwartz MW, Myers MG (2003) A sinalização STAT3 é necessária para a regulação da leptina de equilíbrio de energia, mas não reprodução. Nature 421: 856-859

Gao Q, Wolfgang MJ, Neschen S, Morino K, Horvath TL, Shulman GI, Fu XY (2004) A interrupção do transdutor de sinal neural e ativador da transcrição 3 causa obesidade, diabetes, infertilidade e desregulação térmica. Proc Natl Acad Sci USA 101: 4661-4666

Scarpace PJ, Zhang Y (2009) Resistência à leptina: um fator preditor para a obesidade induzida por dieta. Am J Physiol Regul Integr Comp Physiol 296: R493 – R500

Enriori PJ, Evans AE, Sinnayah P, Jobst EE, Tonelli-Lemos L, Billes SK, Glavas MM, Grayson BE, Perello M, Nillni EA, Grove KL, Cowley MA (2007) A obesidade induzida por dieta causa resistência à leptina severa, mas reversível em neurônios de melanocortina arqueados. Cell Metab 5: 181-194

Munzberg H, Huo L, Nillni EA, Hollenberg AN, Bjorbaek C (2003) Papel do transdutor de sinal e ativador da transcrição 3 na regulação da expressão do gene da proopiomelanocortina hipotalâmica pela leptina. Endocrinology 144: 2121–2131

Varela L, Horvath TL (2012) Vias da leptina e da insulina nos neurônios POMC e AgRP que modulam o balanço energético e a homeostase da glicose. EMBO Rep 13: 1079–1086

Joly-Amado A, Denis RG, Castel J, Lacombe A, Cansell C, Rouch C, Kassis N, Dairou J, Cani PD, Ventura-Clapier R, Prola A, Flamment M, Foufelle F, Magnan C, Luquet S (2012 ) Os neurônios AgRP hipotalâmicos controlam a utilização de substrato periférico e a partição de nutrientes. EMBO J 31: 4276-4288

Banks AS, Davis SM, Bates SH, Myers MG Jr (2000) Ativação de sinais a jusante pela forma longa do receptor de leptina. J Biol Chem 275: 14563-14572

Starr R, Willson TA, Viney EM, Murray LJ, Rayner JR, Jenkins BJ, Gonda TJ, Alexander WS, Metcalf D, Nicola NA, Hilton DJ (1997) A family of cytokine-inducible inibitors of signaling. Nature 387: 917-921

Auernhammer CJ, Bousquet C, Melmed S (1999) Autoregulation of pituitary corticotroph SOCS-3 expression: characterization of the murine SOCS-3 promoter. Proc Natl Acad Sci USA 96: 6964–6969

Bjorbaek C, El-Haschimi K, Frantz JD, Flier JS (1999) O papel de SOCS-3 na sinalização da leptina e resistência à leptina. J Biol Chem 274: 30059–30065

May P, Woldt E, Matz RL, Boucher P (2007) A família da proteína relacionada ao receptor de LDL (LRP): uma velha família de proteínas com novas funções fisiológicas. Ann Med 39: 219-228

Liu Q, Zhang J, Zerbinatti C, Zhan Y, Kolber BJ, Herz J, Muglia LJ, Bu G (2011) O receptor de lipoproteína LRP1 regula a sinalização da leptina e a homeostase energética no sistema nervoso central adulto. PLoS Biol 9: e1000575

Ceccarini G, Flavell RR, Butelman ER, Synan M, Willnow TE, Bar-Dagan M, Goldsmith SJ, Kreek MJ, Kothari P, Vallabhajosula S, Muir TW, Friedman JM (2009) Imagens PET da biodistribuição e metabolismo da leptina em roedores e primatas. Cell Metab 10: 148-159

Hama H, Saito A, Takeda T, Tanuma A, Xie Y, Sato K, Kazama JJ, Gejyo F (2004) Evidência indicando que o metabolismo tubular renal da leptina é mediado pela megalina, mas não pelos receptores de leptina. Endocrinology 145: 3935–3940

Dietrich MO, Spuch C, Antequera D, Rodal I, de Yebenes JG, Molina JA, Bermejo F, Carro E (2008) Megalin medeia o transporte de leptina através da barreira sangue-CSF. Neurobiol Aging 29: 902–912

Gil SY, Youn BS, Byun K, Huang H, Namkoong C, Jang PG, Lee JY, Jo YH, Kang GM, Kim HK, Shin MS, Pietrzik CU, Lee B, Kim YB, Kim MS (2013) Clusterin e LRP2 são componentes críticos da via regulatória da alimentação hipotalâmica. Nat Commun 4: 1862

Byun K, Gil SY, Namkoong C, Youn BS, Huang H, Shin MS, Kang GM, Kim HK, Lee B, Kim YB, Kim MS (2014) Clusterin / ApoJ aumenta a sinalização da leptina central através da endocitose mediada por Lrp2. EMBO Rep 15: 801-808

Niswender KD, Morton GJ, Stearns WH, Rhodes CJ, Myers MG Jr, Schwartz MW (2001) Intracellular signaling. Enzima chave na anorexia induzida por leptina. Nature 413: 794-795

Withers DJ, Gutierrez JS, Towery H, Burks DJ, Ren JM, Previs S, Zhang Y, Bernal D, Pons S, Shulman GI, Bonner-Weir S, White MF (1998) Disruption of IRS-2 causa diabetes tipo 2 em camundongos. Nature 391: 900-904

Duan C, Li M, Rui L (2004) SH2-B promove substrato 1 do receptor de insulina (IRS1) - e ativação mediada por IRS2 da via de fosfatidilinositol 3-quinase em resposta à leptina. J Biol Chem 279: 43684–43691

Ren D, Li M, Duan C, Rui L (2005) Identificação de SH2-B como um regulador chave da sensibilidade à leptina, balanço energético e peso corporal em camundongos. Cell Metab 2: 95-104

Niswender KD, Baskin DG, Schwartz MW (2004) Insulina e sua parceria em evolução com a leptina no controle hipotalâmico da homeostase energética. Trends Endocrinol Metab 15: 362-369

Xu AW, Kaelin CB, Takeda K, Akira S, Schwartz MW, Barsh GS (2005) PI3K integra a ação da insulina e leptina em neurônios hipotalâmicos. J Clin Invest 115: 951–958

Hill JW, Williams KW, Ye C, Luo J, Balthasar N, Coppari R, Cowley MA, Cantley LC, Lowell BB, Elmquist JK (2008). J Clin Invest 118: 1796-1805

Backer JM, Myers MG Jr, Shoelson SE, Chin DJ, Sun XJ, Miralpeix M, Hu P, Margolis B, Skolnik EY, Schlessinger J et al (1992) A fosfatidilinositol 3′-quinase é ativada por associação com IRS-1 durante a insulina estimulação. EMBO J 11: 3469–3479

Plum L, Rother E, Munzberg H, Wunderlich FT, Morgan DA, Hampel B, Shanabrough M, Janoschek R, Konner AC, Alber J, Suzuki A, Krone W, Horvath TL, Rahmouni K, Bruning JC (2007) Enhanced leptin- a ativação de Pi3k estimulada no SNC promove a transdiferenciação do tecido adiposo branco. Cell Metab 6: 431-445

Ameixa L, Ma X, Hampel B, Balthasar N, Coppari R, Munzberg H, Shanabrough M, Burdakov D, Rother E, Janoschek R, Alber J, Belgardt BF, Koch L, Seibler J, Schwenk F, Fekete C, Suzuki A , Mak TW, Krone W, Horvath TL, Ashcroft FM, Bruning JC (2006) A sinalização PIP3 reforçada em neurônios POMC causa a ativação do canal KATP e leva à obesidade sensível à dieta. J Clin Invest 116: 1886–1901

Kitamura T, Feng Y, Kitamura YI, Chua SC Jr, Xu AW, Barsh GS, Rossetti L, Accili D (2006) A proteína de Forkhead FoxO1 medeia os efeitos dependentes de Agrp da leptina na ingestão de alimentos. Nat Med 12: 534-540

Baskin DG, Schwartz MW, Seeley RJ, Woods SC, Porte D Jr, Breininger JF, Jonak Z, Schaefer J, Krouse M, Burghardt C, Campfield LA, Burn P, Kochan JP (1999) Variante de splice de forma longa do receptor de leptina expressão de proteínas em corpos celulares de neurônios do cérebro e co-localização com o mRNA do neuropeptídeo Y no núcleo arqueado. J Histochem Cytochem 47: 353–362

Elmquist JK, Bjorbaek C, Ahima RS, Flier JS, Saper CB (1998) Distributions of leptin receptor mRNA isoforms in the rat brain. J Comp Neurol 395: 535-547

Kim KW, Donato J Jr, Berglund ED, Choi YH, Kohno D, Elias CF, Depinho RA, Elmquist JK (2012) FOXO1 no hipotálamo ventromedial regula o balanço energético. J Clin Invest 122: 2578–2589

Huang H, Kong D, Byun KH, Ye C, Koda S, Lee DH, Oh BC, Lee SW, Lee B, Zabolotny JM, Kim MS, Bjorbaek C, Lowell BB, Kim YB (2012) Rho-quinase regula o equilíbrio de energia visando a sinalização do receptor de leptina hipotalâmico. Nat Neurosci 15: 1391–1398

Kim MS, Pak YK, Jang PG, Namkoong C, Choi YS, Won JC, Kim KS, Kim SW, Kim HS, Park JY, Kim YB, Lee KU (2006) Papel do hipotálamo Foxo1 na regulação da ingestão de alimentos e energia homeostase. Nat Neurosci 9: 901–906

Plum L, Lin HV, Dutia R, Tanaka J, Aizawa KS, Matsumoto M, Kim AJ, Cawley NX, Paik JH, Loh YP, DePinho RA, Wardlaw SL, Accili D (2009) O gene de susceptibilidade à obesidade Cpe liga a sinalização de FoxO1 em neurônios hipotalâmicos pró-opiomelanocortina com regulação da ingestão alimentar. Nat Med 15: 1195-1201

Yang G, Lim CY, Li C, Xiao X, Radda GK, Li C, Cao X, Han W (2009) FoxO1 inibe a regulação da leptina da atividade do promotor pró-opiomelanocortina bloqueando a interação de STAT3 com a proteína de especificidade 1. J Biol Chem 284: 3719-3727

Morikawa Y, Ueyama E, Senba E (2004) Ativação induzida por jejum de proteínas quinases ativadas por mitogênio (ERK / p38) no hipotálamo de camundongo. J Neuroendocrinol 16: 105-112

Ueyama E, Morikawa Y, Yasuda T, Senba E (2004) Atenuação da fosforilação induzida por jejum de proteínas quinases ativadas por mitogênio (ERK / p38) no hipotálamo de camundongo em resposta à realimentação. Neurosci Lett 371: 40-44

Myers MG Jr (2004) Sinalização do receptor de leptina e a regulação da fisiologia dos mamíferos. Prog Horm Res recente 59: 287–304

Takahashi Y, Okimura Y, Mizuno I, Iida K, Takahashi T, Kaji H, Abe H, Chihara K (1997) A leptina induz proliferação dependente de proteína quinase ativada por mitogênio de células C3H10T1 / 2. J Biol Chem 272: 12897-12900

Rahmouni K, Sigmund CD, Haynes WG, Mark AL (2009) Hypothalamic ERK medeia os efeitos simpáticos anorexígenos e termogênicos da leptina. Diabetes 58: 536-542

Bjorbaek C, Uotani S, da Silva B, Flier JS (1997) Divergent signaling capacities of the long and short isoforms of the leptin receptor. J Biol Chem 272: 32686-32695

Schlessinger J (2000) Cell signaling by receptor tyrosine kinases. Cell 103: 211–225

Bjorbaek C, Buchholz RM, Davis SM, Bates SH, Pierroz DD, Gu H, Neel BG, Myers MG Jr, Flier JS (2001) Funções divergentes de SHP-2 na ativação ERK por receptores de leptina. J Biol Chem 276: 4747-4755

Bouret SG, Draper SJ, Simerly RB (2004) Ação trófica da leptina em neurônios hipotalâmicos que regulam a alimentação. Science 304: 108-110

Bouret SG, Bates SH, Chen S, Myers MG Jr, Simerly RB (2012) Papéis distintos para sinais de receptor de leptina específicos no desenvolvimento de circuitos de alimentação hipotalâmicos. J Neurosci 32: 1244–1252

Balland E, Dam J, Langlet F, Caron E, Steculorum S, Messina A, Rasika S, Falluel-Morel A, Anouar Y, Dehouck B, Trinquet E, Jockers R, Bouret SG, Prevot V (2014) Tanicitos hipotalâmicos são um Conduto fechado por ERK para leptina no cérebro. Cell Metab 19: 293–301

Hardie DG, Ross FA, Hawley SA (2012) AMPK: um sensor de nutrientes e energia que mantém a homeostase energética. Nat Rev Mol Cell Biol 13: 251-262

Sanders MJ, Ali ZS, Hegarty BD, Heath R, Snowden MA, Carling D (2007) Definindo o mecanismo de ativação da proteína quinase ativada por AMP pela pequena molécula A-769662, um membro da família tienopiridona. J Biol Chem 282: 32539–32548

Mihaylova MM, Shaw RJ (2011) A via de sinalização AMPK coordena o crescimento celular, autofagia e metabolismo. Nat Cell Biol 13: 1016–1023

Hawley SA, Boudeau J, Reid JL, Mustard KJ, Udd L, Makela TP, Alessi DR, Hardie DG (2003) Complexos between the LKB1 tumor supressor, STRAD alpha / beta and MO25 alpha / beta are upstream kinases in the AMP-enabled cascata de proteína quinase. J Biol 2:28

Racioppi L, Means AR (2012) proteína quinase quinase dependente de cálcio / calmodulina 2: papéis na sinalização e fisiopatologia. J Biol Chem 287: 31658–31665

Minokoshi Y, Alquier T, Furukawa N, Kim YB, Lee A, Xue B, Mu J, Foufelle F, Ferre P, Birnbaum MJ, Stuck BJ, Kahn BB (2004) AMP-quinase regula a ingestão de alimentos respondendo a hormônios e nutrientes sinais no hipotálamo. Nature 428: 569–574

Andersson U, Filipsson K, Abbott CR, Woods A, Smith K, Bloom SR, Carling D, Small CJ (2004) A proteína quinase ativada por AMP desempenha um papel no controle da ingestão de alimentos. J Biol Chem 279: 12005-12008

Obici S, Feng Z, Arduini A, Conti R, Rossetti L (2003) A inibição da carnitina hipotalâmica palmitoyltransferase-1 diminui a ingestão de alimentos e a produção de glicose. Nat Med 9: 756-761

Minokoshi Y, Kim YB, Peroni OD, Fryer LG, Muller C, Carling D, Kahn BB (2002) A leptina estimula a oxidação de ácidos graxos pela ativação da proteína quinase ativada por AMP. Nature 415: 339-343

Tanida M, Yamamoto N, Shibamoto T, Rahmouni K (2013) Envolvimento da proteína quinase ativada por AMP hipotalâmico na ativação do nervo simpático induzida por leptina. PLoS One 8: e56660

Djouder N, Tuerk RD, Suter M, Salvioni P, Thali RF, Scholz R, Vaahtomeri K, Auchli Y, Rechsteiner H, Brunisholz RA, Viollet B, Makela TP, Wallimann T, Neumann D, Krek W (2010) PKA fosforilados e inativa AMPKalpha para promover uma lipólise eficiente. EMBO J 29: 469-481

Hurley RL, Barre LK, Wood SD, Anderson KA, Kemp BE, Means AR, Witters LA (2006) Regulação da proteína quinase ativada por AMP por fosforilação multisite em resposta a agentes que elevam cAMP celular. J Biol Chem 281: 36662–36672

Claret M, Smith MA, Batterham RL, Selman C, Choudhury AI, Fryer LG, Clements M, Al-Qassab H, Heffron H, Xu AW, Speakman JR, Barsh GS, Viollet B, Vaulont S, Ashford ML, Carling D, Withers DJ (2007) AMPK é essencial para a regulação da homeostase energética e detecção de glicose por neurônios POMC e AgRP. J Clin Invest 117: 2325–2336

Jacinto E, Hall MN (2003) Tor sinalizando em bugs, cérebro e músculos. Nat Rev Mol Cell Biol 4: 117-126

Dennis PB, Jaeschke A, Saitoh M, Fowler B, Kozma SC, Thomas G (2001) Mammalian TOR: a homeostatic ATP sensor. Science 294: 1102-1105

Cota D, Proulx K, Smith KA, Kozma SC, Thomas G, Woods SC, Seeley RJ (2006) A sinalização mTOR hipotalâmica regula a ingestão de alimentos. Science 312: 927–930

Cota D, Matter EK, Woods SC, Seeley RJ (2008) O papel do alvo mamífero hipotalâmico da sinalização do complexo de rapamicina 1 na obesidade induzida por dieta. J Neurosci 28: 7202–7208

Blouet C, Ono H, Schwartz GJ (2008) A quinase 1 hipotalâmica mediobasal p70 S6 modula o controle da homeostase energética. Cell Metab 8: 459-467

Harlan SM, Guo DF, Morgan DA, Fernandes-Santos C, Rahmouni K (2013) A sinalização mTORC1 hipotalâmica controla a atividade nervosa simpática e a pressão arterial e medeia os efeitos da leptina. Cell Metab 17: 599-606

Dagon Y, Hur E, Zheng B, Wellenstein K, Cantley LC, Kahn BB (2012) p70S6 quinase fosforila AMPK na serina 491 para mediar o efeito da leptina na ingestão de alimentos. Cell Metab 16: 104-112

Kim JG, Horvath TL (2012) sinalização de mTOR desvanece neurônios POMC durante o envelhecimento. Neurônio 75: 356-357

Yang SB, Tien AC, Boddupalli G, Xu AW, Jan YN, Jan LY (2012) A rapamicina melhora a obesidade dependente da idade associada ao aumento da sinalização mTOR em neurônios POMC hipotalâmicos. Neurônio 75: 425-436

Mori H, Inoki K, Munzberg H, Opland D, Faouzi M, Villanueva EC, Ikenoue T, Kwiatkowski D, MacDougald OA, Myers MG Jr, Guan KL (2009) Papel crítico para a atividade de mTOR hipotálamo no balanço energético. Cell Metab 9: 362-374

Marshall WF, Nonaka S (2006) Cilia: sintonizando a antena do celular. Curr Biol 16: R604 – R614

Badano JL, Mitsuma N, Beales PL, Katsanis N (2006) As ciliopatias: uma classe emergente de doenças genéticas humanas. Annu Rev Genomics Hum Genet 7: 125-148

Seo S, Guo DF, Bugge K, Morgan DA, Rahmouni K, Sheffield VC (2009) Requisito de proteínas da síndrome de Bardet-Biedl para sinalização do receptor de leptina. Hum Mol Genet 18: 1323–1331

Nachury MV, Loktev AV, Zhang Q, Westlake CJ, Peranen J, Merdes A, Slusarski DC, Scheller RH, Bazan JF, Sheffield VC, Jackson PK (2007) Um complexo central de proteínas BBS coopera com a GTPase Rab8 para promover a membrana ciliar biogênese. Cell 129: 1201–1213

Stratigopoulos G, LeDuc CA, Cremona ML, Chung WK, Leibel RL (2011) Cut-like homeobox 1 (CUX1) regula a expressão da massa gorda e associada à obesidade e retinite pigmentosa GTPase que interage com o regulador de proteína 1 (RPGRIP1L) genes e coordena a sinalização do receptor de leptina. J Biol Chem 286: 2155–2170

Stratigopoulos G, Martin Carli JF, O'Day DR, Wang L, Leduc CA, Lanzano P, Chung WK, Rosenbaum M, Egli D, Doherty DA, Leibel RL (2014) Hipomorfismo para RPGRIP1L, um gene ciliar vicinal ao locus FTO , causa aumento da adiposidade em camundongos. Cell Metab 19: 767-779

Frayling TM, Timpson NJ, Weedon MN, Zeggini E, Freathy RM, Lindgren CM, Perry JR, Elliott KS, Lango H, Rayner NW, Shields B, Harries LW, Barrett JC, Ellard S, Groves CJ, Knight B, Patch AM , Ness AR, Ebrahim S, Lawlor DA, Ring SM, Ben-Shlomo Y, Jarvelin MR, Sovio U, Bennett AJ, Melzer D, Ferrucci L, Loos RJ, Barroso I, Wareham NJ, Karpe F, Owen KR, Cardon LR , Walker M, Hitman GA, Palmer CN, Doney AS, Morris AD, Smith GD, Hattersley AT, McCarthy MI (2007) Uma variante comum no gene FTO está associada ao índice de massa corporal e predispõe à obesidade infantil e adulta. Science 316: 889-894

Meyre D, Delplanque J, Chevre JC, Lecoeur C, Lobbens S, Gallina S, Durand E, Vatin V, Degraeve F, Proenca C, Gaget S, Korner A, Kovacs P, Kiess W, Tichet J, Marre M, Hartikainen AL , Horber F, Potoczna N, Hercberg S, Levy-Marchal C, Pattou F, Heude B, Tauber M, McCarthy MI, Blakemore AI, Montpetit A, Polychronakos C, Weill J, Coin LJ, Asher J, Elliott P, Jarvelin MR , Visvikis-Siest S, Balkau B, Sladek R, Balding D, Walley A, Dina C, Froguel P (2009) Estudo de associação do genoma para obesidade adulta precoce e mórbida identifica três novos loci de risco em populações europeias. Nat Genet 41: 157–159

Davenport JR, Watts AJ, Roper VC, Croyle MJ, van Groen T, Wyss JM, Nagy TR, Kesterson RA, Yoder BK (2007) A interrupção do transporte intraflagelar em camundongos adultos leva à obesidade e doença renal cística de início lento. Curr Biol 17: 1586–1594

Han YM, Kang GM, Byun K, Ko HW, Kim J, Shin MS, Kim HK, Gil SY, Yu JH, Lee B, Kim MS (2014) A montagem dos cílios promovida por leptina é crítica para o equilíbrio normal de energia. J Clin Invest 124: 2193–2197

Wang Z, Li V, Chan GC, Phan T, Nudelman AS, Xia Z, Storm DR (2009) Os camundongos adultos com deficiência de adenilil ciclase do tipo 3 são obesos. PLoS One 4: e6979

Berbari NF, Pasek RC, Malarkey EB, Yazdi SM, McNair AD, Lewis WR, Nagy TR, Kesterson RA, Yoder BK (2013) A resistência à leptina é uma consequência secundária da obesidade em camundongos mutantes de ciliopatia. Proc Natl Acad Sci USA 110: 7796-7801

Kang GM, Han YM, Ko HW, Kim J, Oh BC, Kwon I, Kim MS (2015) Leptin Elongates Hypothalamic Neuronal Cilia via Transcriptional Regulation and Actin Destabilization. J Biol Chem 290: 18146–18155

Heymsfield SB, Greenberg AS, Fujioka K, Dixon RM, Kushner R, Hunt T, Lubina JA, Patane J, Self B, Hunt P, McCamish M (1999) Leptina recombinante para perda de peso em adultos obesos e magros: um randomizado, controlado , ensaio de escalonamento de dose. JAMA 282: 1568–1575

Hukshorn CJ, Saris WH, Westerterp-Plantenga MS, Farid AR, Smith FJ, Campfield LA (2000) Administração semanal subcutânea peguilada de leptina humana nativa recombinante (PEG-OB) em homens obesos. J Clin Endocrinol Metab 85: 4003-4009

Frederich RC, Hamann A, Anderson S, Lollmann B, Lowell BB, Flier JS (1995) Os níveis de leptina refletem o conteúdo de lipídios corporais em camundongos: evidência de resistência induzida por dieta à ação da leptina. Nat Med 1: 1311-1314

Myers MG Jr, Heymsfield SB, Haft C, Kahn BB, Laughlin M, Leibel RL, Tschop MH, Yanovski JA (2012) Desafios e oportunidades de definir resistência clínica à leptina. Cell Metab 15: 150-156

Hubschle T, Thom E, Watson A, Roth J, Klaus S, Meyerhof W (2001) translocação nuclear induzida por leptina de imunorreatividade STAT3 em núcleos hipotalâmicos envolvidos na regulação do peso corporal. J Neurosci 21: 2413–2424

El-Haschimi K, Pierroz DD, Hileman SM, Bjorbaek C, Flier JS (2000) Dois defeitos contribuem para a resistência hipotalâmica à leptina em camundongos com obesidade induzida por dieta. J Clin Invest 105: 1827–1832

Bjorbaek C, Elmquist JK, Frantz JD, Shoelson SE, Flier JS (1998) Identificação de SOCS-3 como um mediador potencial da resistência à leptina central. Mol Cell 1: 619-625

Howard JK, Cave BJ, Oksanen LJ, Tzameli I, Bjorbaek C, Flier JS (2004) Sensibilidade aumentada à leptina e atenuação da obesidade induzida por dieta em ratos com haploinsuficiência de Socs3. Nat Med 10: 734-738

Mori H, Hanada R, Hanada T, Aki D, Mashima R, Nishinakamura H, Torisu T, Chien KR, Yasukawa H, Yoshimura A (2004) A deficiência de Socs3 no cérebro eleva a sensibilidade à leptina e confere resistência à obesidade induzida por dieta. Nat Med 10: 739-743

Kievit P, Howard JK, Badman MK, Balthasar N, Coppari R, Mori H, Lee CE, Elmquist JK, Yoshimura A, Flier JS (2006) Sensibilidade à leptina aprimorada e homeostase da glicose aprimorada em camundongos sem supressor de sinalização de citocina-3 em POMC -expressando células. Cell Metab 4: 123-132

Reed AS, Unger EK, Olofsson LE, Piper ML, Myers MG Jr, Xu AW (2010) Functional role of supressor of cytokine signaling 3 upregulation na resistência à leptina hipotalâmica e homeostase energética de longo prazo. Diabetes 59: 894-906

Munzberg H, Flier JS, Bjorbaek C (2004) Resistência à leptina específica da região dentro do hipotálamo de ratos obesos induzidos por dieta. Endocrinology 145: 4880–4889

Ottaway N, Mahbod P, Rivero B, Norman LA, Gertler A, D’Alessio DA, Perez-Tilve D (2015) Camundongos obesos induzidos por dieta retêm a ação da leptina endógena. Cell Metab 21: 877-882

Olofsson LE, Unger EK, Cheung CC, Xu AW (2013) Modulation of AgRP-neuronal function by SOCS3 as a start event in diet-induzida hipotalâmica resistência à leptina. Proc Natl Acad Sci USA 110: E697 – E706

Myers MG Jr (2015) A leptina continua funcionando, mesmo na obesidade. Cell Metab 21: 791-792

Frangioni JV, Beahm PH, Shifrin V, Jost CA, Neel BG (1992) The nontransmembrane tyrosine phosphatase PTP-1B localiza-se no retículo endoplasmático através da sua sequência C-terminal de 35 aminoácidos. Cell 68: 545-560

Zabolotny JM, Bence-Hanulec KK, Stricker-Krongrad A, Haj F, Wang Y, Minokoshi Y, Kim YB, Elmquist JK, Tartaglia LA, Kahn BB, Neel BG (2002) PTP1B regula a transdução do sinal de leptina in vivo. Dev Cell 2: 489-495

Kaszubska W, Falls HD, Schaefer VG, Haasch D, Frost L, Hessler P, Kroeger PE, White DW, Jirousek MR, Trevillyan JM (2002) A proteína tirosina fosfatase 1B regula negativamente a sinalização da leptina em uma linha celular hipotalâmica. Mol Cell Endocrinol 195: 109-118

Myers MP, Andersen JN, Cheng A, Tremblay ML, Horvath CM, Parisien JP, Salmeen A, Barford D, Tonks NK (2001) TYK2 e JAK2 são substratos de proteína-tirosina fosfatase 1B. J Biol Chem 276: 47771–47774

Xue B, Pulinilkunnil T, Murano I, Bence KK, He H, Minokoshi Y, Asakura K, Lee A, Haj F, Furukawa N, Catalano KJ, Delibegovic M, Balschi JA, Cinti S, Neel BG, Kahn BB (2009) A deficiência da proteína tirosina fosfatase 1B neuronal resulta na inibição da AMPK hipotalâmica e na ativação específica de isoforma da AMPK em tecidos periféricos. Mol Cell Biol 29: 4563–4573

Klaman LD, Boss O, Peroni OD, Kim JK, Martino JL, Zabolotny JM, Moghal N, Lubkin M, Kim YB, Sharpe AH, Stricker-Krongrad A, Shulman GI, Neel BG, Kahn BB (2000) Aumento do gasto de energia, diminuição da adiposidade e sensibilidade à insulina específica do tecido em camundongos deficientes em proteína tirosina fosfatase 1B. Mol Cell Biol 20: 5479-5489

Bence KK, Delibegovic M, Xue B, Gorgun CZ, Hotamisligil GS, Neel BG, Kahn BB (2006) O neuronal PTP1B regula o peso corporal, a adiposidade e a ação da leptina. Nat Med 12: 917-924

Cheng A, Uetani N, Simoncic PD, Chaubey VP, Lee-Loy A, McGlade CJ, Kennedy BP, Tremblay ML (2002) Atenuação da ação da leptina e regulação da obesidade pela proteína tirosina fosfatase 1B. Dev Cell 2: 497-503

Picardi PK, Calegari VC, Prada PO, Moraes JC, Araujo E, Marcondes MC, Ueno M, Carvalheira JB, Velloso LA, Saad MJ (2008) A redução da proteína tirosina fosfatase hipotalâmica melhora a resistência à insulina e leptina em ratos obesos induzidos por dieta. Endocrinology 149: 3870–3880

Tsou RC, Rak KS, Zimmer DJ, Bence KK (2014) O fenótipo metabólico melhorado da deficiência de PTP1B hipotalâmica é dependente do receptor de leptina. Mol Metab 3: 301-312

Zabolotny JM, Kim YB, Welsh LA, Kershaw EE, Neel BG, Kahn BB (2008) A expressão da proteína-tirosina fosfatase 1B é induzida por inflamação in vivo. J Biol Chem 283: 14230–14241

White CL, Whittington A, Barnes MJ, Wang Z, Bray GA, Morrison CD (2009) As dietas de HF aumentam o PTP1B hipotalâmico e induzem resistência à leptina por meio de mecanismos dependentes e independentes de leptina. Am J Physiol Endocrinol Metab 296: E291 – E299

Morrison CD, White CL, Wang Z, Lee SY, Lawrence DS, Cefalu WT, Zhang ZY, Gettys TW (2007) O aumento da proteína tirosina fosfatase 1B hipotalâmica contribui para a resistência à leptina com a idade. Endocrinology 148: 433-440

Chen HH, Schock SC, Xu J, Safarpour F, Thompson CS, Stewart AF (2007) A regulação positiva dependente de ATP extracelular do cofator de transcrição LMO4 promove a sobrevivência do neurônio a partir da hipóxia. Exp Cell Res 313: 3106–3116

Zhou X, Gomez-Smith M, Qin Z, Duquette PM, Cardenas-Blanco A, Rai PS, Harper ME, Tsai EC, Anisman H, Chen HH (2012) A ablação de LMO4 em neurônios glutamatérgicos prejudica o controle da leptina do metabolismo da gordura. Cell Mol Life Sci 69: 819-828

Pandey NR, Zhou X, Qin Z, Zaman T, Gomez-Smith M, Keyhanian K, Anisman H, Brunel JM, Stewart AF, Chen HH (2013) O domínio LIM apenas 4 proteína é um inibidor responsivo metabólico da proteína tirosina fosfatase 1B que controla a sinalização de leptina hipotalâmica. J Neurosci 33: 12647–12655

Lantz KA, Hart SG, Planey SL, Roitman MF, Ruiz-White IA, Wolfe HR, McLane MP (2010) A inibição de PTP1B por trodusquemina (MSI-1436) causa perda de peso específica de gordura em camundongos obesos induzidos por dieta. Obesidade (Silver Spring) 18: 1516-1523

Qin Z, Pandey NR, Zhou X, Stewart CA, Hari A, Huang H, Stewart AF, Brunel JM, Chen HH (2015) Functional properties of Claramine: um novo inibidor de PTP1B e composto mimético de insulina. Biochem Biophys Res Commun 458: 21-27

Rousso-Noori L, Knobler H, Levy-Apter E, Kuperman Y, Neufeld-Cohen A, Keshet Y, Akepati VR, Klinghoffer RA, Chen A, Elson A (2011) A proteína tirosina fosfatase épsilon afeta o peso corporal ao diminuir a sinalização da leptina uma maneira dependente de fosforilação. Cell Metab 13: 562-572

Loh K, Fukushima A, Zhang X, Galic S, Briggs D, Enriori PJ, Simonds S, Wiede F, Reichenbach A, Hauser C, Sims NA, Bence KK, Zhang S, Zhang ZY, Kahn BB, Neel BG, Andrews ZB , Cowley MA, Tiganis T (2011) O TCPTP hipotalâmico elevado na obesidade contribui para a resistência à leptina celular. Cell Metab 14: 684-699

St-Pierre J, Tremblay ML (2012) Modulação da resistência à leptina por proteínas tirosina fosfatases. Cell Metab 15: 292-297

De Souza CT, Araujo EP, Bordin S, Ashimine R, Zollner RL, Boschero AC, Saad MJ, Velloso LA (2005) O consumo de uma dieta rica em gorduras ativa uma resposta pró-inflamatória e induz resistência à insulina no hipotálamo. Endocrinology 146: 4192–4199

Thaler JP, Yi CX, Schur EA, Guyenet SJ, Hwang BH, Dietrich MO, Zhao X, Sarruf DA, Izgur V, Maravilla KR, Nguyen HT, Fischer JD, Matsen ME, Wisse BE, Morton GJ, Horvath TL, Baskin DG , Tschop MH, Schwartz MW (2012) A obesidade está associada a lesão hipotalâmica em roedores e humanos. J Clin Invest 122: 153-162

Zhang X, Zhang G, Zhang H, Karin M, Bai H, Cai D (2008) Hypothalamic IKKbeta / NF-kappaB e ER vinculam a supernutrição ao desequilíbrio energético e à obesidade. Cell 135: 61-73

Posey KA, Clegg DJ, Printz RL, Byun J, Morton GJ, Vivekanandan-Giri A, Pennathur S, Baskin DG, Heinecke JW, Woods SC, Schwartz MW, Niswender KD (2009) Acúmulo de lipídeos pró-inflamatórios hipotálamo, inflamação e resistência à insulina em ratos alimentados com uma dieta rica em gordura. Am J Physiol Endocrinol Metab 296: E1003 – E1012

Meng Q, Cai D (2011) A autofagia hipotalâmica defeituosa direciona a patogênese central da obesidade através da via IkappaB quinase beta (IKKbeta) / NF-kappaB. J Biol Chem 286: 32324-32332

Benzler J, Ganjam GK, Pretz D, Oelkrug R, Koch CE, Legler K, Stohr S, Culmsee C, Williams LM, Tups A (2015) A inibição central da sinalização IKKbeta / NF-kappaB atenua a obesidade induzida por dieta rica em gordura e Intolerância à glicose. Diabetes 64: 2015–2027

Tsaousidou E, Paeger L, Belgardt BF, Pal M, Wunderlich CM, Bronneke H, Collienne U, Hampel B, Wunderlich FT, Schmidt-Supprian M, Kloppenburg P, Bruning JC (2014) Funções distintas para ativação de JNK e IKK em agouti- neurônios peptídicos relacionados no desenvolvimento de obesidade e resistência à insulina. Cell Rep 9: 1495-1506

Jang PG, Namkoong C, Kang GM, Hur MW, Kim SW, Kim GH, Kang Y, Jeon MJ, Kim EH, Lee MS, Karin M, Baik JH, Park JY, Lee KU, Kim YB, Kim MS (2010) A ativação do NF-kappaB em neurônios hipotalâmicos pró-opiomelanocortina é essencial na anorexia induzida por doença e leptina. J Biol Chem 285: 9706–9715

Shi X, Wang X, Li Q, Su M, Chew E, Wong ET, Lacza Z, Radda GK, Tergaonkar V, Han W (2013) O fator nuclear kappaB (NF-kappaB) suprime a ingestão de alimentos e o gasto de energia em camundongos por meio de ativando o promotor Pomc. Diabetologia 56: 925–936

Wang X, Ge A, Cheng M, Guo F, Zhao M, Zhou X, Liu L, Yang N (2012) Aumento da inflamação hipotalâmica associada à suscetibilidade à obesidade em ratos expostos a dieta rica em gordura. Exp Diabetes Res 2012: 847246

Milanski M, Degasperi G, Coope A, Morari J, Denis R, Cintra DE, Tsukumo DM, Anhe G, Amaral ME, Takahashi HK, Curi R, Oliveira HC, Carvalheira JB, Bordin S, Saad MJ, Velloso LA (2009) Os ácidos graxos saturados produzem uma resposta inflamatória predominantemente por meio da ativação da sinalização de TLR4 no hipotálamo: implicações para a patogênese da obesidade. J Neurosci 29: 359-370

Romanatto T, Roman EA, Arruda AP, Denis RG, Solon C, Milanski M, Moraes JC, Bonfleur ML, Degasperi GR, Picardi PK, Hirabara S, Boschero AC, Curi R, Velloso LA (2009) Deleção do fator de necrose tumoral- O receptor alfa 1 (TNFR1) protege contra a obesidade induzida por dieta por meio do aumento da termogênese. J Biol Chem 284: 36213–36222

Milanski M, Arruda AP, Coope A, Ignacio-Souza LM, Nunez CE, Roman EA, Romanatto T, Pascoal LB, Caricilli AM, Torsoni MA, Prada PO, Saad MJ, Velloso LA (2012) A inibição da inflamação hipotalâmica reverte a dieta resistência induzida à insulina no fígado. Diabetes 61: 1455-1462

Romanatto T, Cesquini M, Amaral ME, Roman EA, Moraes JC, Torsoni MA, Cruz-Neto AP, Velloso LA (2007) TNF-alfa atua no hipotálamo inibindo a ingestão de alimentos e aumentando o quociente respiratório - efeitos sobre a leptina e a sinalização da insulina caminhos. Peptídeos 28: 1050–1058

Ropelle ER, Flores MB, Cintra DE, Rocha GZ, Pauli JR, Morari J, de Souza CT, Moraes JC, Prada PO, Guadagnini D, Marin RM, Oliveira AG, Augusto TM, Carvalho HF, Velloso LA, Saad MJ, Carvalheira JB (2010) A atividade antiinflamatória de IL-6 e IL-10 vincula o exercício à insulina hipotalâmica e à sensibilidade à leptina por meio da inibição do estresse por IKKbeta e ER. PLoS Biol 8: e1000465

Luheshi GN, Gardner JD, Rushforth DA, Loudon AS, Rothwell NJ (1999). As ações da leptina na ingestão de alimentos e na temperatura corporal são mediadas por IL-1. Proc Natl Acad Sci USA 96: 7047–7052

Cintra DE, Ropelle ER, Moraes JC, Pauli JR, Morari J, Souza CT, Grimaldi R, Stahl M, Carvalheira JB, Saad MJ, Velloso LA (2012) Os ácidos graxos insaturados revertem a inflamação hipotalâmica induzida por dieta na obesidade. PLoS One 7: e30571

Oh IS, Thaler JP, Ogimoto K, Wisse BE, Morton GJ, Schwartz MW (2010) A administração central de interleucina-4 exacerba a inflamação hipotalâmica e o ganho de peso durante a alimentação com alto teor de gordura. Am J Physiol Endocrinol Metab 299: E47 – E53

Takeda K, Kaisho T, Akira S (2003) Toll-like receptors. Annu Rev Immunol 21: 335-376

Suganami T, Tanimoto-Koyama K, Nishida J, Itoh M, Yuan X, Mizuarai S, Kotani H, Yamaoka S, Miyake K, Aoe S, Kamei Y, Ogawa Y (2007) Papel do receptor Toll-like 4 / NF Via -kappaB em alterações inflamatórias induzidas por ácidos graxos saturados na interação entre adipócitos e macrófagos. Arterioscler Thromb Vasc Biol 27: 84-91

Kawai T, Adachi O, Ogawa T, Takeda K, Akira S (1999) Unresponsiveness of MyD88-deficient mice to endotoxin. Imunidade 11: 115-122

Kleinridders A, Schenten D, Konner AC, Belgardt BF, Mauer J, Okamura T, Wunderlich FT, Medzhitov R, Bruning JC (2009) A sinalização MyD88 no SNC é necessária para o desenvolvimento de resistência à leptina induzida por ácidos graxos e obesidade induzida por dieta . Cell Metab 10: 249-259

Weissmann L, Quaresma PG, Santos AC, de Matos AH, Pascoal VD, Zanotto TM, Castro G, Guadagnini D, da Silva JM, Velloso LA, Bittencourt JC, Lopes-Cendes I, Saad MJ, Prada PO (2014) IKKepsilon é chave para a indução da resistência à insulina no hipotálamo, e sua inibição reverte a obesidade. Diabetes 63: 3334-3345

Borges Bde C, Rorato RC, Uchoa ET, Marangon PB, Elias CF, Antunes-Rodrigues J, Elias LL (2015) A proteína tirosina fosfatase-1B contribui para a resistência à leptina induzida por LPS em ratos machos. Am J Physiol Endocrinol Metab 308: E40 – E50

Sachot C, Poole S, Luheshi GN (2004) Circulating leptin medeia anorexia induzida por lipopolissacarídeo e febre em ratos. J Physiol 561: 263-272

Reis WL, Yi CX, Gao Y, Tschop MH, Stern JE (2015) A imunidade inata do cérebro regula a atividade neuronal arqueada hipotalâmica e o comportamento alimentar. Endocrinology 156: 1303–1315

Borges BC, Rorato R, Avraham Y, da Silva LE, Castro M, Vorobiav L, Berry E, Antunes-Rodrigues J, Elias LL (2011) Resistência à leptina e dessensibilização da hipofagia durante o desafio inflamatório prolongado. Am J Physiol Endocrinol Metab 300: E858 – E869

Marciniak SJ, Ron D (2006) Endoplasmic reticulum stress signaling in disease. Physiol Rev 86: 1133-1149

Ron D, Walter P (2007) Signal integration in the endoplasmic reticulum unfolded protein response. Nat Rev Mol Cell Biol 8: 519-529

Ozcan U, Cao Q, Yilmaz E, Lee AH, Iwakoshi NN, Ozdelen E, Tuncman G, Gorgun C, Glimcher LH, Hotamisligil GS (2004) O estresse do retículo endoplasmático liga a obesidade, a ação da insulina e o diabetes tipo 2. Science 306: 457-461

Ozcan L, Ergin AS, Lu A, Chung J, Sarkar S, Nie D, Myers MG Jr, Ozcan U (2009) O estresse do retículo endoplasmático desempenha um papel central no desenvolvimento da resistência à leptina. Cell Metab 9: 35-51

Won JC, Jang PG, Namkoong C, Koh EH, Kim SK, Park JY, Lee KU, Kim MS (2009) A administração central de um indutor de estresse do retículo endoplasmático inibe os efeitos anorexigênicos da leptina e da insulina. Obesidade (Silver Spring) 17: 1861-1865

Alfieri A, Pasanisi F, Salzano S, Esposito L, Martone D, Tafuri D, Daniele A, Contaldo F, Sacchetti L, Zagari A, Buono P (2010) Análise funcional de mutantes do receptor de melanocortina-4 identificados em indivíduos gravemente obesos vivos no sul da Itália. Gene 457: 35-41

Granell S, Mohammad S, Ramanagoudr-Bhojappa R, Baldini G (2010) Variantes ligadas à obesidade do receptor de melanocortina-4 são mal dobradas no retículo endoplasmático e podem ser resgatadas para a superfície da célula por um acompanhante químico. Mol Endocrinol 24: 1805–1821

Williams KW, Liu T, Kong X, Fukuda M, Deng Y, Berglund ED, Deng Z, Gao Y, Liu T, Sohn JW, Jia L, Fujikawa T, Kohno D, Scott MM, Lee S, Lee CE, Sun K , Chang Y, Scherer PE, Elmquist JK (2014) Xbp1s em neurônios Pomc conecta o estresse ER com balanço energético e homeostase da glicose. Cell Metab 20: 471-482

Ramirez S, Claret M (2015) Hypothalamic ER stress: a bridge entre a resistência à leptina e a obesidade. FEBS Lett 589: 1678-1687

Cragle FK, Baldini G (2014) O estresse lipídico leve induz perda profunda da abundância e função da proteína MC4R. Mol Endocrinol 28: 357-367

Purkayastha S, Zhang H, Zhang G, Ahmed Z, Wang Y, Cai D (2011) Desregulação neural da ação da insulina periférica e da pressão sanguínea pelo estresse do retículo endoplasmático do cérebro. Proc Natl Acad Sci USA 108: 2939–2944

Hoepfner D, Schildknegt D, Braakman I, Philippsen P, Tabak HF (2005) Contribuição do retículo endoplasmático para a formação de peroxissoma. Cell 122: 85-95

Semple RK, Chatterjee VK, O’Rahilly S (2006) PPAR gama e doença metabólica humana. J Clin Invest 116: 581–589

Ryan KK, Li B, Grayson BE, Matter EK, Woods SC, Seeley RJ (2011) Um papel do sistema nervoso central PPAR-gama na regulação do balanço de energia. Nat Med 17: 623-626

Diano S, Liu ZW, Jeong JK, Dietrich MO, Ruan HB, Kim E, Suyama S, Kelly K, Gyengesi E, Arbiser JL, Belsham DD, Sarruf DA, Schwartz MW, Bennett AM, Shanabrough M, Mobbs CV, Yang X , Gao XB, Horvath TL (2011) O controle associado à proliferação de peroxissoma de espécies reativas de oxigênio define o tom da melanocortina e a alimentação na obesidade induzida por dieta. Nat Med 17: 1121-1127

Long L, Toda C, Jeong JK, Horvath TL, Diano S (2014) A ablação PPARgamma sensibiliza os neurônios da proopiomelanocortina à leptina durante a alimentação com alto teor de gordura. J Clin Invest 124: 4017–4027

Schneeberger M, Dietrich MO, Sebastian D, Imbernon M, Castano C, Garcia A, Esteban Y, Gonzalez-Franquesa A, Rodriguez IC, Bortolozzi A, Garcia-Roves PM, Gomis R, Nogueiras R, Horvath TL, Zorzano A, Claret M (2013) A mitofusina 2 em neurônios POMC conecta o estresse ER com resistência à leptina e desequilíbrio de energia. Cell 155: 172-187

Dietrich MO, Liu ZW, Horvath TL (2013) A dinâmica mitocondrial controlada por mitofusinas regula a atividade neuronal de Agrp e a obesidade induzida por dieta. Cell 155: 188–199

Calfon M, Zeng H, Urano F, Till JH, Hubbard SR, Harding HP, Clark SG, Ron D (2002) IRE1 acopla a carga do retículo endoplasmático à capacidade secretória processando o mRNA de XBP-1. Nature 415: 92-96

Hirosumi J, Tuncman G, Chang L, Gorgun CZ, Uysal KT, Maeda K, Karin M, Hotamisligil GS (2002) Um papel central para JNK na obesidade e resistência à insulina. Nature 420: 333-336

Belgardt BF, Mauer J, Wunderlich FT, Ernst MB, Pal M, Spohn G, Bronneke HS, Brodesser S, Hampel B, Schauss AC, Bruning JC (2010) Hipotálamo e hipofisário c-Jun N-terminal quinase 1 sinaliza coordenadamente a glicose metabolismo. Proc Natl Acad Sci USA 107: 6028–6033

Benzler J, Ganjam GK, Legler K, Stohr S, Kruger M, Steger J, Tups A (2013) A inibição aguda da quinase N-terminal c-Jun central restaura a sinalização de insulina hipotalâmica e alivia a intolerância à glicose em camundongos diabéticos. J Neuroendocrinol 25: 446-454

Kim JK, Fillmore JJ, Sunshine MJ, Albrecht B, Higashimori T, Kim DW, Liu ZX, Soos TJ, Cline GW, O'Brien WR, Littman DR, Shulman GI (2004) PKC-theta knockout camundongos são protegidos de gordura- resistência induzida à insulina. J Clin Invest 114: 823-827

Benoit SC, Kemp CJ, Elias CF, Abplanalp W, Herman JP, Migrenne S, Lefevre AL, Cruciani-Guglielmacci C, Magnan C, Yu F, Niswender K, Irani BG, Holland WL, Clegg DJ (2009) O ácido palmítico medeia o hipotálamo resistência à insulina por meio da alteração da localização subcelular de PKC-teta em roedores. J Clin Invest 119: 2577–2589

Fukuda M, Williams KW, Gautron L, Elmquist JK (2011) Indução da resistência à leptina pela ativação da sinalização cAMP-Epac. Cell Metab 13: 331-339

de Rooij J, Zwartkruis FJ, Verheijen MH, Cool RH, Nijman SM, Wittinghofer A, Bos JL (1998) Epac é um fator de troca de nucleotídeo de guanina Rap1 diretamente ativado por AMP cíclico. Nature 396: 474-477

Leshan RL, Greenwald-Yarnell M, Patterson CM, Gonzalez IE, Myers MG Jr (2012) A ação da leptina por meio de neurônios hipotalâmicos que expressam óxido nítrico sintase-1 controla o equilíbrio de energia. Nat Med 18: 820-823

Vong L, Ye C, Yang Z, Choi B, Chua S Jr, Lowell BB (2011) A ação da leptina nos neurônios GABAérgicos previne a obesidade e reduz o tônus ​​inibitório para os neurônios POMC. Neurônio 71: 142-154

Fuente-Martin E, Garcia-Caceres C, Granado M, de Ceballos ML, Sanchez-Garrido MA, Sarman B, Liu ZW, Dietrich MO, Tena-Sempere M, Argente-Arizon P, Diaz F, Argente J, Horvath TL, Chowen JA (2012) A leptina regula o glutamato e os transportadores de glicose em astrócitos hipotalâmicos. J Clin Invest 122: 3900-3913

Kim JG, Suyama S, Koch M, Jin S, Argente-Arizon P, Argente J, Liu ZW, Zimmer MR, Jeong JK, Szigeti-Buck K, Gao Y, Garcia-Caceres C, Yi CX, Salmaso N, Vaccarino FM , Chowen J, Diano S, Dietrich MO, Tschop MH, Horvath TL (2014) A sinalização de leptina em astrócitos regula os circuitos neuronais hipotalâmicos e a alimentação. Nat Neurosci 17: 908–910


Regulação Central de Ingestão de Alimentos e Despesas de Energia

A regulação da ingestão de alimentos é coordenada por mecanismos centrais, particularmente no hipotálamo. O hipotálamo desempenha um papel importante na regulação do apetite e do gasto de energia. Particularmente, o núcleo arqueado do núcleo arqueado do hipotálamo (ARC) é crítico para a regulação do apetite e o mecanismo da obesidade. Existem muitos fatores a serem considerados na regulação hipotalâmica da ingestão de alimentos, por exemplo, hormônio concentrador de melanina (MCH), NPY, proteína relacionada à cutia (AgRP), proopiomelanocortina (POMC), transcrição responsiva à cocaína e anfetamina (CART), oxitocina, arginina vasopressina, fator neurotrófico derivado do cérebro (BDNF), serotonina (5-HT), fator de liberação de corticotropina (CRF) e as urocortinas (UCN1, UCN2, UCN3).

O ARC se projeta para outros locais do hipotálamo, como o núcleo periventricular (PVN), núcleos dorsomediais (DMH) do hipotálamo e a área hipotalâmica lateral (LHA). Os neurônios incluem POMC, NPY e AgRP estão localizados em ARC. Os outros neurônios incluem & # x003B1-melanócito & # x02013 hormônio estimulador (& # x003B1MSH), que são os peptídeos de melanocortina derivados de POMC. Os neurônios NPY / AgRP liberam os peptídeos orexigênicos NPY e AgRP, levando ao aumento da ingestão de alimentos (Williams et al., 2011 Xu et al., 2011). Em contraste, os neurônios POMC sintetizam e secretam um peptídeo anorexigênico, & # x003B1-MSH, que ativa os receptores de melanocortina e leva à diminuição da ingestão de alimentos. A administração central ou periférica de leptina aumenta a expressão de mRNA de POMC / CART, e os mRNAs de NPY e AgRP são inibidos pela administração de leptina.

Os outros fatores importantes são os sistemas CRF e 5-HT. O CRF e a urocortina do ligante do receptor do CRF endógeno são peptídeos inibidores da alimentação localizados no PVN. A urocortina liga-se aos receptores do CRF tipo 1 e 2, mas mostra uma afinidade maior para o receptor do CRF tipo 2 do que o receptor do tipo 1. Os receptores do CRF tipo 2 estão relacionados às alterações induzidas pelo estresse das funções gastrointestinais (Asakawa et al., 1999, Ushikai et al., 2011 Fujimiya et al., 2012).

Os sistemas centrais de 5-HT também desempenham um papel importante na supressão da alimentação. Particularmente, o receptor 5-HT2C (5-HT2CR) e os receptores 5-HT1B (5-HT1BRs) são amplamente expressos no sistema nervoso central (SNC), mediando a atividade anorexigênica de agonistas e antagonistas do receptor endógeno de melanocortina no receptor de melanocortina 4 (MC4R) (Lam et al., 2008 Marston et al., 2011). O 5-HT atua no 5-HT2CR em neurônios POMC para regular a alimentação e a sensibilidade à insulina por meio das vias de sinalização MC4R (Zhou et al., 2007). A depleção de 5-HT não prejudica os efeitos anorexígenos da leptina, o que sugere que a leptina não faz com que os neurônios de serotonina do SNC influenciem diretamente o apetite (Lam et al., 2011).

No peptídeo regulador da alimentação periférica, a grelina age inversamente com a leptina. A grelina é um agonista endógeno do receptor do secretagogo do hormônio do crescimento (GH) e é membro da família de peptídeos reguladores relacionados à motilina. Além de sua capacidade de estimular a secreção de GH e a motilidade gástrica, a grelina estimula o apetite e induz um balanço energético positivo que leva ao ganho de peso. A leptina e a grelina são sinais complementares, embora antagônicos, que refletem mudanças agudas e crônicas no balanço energético. As vias aferentes endócrinas e vagais estão envolvidas nessas ações da grelina e da leptina (Inui et al., 2004). A grelina ativa os neurônios NPY / AgRP no PVN e suprime a atividade neuronal POMC para regular a ingestão de alimentos (Cowley et al., 2003). Quanto às funções glicorregulatórias, níveis aumentados de leptina estão associados à obesidade e diabetes tipo 2, enquanto os níveis diminuídos de grelina estão associados à obesidade e resistência à insulina, em vez de diabetes tipo 2. A taxa de infusão de glicose se correlacionou positivamente com a grelina plasmática e negativamente com os níveis de leptina sérica (Zhang et al., 2012).


RESULTADOS

Experimento 1: imuno-histoquímica de dupla marcação

Avaliamos a hipótese de sobreposição na distribuição de POMC e do receptor de insulina (subunidade β) por imuno-histoquímica de dupla marcação qualitativa. Em primeiro lugar, a imunorreatividade para o receptor-β da insulina estava presente em áreas do cérebro que antes continham mRNA ou locais de ligação (Baskin et al., 1983), incluindo hipocampo e núcleo arqueado (Fig. 1). Não foi observada imunorreatividade do receptor β de insulina em áreas do cérebro que não expressam mRNA do receptor de insulina. Em segundo lugar, em todas as seções observadas, os neurônios arqueados com imunorreatividade POMC também apresentaram imunorreatividade para o receptor-β da insulina. A Figura 1 mostra uma seção representativa com co-localização de POMC e imunorreatividade do receptor de insulina-β no núcleo arqueado em bregma -2,4 mm. Extensa colocalização de POMC e receptor de insulina-β foi observada em todo o núcleo em ambos os neurônios arqueados medial e lateral. A maioria (∼90%) das células com imunorreatividade POMC também apresentava imunorreatividade do receptor-β de insulina. No entanto, nem todos os neurônios imunopositivos para o receptor β de insulina coexpressam a imunorreatividade do POMC. As células positivas apenas para o receptor β de insulina foram distribuídas ao longo do arqueado, mas principalmente observadas nas seções mais rostrais. Além disso, os controles imunocitoquímicos demonstraram especificidade do anticorpo primário. Tanto a omissão do anticorpo primário quanto a pré-absorção no anti-soro diluído bloquearam a imunorreatividade do receptor β de insulina.

Imuno-histoquímica de rótulo duplo para receptor-β de insulina e POMC. o dois primeirospainéissão imagens confocais (seção óptica de 5 μm) de neurônios ARC. A imunorreatividade positiva para o receptor de insulina β é ilustrada emverde (UMA), enquanto a imunorreatividade POMC-positiva é representada em vermelho(B). C, Uma sobreposição das imagens acima. VerdeSetas; flechas apontar para neurônios com rótulo único amareloSetas; flechasindicam neurônios com dupla marcação. Barra de escala, 50 μm.

Experimento 2: expressão POMC

Para testar a hipótese de que a insulina regula positivamente a expressão de POMC no ARC, a insulina foi administrada no terceiro ventrículo de ratos em jejum e a expressão de POMC comparada com a expressão de POMC em jejum, tratada com solução salina eAD Libitum ratos alimentados foram medidos em extratos hipotalâmicos inteiros por PCR em tempo real (Medhurst et al., 2000). Conforme representado na Figura 2, a expressão de POMC nos ratos tratados com solução salina em jejum foi diminuída em 50% (ANOVA Tukey's post hoc teste p & lt 0,01) em relação àqueles em um grupo de ratos alimentados, um efeito semelhante ao observado em relatórios anteriores (Schwartz et al., 1997 Thornton et al., 1997 Mizuno et al., 1998). Em contraste, a expressão de POMC em ratos em jejum tratados com insulina foi significativamente maior do que o nível em ratos em jejum com solução salina (Tukey's post hoc teste p & lt 0,05) e não significativamente diferente do nível nos controles alimentados. Conseqüentemente, a administração local de insulina atenuou bastante a redução de ARC POMC causada pelo jejum. Os dados de porcentagem de alteração foram analisados ​​com ANOVA de uma via, que produziu um efeito principal significativo do tratamento (F(2,19) = 7.44 p & lt 0,05).

Expressão hipotalâmica de POMC. Expressão POMC após AD Libitum alimentando (deixouBarra), um jejum de 72 horas (barra do meio), e um jejum de 72 horas com infusões i3vt de 4 mU de insulina a cada 12 horas (barra direita) A administração central de insulina aumentou a expressão de POMC em relação ao jejum, e os níveis resultantes não foram diferentes daqueles que ocorreram durante AD Libitumalimentando. *p & lt 0,05.

Experimento 3: ingestão de alimentos

SHU-9119 na ausência de insulina não teve efeito sobre a ingestão de alimentos nesta dose (Fig. 3), nem bloqueou a ação anoréxica do peptídeo-1 semelhante ao glucagon (Seeley et al., 1997). A insulina por si só causou uma redução significativa na ingestão de alimentos (Tukey's post hoc teste p & lt 0,05), e isso foi completamente revertido pela presença de SHU-9119. Os dados de ingestão de alimentos foram analisados ​​com uma ANOVA de medidas repetidas, produzindo um efeito principal significativo dos tratamentos (F(3,12) = 3.52 p & lt 0,05).

Efeito da insulina e SHU-9119 na ingestão de alimentos. Ingestão alimentar média de 4 horas (em gramas) após a administração i3vt de solução salina (Sal), insulina (8 mU) (Ins), SHU-9119 (0,1 nmol) (Shu), e SHU-9119 seguido por insulina (S + I) SHU-9119, por si só, não teve efeito sobre a ingestão de alimentos, enquanto a insulina reduziu significativamente a ingestão em relação ao soro fisiológico. A administração de SHU-9119 antes da administração de insulina bloqueou o efeito da insulina para reduzir a ingestão de alimentos (*p & lt 0,05).


Materiais e métodos

Imortalização e subclonagem celular. As linhas celulares foram geradas usando o método descrito anteriormente (Belsham et al., 2004). Resumidamente, hipotálamo foram colhidos e dissecados de camundongos no dia embrionário 15 (E15), E17 e E18. A cultura de células dissociadas foi então semeada em placas de cultura contendo meio de cultura primário [DMEM, 10% de soro fetal bovino definido inativado por calor (FBS), 10% de soro de cavalo definido inativado por calor, 1% de penicilina-estreptomicina e 20 mmd-glicose Invitrogen, Carlsbad, CA]. As células foram infectadas com retrovírus contendo a sequência de cDNA intacta para o antígeno T grande do vírus símio (SV40) e o gene de resistência à neomicina, colhidos da cultura confluente de células ψ2 [células psitex (Brown et al., 1986)] produzindo um defeito de replicação, recombinante retrovírus murino. Após 48 h em meio de cultura com o retrovírus, as células foram incubadas com meio contendo geneticina (G418) com concentração seletiva (400-600 μg / ml para seleção inicial 250 μg / ml para manutenção celular). Populações mistas de células hipotalâmicas foram posteriormente subclonadas por diluição sucessiva das populações de células tripsinizadas em placas de 96 poços. A diluição ideal permitiu apenas uma ou duas células por poço. As colônias de células foram deixadas crescer e então sucessivamente divididas em placas de 24 poços e, finalmente, em placas de 60 mm. Cada linha celular foi purificada três a quatro vezes. As linhas celulares que expressam NT foram denominadas N-36/1 e N-39.

Cultura de células e tratamento. Linhas celulares imortalizadas foram cultivadas em DMEM suplementado com FBS a 10% (Invitrogen), glicose 20 mm e penicilina / estreptomicina e mantidas a 37 ° C com 5% de CO2. As células N-36/1 ou N-39 foram cultivadas durante a noite até 80-90% de confluência, e o meio foi substituído por DMEM sem soro 12-16 h antes do início dos experimentos. As células foram tratadas com leptina (Sigma-Aldrich, St. Louis, MO), NPY, α-MSH (America Peptide, Sunnyvale, CA) e insulina (DB Biosciences, Mississauga, ON) durante 4 ou 8 h. As placas tratadas com veículo foram usadas como controle em cada ponto de tempo indicado.

Transcriptase reversa-PCR. O RNA total de células N-36/1 ou N-39 foi isolado pelo método de extração de tiocianato de guanidínio fenol clorofórmio (Chomczynski e Sacchi, 1987). O cDNA da primeira fita foi sintetizado de 1 a 10 μg de RNA tratado com desoxirribonuclease I usando a transcriptase reversa SuperScript (RT) e primers aleatórios (Invitrogen), conforme descrito no kit Superscript cDNA Synthesis (Invitrogen). A especificidade de cada reação de amplificação foi monitorada em reações de controle, nas quais a amplificação foi realizada em amostras nas quais o RT foi omitido (RT-). A síntese de cDNA foi seguida por digestão de RNA por RNase H (180 U / ml Invitrogen) em um volume total de 20 μl. As amplificações de PCR foram realizadas com 1,25 U de Taq Vermelho polimerase (Sigma) em uma reação de 50 μl por 40 ciclos (1 min a 94 ° C, temperatura de anelamento e 1 min a 72 ° C). Sempre que possível, os primers foram projetados a partir das sequências de camundongos no GenBank para abranger os íntrons. Os primers usados ​​para RT-PCR estão listados na Tabela 1. Esses produtos foram separados por eletroforese em gel de agarose a 1,2%, corados com 1 μg / ml de brometo de etídio e visualizados sob luz ultravioleta. A identidade foi confirmada por sequenciamento (ACGT, Toronto, Ontário, Canadá). Todos os primers foram feitos por ACGT.

Sequências de primer RT-PCR

Imunocitoquímica. As células foram cultivadas em lâminas de vidro até 60% de confluência. As células cultivadas foram enxaguadas brevemente em PBS, fixadas com acetona: etanol (1: 1) por 10 min a 4 ° C, permeabilizadas com 0,3% de Triton X-100 em PBS por 10 min, e tratadas com 5% de soro de cabra normal que serviu como um agente de bloqueio para ligação não específica por 1 h. A atividade da peroxidase endógena foi extinta por pré-tratamento com peróxido de hidrogênio a 0,3% em PBS. As células foram então lavadas em PBS incubado a 4 ° C durante a noite com anticorpos para neurofilamento (NF) (1: 200 Neomarkers, Fremont, CA) e NT (1: 500 Immunostar, Hudson, WI). As células foram lavadas e incubadas com anticorpo secundário biotinilado (Vector Laboratories, Burlingame, CA) por 60 min, lavadas novamente e incubadas com o complexo avidina biotina-peroxidase (Vector Laboratories) por 60 min adicionais. Após a lavagem final, as proteínas imunorreativas foram visualizadas com a adição de 3,3′diaminobenzidina (Sigma) por 2-10 min. As células foram contrastadas com hematoxilina, desidratadas em etanol graduado e depuradas, e lamínulas foram aplicadas.

Ensaio de proliferação celular. As células N-36/1 ou N-39 (6 × 10 4 / cm 2) foram cultivadas em uma placa de cultura de plástico de 24 poços no DMEM suplementado com 10% de FBS a 37 ° C com 5% de CO2. Nos pontos de tempo indicados, o número de células viáveis ​​foi avaliado pela biorredução de um sal de tetrazólio MTT. Os cristais de formazan azuis resultantes foram solubilizados com dimetilsulfóxido e quantificados espectrofotometricamente a 540 nm.

Análise de Northern blot. A análise de Northern blot foi realizada conforme descrito anteriormente (Belsham et al., 1996). O RNA total foi isolado como descrito acima. Dez microgramas de RNA total foram fracionados por tamanho em géis de agarose-formaldeído a 1% e transferidos para membranas GeneScreen (NEN, Boston, MA) por transferência capilar (Maniatis et al., 1982). Os filtros foram hibridizados com cDNA de NT de camundongo. A hibridização com cDNA de γ-actina de camundongo foi usada para controlar as variações no carregamento do gel e na eficiência de transferência. As sondas de cDNA de NT e γ-actina foram geradas por RT-PCR. A pré-hibridização por 6-8 h e hibridização por 16 h foram conduzidas em um tampão de hibridização de formamida a 25% [1% BSA (w / v), 1 m m EDTA, 0,5 m Na2HPO4, 5% SDS (p / v) e 25% formamida] a 55 ° C. As sondas de cDNA foram marcadas usando hexâmeros aleatórios e α- [32 P] desoxi-CTP (6000 Ci / mmol NEN) incorporado com o fragmento Klenow da DNA polimerase I. Os blots foram lavados em alta restringência (55 ° C 0,5 × SSC, 0,1 % SDS) e exposto ao filme Kodak (Fisher Scientific, Nepean, Ontário, Canadá) a -70 ° C com telas de intensificação por 4-48 h. As autorradiografias foram escaneadas com um scanner Epson 1260 (Epson, Long Beach, CA), e os sinais de mRNA de NT e γ-actina foram quantificados por densitometria usando o programa NIH Image.

RT-PCR quantitativo. O RNA total foi isolado e a transcrição reversa foi realizada como descrito acima. A RT-PCR quantitativa em tempo real foi realizada conforme descrito no SYBR Green PCR Master Mix e Protocolo de PCR (Applied Biosystems, Foster City, CA). Resumidamente, o cDNA foi sintetizado a partir de 2,5 μg de RNA total em um volume total de 10 μl, e 1 μl de cDNA como modelo foi amplificado com SYBR Green Master Mix (Applied Biosystems) e primers de 300 nm em uma reação de 25 ml por 40 ciclos (15 s a 95 ° C 1 min a 60 ° C). As sequências dos iniciadores para cada gene são as seguintes: actina-SYBR-F, 5′-CTTCCCCACGCCATCTTG-3 ′ (direto), actina-SYBR-R, 5′-CCCGTTCAGTCAGGATCTTCAT-3 ′ (reverso) e NT-SYBR- 436, 5′-GGCCTTTCAACACTGGGAGAT-3 ′ (direto), NT-SYBR-588, 5′-CTCTTGAGAATGTAGGGCCTTCTG-3 ′ (reverso). Todos os primers foram projetados usando o software Primer Express (Applied Biosystems) e sintetizados pela ACGT. Os dados foram representados como Ct valores, definidos como o ciclo limite de PCR no qual o produto amplificado foi detectado pela primeira vez e analisado usando o pacote de software ABI Prism 7000 SDS (Applied Biosystems). O número de cópias do gene NT amplificado padronizado para γ-actina usando o δ-Ct (ABI Prism 7700 Users Bulletin). As diferenças finais na expressão foram relativas ao tratamento correspondente ou tratamento com veículo.

Características morfológicas e de crescimento dos dois modelos de células que expressam NT N-36/1 e N-39. UMA, Micrografias de contraste de fase dos neurônios N-36/1 e N-39 de camundongos imortalizados. UMA, B, D, E, As células foram cultivadas por 1 d após 30 passagens em placas de cultura de tecido de plástico em DMEM com FBS a 10%. C, F, As células foram cultivadas por 3 dias em DMEM com FBS a 10%. Barra de escala, 50 μm. B, Curvas de crescimento celular de neurônios N-36/1 e N-39. As células foram semeadas em placas de 24 poços a uma densidade de 5 × 10 4 células / poço em 1 ml de DMEM com FBS a 10%. O meio era trocado a cada 2 d. Após fixação à placa (4 h), as células foram contadas pelo ensaio MTT como controle. Nos pontos de tempo indicados, o número de células viáveis ​​foi avaliado pelo ensaio MTT e expresso como uma porcentagem em relação ao valor de controle. Os dados são expressos como média ± SEM (n = 3).

Plasmídeos e transfecções transitórias. O plasmídeo do gene flanqueador de NT 5 ′ de camundongo de comprimento total foi gerado por PCR usando os seguintes iniciadores no DNA genômico de camundongo: sense (-1523) 5′-CAGGCTTGCCAGTCAACCATC-3 ′, antisense (+173) 5′-AGACTCCAGGAGCTGAAAGCC-3 ′. O produto de PCR foi clonado diretamente no vetor de clonagem pDrive (Qiagen, Valencia, CA). As construções de deleção foram preparadas por digestão com HindIII, que corta no nucleotídeo +173 dentro da região 5 'não traduzida e BglII (-597), KpnI (-246), ou NheI (+55) do plasmídeo NT -1523 de comprimento total, seguido por ligação ao vetor sem promotor, pGL2-enh (Promega, Madison, WI) com a enzima apropriada. As construções de deleção adicionais foram geradas usando PCR e o plasmídeo -1523 NT como molde. Os primers usados ​​para gerar os fragmentos foram os seguintes: NTPm-487 (direto), 5′-ACG ACGCGT TTTGAGACAACGAAGC-3 ′ (MluO site I está sublinhado) NTPm-409 (para a frente), 5′-ACG ACGCGT GATTTCTCCCTAGAAC-3 ′ (MluI site está sublinhado) e NTPm-HindIII (reverso), 5′-CGAG AAGCTT GTCGACGAATT-3 ′ (Hino local dIII está sublinhado). Todos os fragmentos de PCR foram subclonados no pGL2-enh usando o MluEu para Hinsites dIII. Todas as sequências de plasmídeo foram confirmadas por sequenciação (ACGT). Os seis construtos de expressão de pGL2-enh-luciferase feitos foram os seguintes: -1521NT-LUC (abrangendo -1521 a +173) -590NT-LUC (abrangendo -590 a +173) -459NT-LUC (abrangendo -459 a +173) -381NT-LUC (abrangendo -381 a +173) -250NT-LUC (abrangendo -250 a +173) e + 55NT-LUC (abrangendo +55 a +173, onde +1 é o local previsto de iniciação da transcrição).

As transfecções foram realizadas usando o método do precipitado de fosfato de cálcio, conforme descrito anteriormente (Mellon et al., 1981). As células foram incubadas por 14-16 h com DNA, seguido por três lavagens com PBS. Após uma incubação de 2 horas, as células foram tratadas com ou sem 100 nm de leptina e incubadas por mais 48 horas antes da colheita. As concentrações de proteína foram determinadas usando o kit Pierce BCA Protein Assay Reagent (Pierce, Rockford, IL). Os ensaios de luciferase foram realizados conforme descrito anteriormente (Belsham et al., 1998). As transfecções negativas dominantes foram realizadas usando LipofectAMINE2000 (Invitrogen) de acordo com as instruções do fabricante. As células foram incubadas por 24 h com 2,5 μg de pEF-BOS (controle interno), pWT-STAT3 (tipo selvagem de STAT3) ou pDN-STAT3 (tipo dominante negativo de STAT3 gentilmente fornecido por Hiroshi Higuchi, Universidade de Osaka, Osaka , Japão) (Minami et al., 1996 Muraoka et al., 2003). O meio foi então substituído por DMEM sem soro com BSA a 1% por 2 h, após o que as células foram tratadas com ou sem leptina 10-11 m e incubadas por 4 h antes do isolamento de RNA. LipofectAMINE2000 foi usado neste caso porque as células não tolerariam condições sem soro após exposição a fosfato de cálcio. A eficiência de transfecção foi suficiente usando qualquer um dos métodos, embora LipofectAMINE2000 tenha resultado em níveis mais altos atingindo ∼40-50%.

Ensaio de imunoprecipitação da cromatina. Os ensaios ChIP foram realizados usando a metodologia descrita anteriormente (Barre et al., 2003, 2005). As células foram reticuladas com formaldeído a 1% por 10 min em temperatura ambiente e depois lavadas com PBS gelado. O sedimento celular foi ressuspenso em tampão de lise celular [5 m m PIPES (KOH), pH 8,0, 85 m m KCl, 0,5% NP-40] contendo inibidores de protease e incubado por 10 min em gelo. Os núcleos foram lisados ​​no tampão de lise nuclear (50 m m Tris, pH 8,1, 10 m m EDTA, 1% SDS) contendo inibidores de protease e sonicados três vezes durante 20 s cada em gelo. Os sobrenadantes foram então recuperados por centrifugação a 20.000 rpm por 10 min a 4 ° C, diluídos cinco vezes em tampão de diluição (0,01% SDS, 1,1% Triton X-100, 1,2 mm EDTA, 16,7 mm Tris, pH 8,1, 167 mm NaCl) mais inibidores de protease. A amostra foi pré-limpa com 80 μl de uma pasta de agarose de DNA / proteína G de espermatozóide de salmão a 50% (Upstate Biotechnology, Lake Placid, NY) por 30 min a 4 C. Dez por cento do lisado foi usado como o controle de entrada (50- diluição de vezes). O resto do sobrenadante foi incubado com 2 μl de anticorpo anti-STAT3 (Santa Cruz Biotechnology) a 4 ° C durante a noite e, em seguida, 60 μl de uma pasta de agarose de DNA / proteína G de espermatozóide de salmão 50% foi adicionado por 1 h em 4 ° C. Os imunoprecipitados foram lavados sequencialmente por 5 min cada em tampão de lavagem com baixo teor de sal (0,1% SDS, 1% Triton X-100, 2 mm EDTA, 20 mm Tris, pH 8,1, 150 mm NaCl), tampão de lavagem com alto teor de sal (0,1% SDS , 1% Triton X-100, 2 mm EDTA, 20 mm Tris, pH 8,1, 500 mm NaCl) e tampão de lavagem LiCl (0,25 M LiCl, 1% NP-40, 1% desoxicolato, 1 mm EDTA, 10 mm Tris , pH 8,0). Os precipitados de grânulos foram então lavados duas vezes com tampão TE e eluídos duas vezes com tampão de eluição (1% SDS, 0,1 m NaHCO3) Os eluatos foram combinados e incubados a 65 ° C durante 5 h para reverter a reticulação de formaldeído. O DNA foi precipitado e dissolvido em água e tratado com proteinase K a 45 ° C por 2 h. O DNA foi purificado usando colunas Qia-quick spin (Qiagen) e eluído em 50 μl de água. Para PCR, 2 μl de DNA foram amplificados por 35 ciclos. Os seguintes primers foram usados: ACGACGCGTGATTTCTCCCTAGAAC (sentido), GAGAGGTACTTCTGGTACCTTTTTCC (antisense) de -385 a -234 pb do promotor NT / N de camundongo (região de ligação STAT3).

Análise estatística. Os dados foram analisados ​​usando ANOVA unilateral por GraphPad Prism (GraphPad Software, San Diego, CA), e a significância estatística foi determinada usando testes de comparação múltipla de Tukey ou Student's t teste com p & lt 0,05.


Resultados

A administração ICV de 0,3 ou 1,0 µg de TG aumentou significativamente a ingestão de alimentos de 2 e 24 horas em comparação com controles injetados com veículo (Figura 1a, b) A administração de TG (0,3 e 1 µg) também aumentou o ganho de peso corporal 24 horas após a injeção (Figura 1c) A administração ICV de TG aumentou significativamente a expressão hipotalâmica dos marcadores de estresse ER, como fosfo-IRE1 (ref. (21)) e CHOP ((23)) (Figura 1d).

A administração central de indutor de estresse de retículo endoplasmático (ER) aumenta a ingestão de alimentos, o peso corporal e a expressão do marcador de estresse de ER hipotalâmico. (a – c) Efeitos da administração intracerebroventricular (ICV) de tapsigargina (TG, 0,1−1 µg) na ingestão de alimentos e peso corporal durante o período de 24 horas após a injeção (n = 6−7 por grupo). Os dados são as médias ± s.e.m. *P & lt 0,05 vs. controles injetados com veículo, †P & lt 0,05 vs. grupo injetado com TG (0,1 µg). (d) Efeitos da administração ICV de TG (5 µg) na expressão hipotalâmica de fosfo-IRE1 e CHOP em camundongos C57BL / 6J alimentados com dieta normal (n = 5 por grupo). Western blots representativos e intensidades de banda médias de marcadores de estresse ER, que foi normalizado por β-actina. *P & lt 0,05 vs. grupo injetado com veículo (1% dimetilsulfóxido). CHOP, proteína de homologia C / EBP IRE1, quinase-1 requerendo inositol.

Em seguida, determinamos se o estresse do ER hipotalâmico causa resistência à leptina central. Consistente com o relatório anterior ((24)), a administração ICV de leptina diminuiu significativamente a ingestão de alimentos e o ganho de peso corporal por 24 horas após a injeção (Figura 2a – c) No entanto, os efeitos da leptina na ingestão de alimentos e no peso corporal foram significativamente inibidos pela administração anterior de TG (0,3 e 1 µg) (Figura 2a – c) A administração ICV de TG pode induzir estresse no RE não apenas no hipotálamo, mas também em regiões remotas do cérebro. Para provocar estresse ER confinado ao hipotálamo mediobasal, TG (0,1 µg) foi administrado por meio de cânulas iMBH. Da mesma forma que a injeção ICV, a administração iMBH de TG bloqueou completamente os efeitos da leptina na ingestão de alimentos e no peso corporal (Figura 2d, e) Em seguida, investigamos se uma administração anterior de TG afeta as vias de sinalização da leptina. A administração ICV de leptina aumentou significativamente a fosforilação de STAT3 no hipotálamo (Figura 2f) Inesperadamente, a administração de TG por si só aumentou a fosforilação de STAT3 hipotalâmica e bloqueou uma ativação adicional de STAT3 pela leptina (Figura 2f).

A administração central de indutor de estresse do retículo endoplasmático inibe os efeitos da leptina na ingestão de alimentos, peso corporal e ativação de Stat3. (a – c) A administração intracerebroventricular (ICV) prévia de TG inibe a redução na ingestão de alimentos e peso corporal induzida pela injeção de leptina (n = 6−7 por grupo). *P & lt 0,05 vs. controles injetados com veículo, †P & lt 0,05 vs. grupo injetado com leptina (3 µg) e TG (0,3 µg), ‡P & lt 0,05 vs. grupo injetado com leptina (3 µg) e TG (1 µg). (d, e) A administração intra-hipotalâmica de TG (0,1 µg) bloqueia a diminuição da ingestão de alimentos e do peso corporal induzida pela injeção de 0,3 µg de leptina (n = 5−6 por grupo). Os dados são as médias ± s.e.m. *P & lt 0,05 vs. controles injetados com veículo, †P & lt 0,05 vs. grupo injetado com TG, ‡P & lt 0,05 vs. grupo injetado com leptina e TG. (f) Efeito de ICV TG (5 µg) na fosforilação de STAT3 induzida por leptina (3 µg) (n = 6 por grupo). *P & lt 0,01, †P & lt 0,05 vs. controles injetados com veículo, ‡P & lt 0,05 vs. grupo injetado com TG, §P & lt 0,05 vs. grupo injetado com leptina e TG. iMBH, hipotálamo mediobasal bilateral Lep, leptina STAT3, TG transcrito-3 ativado por transdução de sinal, tapsigargina.

Também examinamos se o estresse do ER hipotalâmico inibe o efeito de alimentação e a via de sinalização da insulina. A administração anterior de iMBH de TG bloqueou a redução induzida por insulina na ingestão de alimentos e peso corporal (Figura 3a – c) Da mesma forma, a administração de TG aumentou significativamente a fosforilação de Akt hipotalâmica em comparação com a administração de veículo. Além disso, a fosforilação de Akt induzida por insulina foi abolida por uma administração anterior de TG (Figura 3d).

A administração central de indutor de estresse do retículo endoplasmático inibe os efeitos da insulina na ingestão de alimentos, peso corporal e ativação de Akt. (a – c) Efeito inibidor da administração intra-hipotalâmica de TG (0,1 µg) na supressão induzida por insulina (Ins, 0,01 µg) da ingestão de alimentos e peso corporal (n = 6−7 por grupo). Os dados são as médias ± s.e.m. *P & lt 0,05 vs. controles injetados com veículo, †P & lt 0,05 vs. grupo injetado com TG, ‡P & lt 0,05 vs. grupo injetado com insulina e TG. (d) A administração intracerebroventricular anterior de TG (5 µg) bloqueia a fosforilação de Akt induzida por insulina (0,2 µg) no hipotálamo (n = 6 por grupo). Western blots representativos e intensidades de banda médias normalizadas para o conteúdo de β-actina são apresentados. *P & lt 0,01, †P & lt 0,05 vs. controles com injeção de veículo, ‡P & lt 0,05 vs. grupo injetado com TG, §P & lt 0,05 vs. grupo injetado com insulina e TG. Ctl, controle Ins, insulina TG, tapsigargina.

Determinamos a expressão de marcadores de estresse ER no hipotálamo de camundongos DIO e comparamos com aqueles em controles magros alimentados com LFD. O peso corporal médio de camundongos DIO alimentados com HFD foi significativamente maior do que o dos controles magros alimentados com LFD antes de matar (LFD 30,7 ± 0,43 g vs. HFD 43,8 ± 0,79 g, P & lt 0,005). Os níveis de expressão do hipotálamo dos marcadores de estresse ER fosfo-IRE1, CHOP, proteína-78 de imunoglobulina de ligação regulada por glicose (ref. (25)) e XBP-1s foram significativamente maiores em camundongos alimentados com HFD do que em camundongos alimentados com LFD (Figura 4a, b) A expressão de c-Jun fosforilado, um marcador da ativação da quinase N-terminal de c-Jun, também aumentou significativamente no hipotálamo de camundongos DIO (Figura 4a) Finalmente investigamos se o tratamento de PBA da chaperona química em camundongos DIO pode melhorar a resistência à leptina central. Em camundongos DIO, a administração ICV de leptina (3 µg) não reduziu significativamente a ingestão de alimentos e o peso corporal, indicando que esses animais têm resistência central à leptina (Figura 4c, d) No entanto, os efeitos da leptina na ingestão de alimentos e no peso corporal foram significativamente melhorados pelo tratamento com PBA (Figura 4c, d) Esses dados sugerem que uma redução no estresse ER pode ajudar a melhorar a resistência à leptina central em camundongos DIO.

Aumento do estresse ER hipotalâmico em camundongos obesos. (uma) Expressão de marcadores de estresse ER (fosfo-IRE1, GRP78 e CHOP) e um marcador de ativação da quinase N-terminal c-Jun (fosfo-c-Jun) no hipotálamo de camundongos alimentados com dieta baixa em gordura (LFD) ou uma dieta rica em gordura (HFD) por 8 semanas (n = 6 por grupo). Western blots representativos e intensidades de banda médias normalizadas para o conteúdo de β-actina são apresentados. *P & lt 0,05 vs. LFD. (b) Aumento da expressão hipotalâmica de XBP-1s em camundongos alimentados com HFD em comparação com camundongos alimentados com LFD (n = 6 por grupo). *P & lt 0,05 vs. LFD. (CD) Efeitos da administração ICV de leptina na ingestão de alimentos e peso corporal em camundongos DIO alimentados com HFD com ou sem tratamento com PBA (n = 5−6 por grupo). *P & lt 0,05 vs. controles injetados com veículo e solução salina, †P & lt 0,05 vs. grupo injetado com veículo e leptina, ‡P & lt 0,05 vs. grupo injetado com PBA e solução salina. CHOP, proteína de homologia C / EBP DIO, ER obeso induzido por dieta, retículo endoplasmático GRP78, proteína imunoglobulina de ligação / regulada por glicose-78 IRE1, quinase-1 requerendo inositol Lep, leptina PBA, ácido 4-fenil butírico Sal, Soro fisiológico.


Anormalidades celulares e subcelulares neuronais hipotalâmicas na obesidade experimental

A caracterização da rede neuronal hipotalâmica, que controla a ingestão alimentar e o gasto energético, proporcionou grandes avanços no entendimento da fisiopatologia da obesidade. A maior parte dos avanços nesse campo foram obtidos graças ao desenvolvimento de uma série de modelos animais genéticos e não genéticos que, pelo menos em parte, superaram as restrições anatômicas que dificultam o estudo do hipotálamo humano. Apesar das diferenças indiscutíveis entre a fisiologia humana e de roedores, a maioria dos estudos seminais realizados em roedores que revelaram detalhes da regulação neural da homeostase energética foram eventualmente confirmados em humanos, colocando os estudos experimentais na vanguarda da pesquisa sobre obesidade. Durante os últimos 15 anos, os pesquisadores forneceram extensas provas experimentais que sustentam a existência de disfunção hipotalâmica, que leva a um balanço energético positivo progressivo de todo o corpo e, portanto, à obesidade. Aqui, revisamos o trabalho experimental que desvendou os mecanismos por trás da disfunção hipotalâmica na obesidade.


Eun Roh e Do Kyeong Song: Esses autores contribuíram igualmente para este trabalho.

Afiliações

Laboratório de Regulação de Appeptite, Instituto Asan de Ciências da Vida, University of Ulsan College of Medicine, Seul, Coreia

Eun Roh, Do Kyeong Song e Min-Seon Kim

Departamento de Medicina, University of Ulsan College of Medicine, Seul, Coreia

Divisão de Endocrinologia e Metabolismo, Asan Medical Center, Seul, Coréia