Em formação

O códon de início é considerado parte da UTR (região não traduzida)?


A entrada da Wikipedia para Gene contém a declaração:

O pré-mRNA transcrito contém regiões não traduzidas em ambas as extremidades que contêm um local de ligação ao ribossomo, terminador e códons de início e parada.

Mas a página no códon de início diz:

O códon de início é frequentemente precedido por uma região 5 'não traduzida (5' UTR)

Então, o códon de início faz parte do UTR?


Porque o códon de início é traduzido em metionina, pode claramente não faça parte da região 5'-não traduzida, como @Johnny escreve em sua resposta.

A questão mais contenciosa seria para o parar códons e a Região 3 'não traduzida. Então é realmente uma questão de semântica. Pode-se argumentar que, como nenhum aminoácido é inserido em resposta a esses códons, eles não são traduzidos. No entanto, se considerarmos o significado da palavra 'traduzir' e sua aplicação ao código genético, um códon de parada é claramente traduzido - é lido e traduzido em informações que iniciam a liberação do peptídeo nascente do ribossomo.

E assim, na entrada da Wikipedia sobre Regiões não traduzidas, ele (junto com o códon inicial) é mostrado na sequência de codificação, e não na região não traduzida. As anotações usadas pelo GenBank também incluem códons de início e parada na sequência de codificação (CDS em suas anotações) - consulte, por exemplo, a anotação para esta sequência precursora de insulina.


O códon de início tanto em procariotos quanto em eucariotos não faz parte dos 5'UTRs, ele está presente a jusante dos UTRs.

Em procariotos, o Ribossomo liga-se à sequência Shine-Dalgarno (AGGAGGU) de 5'UTR. Esta sequência é encontrada 3-10 pares de bases a montante do códon de iniciação.

Em eucariotos, o códon iniciador é geralmente o primeiro 5'AUG3 'presente na sequência de consenso kozak (GCCGCCRCCAGOG, onde R é adenina ou guanina). O ribossomo não se liga a essa sequência diretamente, mas navegando por ela a partir da extremidade 5 ', ele começa a síntese assim que atinge a sequência de consenso. Esta sequência kozak varia da porção terminal de 5'UTR até os primeiros (na verdade, quatro) nucleotídeos da região de tradução.

Fontes:

  • Princípios da genética por Snustard e Simmons

  • Bioquímica de Berg


Esta afirmação é incorreta.

O pré-mRNA transcrito contém regiões não traduzidas em ambas as extremidades que contêm um local de ligação ao ribossomo, terminador e códons de início e parada.

O códon de início sempre codifica para metionina (eucariotos) ou N-Formilmetionina (procariotos), portanto, visto que o códon de início codifica para um aminoácido, seria considerado parte do traduzindo região.


Três regiões principais não traduzidas

Em genética molecular, o três regiões principais não traduzidas (3′-UTR) é a seção do RNA mensageiro (mRNA) que segue imediatamente o códon de terminação da tradução. A 3′-UTR freqüentemente contém regiões regulatórias que influenciam pós-transcricionalmente a expressão gênica.

Durante a expressão do gene, uma molécula de mRNA é transcrita a partir da sequência de DNA e posteriormente traduzida em uma proteína. Várias regiões da molécula de mRNA não são traduzidas em uma proteína, incluindo o cap 5 ', a região 5' não traduzida, a região 3 'não traduzida e a cauda poli (A). As regiões regulatórias dentro da região 3 'não traduzida podem influenciar a poliadenilação, a eficiência da tradução, a localização e a estabilidade do mRNA. [1] [2] O 3′-UTR contém locais de ligação para proteínas regulatórias e também microRNAs (miRNAs). Ao se ligar a locais específicos dentro da 3'-UTR, os miRNAs podem diminuir a expressão gênica de vários mRNAs, tanto inibindo a tradução quanto causando diretamente a degradação do transcrito. A 3'-UTR também possui regiões silenciadoras que se ligam a proteínas repressoras e inibem a expressão do mRNA.

Muitos 3′-UTRs também contêm elementos ricos em AU (AREs). As proteínas ligam-se a AREs para afetar a estabilidade ou taxa de decaimento dos transcritos de maneira localizada ou afetar o início da tradução. Além disso, o 3'-UTR contém a sequência AAUAAA que direciona a adição de várias centenas de resíduos de adenina chamados de cauda poli (A) ao final do transcrito do mRNA. A proteína de ligação poli (A) (PABP) se liga a essa cauda, ​​contribuindo para a regulação da tradução, estabilidade e exportação do mRNA. Por exemplo, o PABP ligado à cauda poli (A) interage com proteínas associadas à extremidade 5 'do transcrito, causando uma circularização do mRNA que promove a tradução.

A 3'-UTR também pode conter sequências que atraem proteínas para associar o mRNA ao citoesqueleto, transportá-lo de ou para o núcleo da célula ou realizar outros tipos de localização. Além das sequências dentro da 3′-UTR, as características físicas da região, incluindo seu comprimento e estrutura secundária, contribuem para a regulação da tradução. Esses diversos mecanismos de regulação gênica garantem que os genes corretos sejam expressos nas células corretas nos momentos apropriados.


Controle da eficiência da tradução

A tradução de mRNAs pode variar em eficiência, de modo que a quantidade de proteína produzida é modulada. Este é um nível importante de regulação gênica, de fato, uma correlação entre mRNA e abundância de proteína é vista apenas para proteínas secretadas, enquanto para proteínas intracelulares as diferentes taxas de tradução de diferentes mRNAs remove essa correlação [18]. Recursos ao longo de todo o mRNA podem afetar a eficiência da tradução.

As características estruturais da 5 'UTR têm um papel importante no controle da tradução do mRNA. RNAs mensageiros que codificam proteínas envolvidas em processos de desenvolvimento, como fatores de crescimento, fatores de transcrição ou proto-oncogenes, todos os quais precisam ser forte e finamente regulados, muitas vezes têm 5 'UTRs que são mais longos do que a média [19], com códons de iniciação a montante ou quadros de leitura aberta (ORFs) e estruturas secundárias estáveis ​​que dificultam a eficiência da tradução (Tabela 2). Outros motivos específicos e estruturas secundárias na 5 'UTR também podem modular a eficiência da tradução.

Em condições normais, após o transporte de um mRNA do núcleo para o citoplasma, o complexo de proteína eIF4F se reúne na tampa. Este complexo consiste em três subunidades: eIF4E, a proteína de ligação a cap eIF4A, que tem atividade de RNA helicase e eIF4G, que interage com várias outras proteínas, incluindo a proteína de ligação de poliadenilato. A atividade helicase dependente de ATP de eIF4A, estimulada pela proteína de ligação a RNA eIF4B, desenrola qualquer estrutura secundária no mRNA, criando assim uma 'plataforma de aterrissagem' para a pequena subunidade ribossômica (40S) [20]. Quando a concentração de ribossomos ou fator de tradução são limitantes, a cauda poli (A) pode cooperar com o tampão 5 'para aumentar o início da tradução por meio da intervenção de uma proteína de ligação de poliadenilato que pode interagir fisicamente com o complexo eIF4F [21].

Na maioria dos mRNAs eucarióticos, pensa-se que a tradução inicia no primeiro códon AUG encontrado pela subunidade ribossômica 40S conforme ela se move, ou varre, 3 'ao longo do mRNA do cap 5' m7G. As sequências que flanqueiam o códon de iniciação de AUG não são aleatórias, mas se encaixam em uma sequência de consenso em mamíferos, esta sequência é GCCRCCaugG, e os nucleotídeos mais conservados são a purina (R), geralmente A, na posição -3 em relação ao códon de início de AUG e o guanina na posição +4. A forte preferência por A na posição -3 e G na posição +4 também é conservada em outros animais e em plantas e fungos. O contexto de sequência do primeiro códon AUG, em particular a parte localizada na região não traduzida, pode modular a eficiência com a qual é reconhecido como um códon de iniciação da tradução.

É digno de nota que uma grande fração de 5 'UTRs contém AUGs a montante, de 15% a quase 50% dependendo do organismo (Figura 2b), sugerindo que a' primeira regra AUG 'prevista pelo modelo de varredura de seleção do local de início do ribossomo é desobedecido em um grande número de casos. Isso implica que a subunidade ribossômica 40S pode às vezes contornar o códon AUG mais a montante, possivelmente porque seu contexto de sequência o torna um códon de iniciação fraco, para iniciar a tradução em um AUG mais distal. Com esse mecanismo, chamado de 'varredura com vazamento', várias proteínas diferentes podem ser obtidas a partir do mesmo mRNA [22]. Além disso, foi calculado que a presença de um AUG a montante se correlaciona com um UTR 5 'longo e com um contexto de códon de início "fraco" do AUG que é normalmente usado, enquanto os transcritos com um contexto de códon de início ideal têm 5' curto UTRs sem AUGs upstream [23], sugerindo que AUGs upstream podem ter um papel em manter baixo o nível de tradução basal de um gene.

Se um códon de parada no quadro for encontrado após o AUG a montante e antes do códon de início principal, ele cria um ORF a montante. Após a tradução da ORF a montante e o descolamento da subunidade ribossômica grande (60S), a subunidade ribossômica pequena tem vários destinos alternativos, que afetam a eficiência da tradução e a estabilidade do mRNA. A subunidade 40S pode reter o mRNA, retomar a varredura e reiniciar a tradução em um códon AUG a jusante, ou pode deixar o mRNA, prejudicando assim a tradução da ORF principal. A capacidade de um ribossomo de reiniciar é limitada em eucariotos pelo contexto do códon de parada [24] e pelo comprimento da ORF a montante. Se a ORF a montante for maior do que cerca de 30 códons [25], o ribossomo não pode reiniciar. Este processo é conhecido por regular negativamente a tradução dos mRNAs para os fatores de transcrição de levedura GCN4 e YAP1, que contêm ORFs a montante [26].

Estruturas secundárias em 5 'UTRs também são importantes na regulação da tradução. Dados experimentais sugerem que estruturas secundárias moderadamente estáveis ​​(uma mudança na energia livre (ΔG) acima de -30 kcal / mol) envolvendo diretamente o códon de início AUG não paralisam a migração da subunidade ribossômica 40S, uma diminuição significativa na eficiência da tradução é observada apenas quando estruturas muito estáveis ​​(ΔG abaixo de -50 kcal / mol) são formadas. As sequências UTR com tais estruturas secundárias muito estáveis ​​são relatadas na Tabela 3. Os efeitos inibitórios dessas estruturas podem ser superados por um aumento no nível de eIF4A, a subunidade do complexo eIF4F que promove o desenrolamento de estruturas secundárias de RNA em cooperação com eIF4B e eIF4H [27].

Um mecanismo alternativo para o início da tradução, que ocorre independentemente do cap 5 ', foi descoberto pela primeira vez em picornavírus [28]: um elemento de sequência no 5' UTR atua como um local de entrada de ribossomo interno (IRES). Elementos IRES foram encontrados em muitos mRNAs celulares que codificam proteínas regulatórias, como produtos de proto-oncogene como c-Myc, proteínas do homeodomínio, fatores de crescimento (como o fator de crescimento de fibroblastos FGF-2) e seus receptores. O conceito de IRESs foi revisado de forma muito crítica por Kozak [29], que originalmente definiu a importância do contexto do códon de iniciação. A análise comparativa de IRESs celulares conhecidos leva à identificação de um motivo estrutural comum compartilhado por muitos mRNAs, incluindo aqueles que codificam a proteína de ligação da cadeia pesada de imunoglobulina BiP e FGF2: uma haste em forma de Y logo a montante do códon de iniciação AUG [30] (consulte a Tabela 4 e a Figura 2b). Foi descoberto recentemente que motivos de sequência curta complementares ao pequeno RNA ribossômico também podem atuar como IRESs [31].

Elementos de sequência que são o alvo de transAs proteínas de ligação ao RNA também podem regular a tradução. Por exemplo, o elemento responsivo ao ferro (IRE) localizado na 5 'UTR de mRNAs que codificam proteínas envolvidas no metabolismo do ferro (ferritina, 5-aminolevulinato sintase e aconitase) pode inibir a tradução através da ligação dependente de ferro de proteínas reguladoras de ferro, que impedir o processo normal de digitalização da pequena subunidade ribossômica no início da tradução. Além disso, a maioria dos mRNAs de vertebrados que codificam proteínas ribossômicas e fatores de alongamento de tradução analisados ​​até o momento contêm um trato de oligopirimidina terminal 5 '(TOP) que consiste em 5-15 pirimidinas imediatamente adjacentes ao cap m7G. Este trato é necessário para a repressão translacional coordenada durante a parada do crescimento, diferenciação, desenvolvimento e certos tratamentos com drogas [32].


Mastering Biology Chp. 14 HW

Use a tabela para classificar os dez códons a seguir em uma das três caixas, de acordo com se eles codificam para um códon de início, um aminoácido em sequência ou um códon de parada.

Durante a tradução, tripletos de bases de nucleotídeos (códons) no mRNA são lidos em sequência na direção 5 '→ 3' ao longo do mRNA. Os aminoácidos são especificados pela cadeia de códons. Que sequência de aminoácidos a seguinte sequência de nucleotídeos de mRNA especifica?
5′ − AUGGCAAGAAAA − 3 ′

[Antes que uma molécula de mRNA possa ser traduzida em uma proteína no ribossomo, o mRNA deve primeiro ser transcrito de uma sequência de DNA.
O diagrama mostra um esquema de tradução do DNA em uma proteína no ribossomo. Há um fragmento de DNA com duas fitas (a fita de 3 a 5 linhas é uma fita modelo). A fita modelo é transcrita em mRNA (bases nitrogenadas complementares são selecionadas - U para A, A para T, C para G e G para C). Em seguida, o mRNA é traduzido na proteína do ribossomo e cada códon é traduzido em um determinado aminoácido (por exemplo, UGG é traduzido em Trp). A sequência de aminoácidos forma a proteína.]

Que sequência de aminoácidos a seguinte sequência de nucleotídeos de DNA especifica?
3′ − TACAGAACGGTA − 5 ′

Suponha que uma porção de DNA de fita dupla no meio de um grande gene esteja sendo transcrita por uma RNA polimerase. Conforme a polimerase se move através da sequência de seis bases mostrada no diagrama abaixo, qual é a sequência de bases correspondente no RNA que é produzido?

[Diagrama de DNA mostrando uma fita codificadora e uma fita modelo. A cadeia de codificação da extremidade 3 primos para a extremidade 5 primos lê C C G A G T. A cadeia do modelo da extremidade 5 primos para a extremidade 3 primos lê G G C T C A.]

Durante a transcrição em eucariotos, um tipo de RNA polimerase chamada RNA polimerase II se move ao longo da fita molde do DNA na direção 3 '→ 5'. No entanto, para qualquer gene dado, qualquer fita do DNA de fita dupla pode funcionar como a fita molde.

Após o início da transcrição, várias etapas devem ser concluídas antes que o mRNA totalmente processado esteja pronto para ser usado como um modelo para a síntese de proteínas nos ribossomos.

[Uma vez que a RNA polimerase II é ligada à região promotora de um gene, a transcrição da fita molde começa. Conforme a transcrição prossegue, três etapas principais ocorrem na transcrição do RNA:
- No início da transcrição, quando o transcrito em crescimento tem cerca de 20 a 40 nucleotídeos de comprimento, um nucleotídeo de guanina modificado é adicionado à extremidade 5 'do transcrito, criando um cap 5'.
-Introns são separados do transcrito de RNA por spliceossomos, e os exons são unidos, produzindo uma região de codificação contínua.
- Uma cauda poli-A (entre 50 e 250 nucleotídeos de adenina) é adicionada à extremidade 3 'do transcrito de RNA.

Combine as palavras da coluna da esquerda com o espaço em branco apropriado nas frases da coluna da direita.

Em células eucarióticas, os processos de síntese de proteínas ocorrem em diferentes localizações celulares.

O RNA desempenha papéis importantes em muitos processos celulares, particularmente aqueles associados à síntese de proteínas: transcrição, processamento de RNA e tradução.

[Em eucariotos, o pré-mRNA é produzido pela transcrição direta da sequência de DNA de um gene em uma sequência de nucleotídeos de RNA. Antes que este transcrito de RNA possa ser usado como um modelo para a síntese de proteínas, ele é processado por modificação de ambas as extremidades 5 'e 3'. Além disso, os íntrons são removidos do pré-mRNA por um processo de splicing que é catalisado por snRNAs (pequenos RNAs nucleares) complexados com proteínas.
O produto do processamento de RNA, mRNA (RNA mensageiro), sai do núcleo. Fora do núcleo, o mRNA serve como um modelo para a síntese de proteínas nos ribossomos, que consistem em moléculas de rRNA catalítico (RNA ribossômico) ligadas a proteínas ribossômicas. Durante a tradução, as moléculas de tRNA (RNA de transferência) combinam uma sequência de três nucleotídeos no mRNA a um aminoácido específico, que é adicionado à cadeia polipeptídica em crescimento.

A vida como a conhecemos depende do código genético: um conjunto de códons, cada um composto de três bases em uma sequência de DNA e a sequência de mRNA correspondente, que especifica qual dos 20 aminoácidos será adicionado à proteína durante a tradução.

Imagine que um organismo semelhante ao procarioto tenha sido descoberto no gelo polar de Marte. Curiosamente, esses organismos marcianos usam o mesmo sistema de proteína DNA → RNA → da vida na Terra, exceto que
- existem apenas 2 bases (A e T) no DNA marciano, e
-Há apenas 17 aminoácidos encontrados nas proteínas marcianas.


Métodos

Cepas bacterianas e condições de crescimento

Recombinante E. coli DH5α (Laboratórios de Pesquisa Bethesda), E. coli RV308 (ATCC 31608) e P. putida KT2440 foram cultivados em caldo Lysogeny (LB) (10 g / L de triptona, 5 g / L de extrato de levedura e 5 g / L de NaCl) ou em Lysogeny Agar (LB caldo com 15 g / L de ágar) suplementado com 50 μg / mL de canamicina . Seleção de E. coli DH5α transformantes foi realizada a 37 ° C, enquanto 30 ° C foi usado para todas as experiências de crescimento. Para a indução dos sistemas promotores, as primeiras culturas durante a noite foram inoculadas em meio fresco e foram cultivadas até a fase mid-log ser atingida, e depois foram induzidas nos níveis especificados.

Manipulações de DNA

Os procedimentos padrão de DNA recombinante foram realizados conforme descrito por Sambrook e Russell 33. Fragmentos de DNA foram extraídos de géis de agarose usando o kit de extração de gel QIAquick e de líquidos usando o kit de purificação de PCR QIAquick (QIAGEN). O DNA de plasmídeo foi isolado usando o kit de purificação de DNA Wizard Plus SV Minipreps (Promega) ou o kit NucleoBond Xtra Midi (Macherey-Nagel). Os oligonucleótidos sintéticos foram encomendados à Sigma-Aldrich ou Eurofins. A clonagem de restrição foi realizada de acordo com as recomendações da New England Biolabs. As reações de PCR foram realizadas com o sistema Expand High Fidelity PCR (Roche Applied Science) ou Q5 High-Fidelity DNA Polymerase (NEB). E. coli os clones foram transformados usando um protocolo RbCl modificado (Promega) e P. putida KT2440 foi transformado usando um protocolo de eletroporação descrito por Hanahan e colegas 34. Os plasmídeos construídos foram confirmados por sequenciação realizada na Eurofins / GATC Biotech usando o iniciador 5′-AAC GGCCTGCTCCATGACAA-3 ′ para pAO-Tr-, pIB11- 18, pdualUTR- e os iniciadores 5′-CTTTCACCAGCGTTTCTGGGTCTG-3 ′ e 5′-CTTTCACCAGCGTTTCTGGGTCTGTA- 3 ′ e 5′-CTTTCACCAGCGTTTCTGGGTCTGTA-3 ′CCGCTG 3 'para construções baseadas em pAO-Tn.

Construções de plasmídeo

Todos os plasmídeos são baseados no replicon mini-RK2 de ampla gama de hospedeiros. Para a construção do plasmídeo pAO-Tr, o bla A sequência de codificação foi amplificada a partir do plasmídeo pIB11 18 com os iniciadores 5′-GCAGGCGGAATTCTA ATGAGGTCATGAACTTATGAGTATTCAACATT-3 ′ e 5′-CTAGAGGATCCCCGGGTACCTTTTCTACG G-3 ′, introduzindo os locais de restrição EcoRI e BamHI como o pbamHI 22 fragmento a jusante do celB gene. Esta construção resultou no plasmídeo pAO-Tr (SOM pAO-Tr.gb).

Para a construção do pAO-Tn, o celB A sequência de codificação e a sequência de DNA correspondente ao seu 5′UTR foram amplificadas por PCR a partir do plasmídeo pAO-Tr usando o par de iniciadores 5′-ACCCCTTAGGCTTTATGCAACAgaaACAATAATAATGGAGTCATGAACtTATG-3 ′ e 5′-CTTTCACCAGCGTTTCTGGGTG-3. O produto de PCR resultante foi digerido com Bsu36I e EcoRI e reintroduzido em pAO-Tr usando os mesmos locais de restrição que levam a pAO-Tn (-1). Por esta clonagem, os locais de restrição Ndel e PciI adicionais foram removidos (indicados por letras minúsculas). o bla a sequência de codificação foi amplificada por PCR de pIB11 usando o par de iniciadores 5′-cggaattCAACATGTA CAATAATaatg-3 ′ e 5′-AGCTAGAGGATCCCCGGGTA-3 ′ e o produto de PCR resultante foi clonado como um fragmento EcoRI-BamHI no plasmídeo pAO-Tn (-1) resultando em pAO-Tn (SOM pAO-Tn.gb).

Para a caracterização individual do fenótipo de Tr- e Tn-UTR, as sequências de DNA de 5 ′ UTR foram integradas entre os locais PciI e NdeI únicos no plasmídeo pIB11 como pares emparelhados de oligonucleotídeos sintéticos diretos e reversos.

Para a construção de plasmídeos carregando os UTRs duplos, pdualUTR (SOM pdualUTR.gb), a sequência de DNA 5 'UTR nativa a montante do bla sequência de codificação em pIB11 foi substituído com os oligonucleótidos emparelhados 5'-CATGTACAATAATAATGGAGTCATGAACATATCTTCATGAGCTCCATTATTATTGTATATGTACAATAATAATGGAGTCATGAACA-3 'e 5'-TATGTTCATGACTCCATTATTATTGTACATATACAATAATAATGGAGCTCATGAAGATATGTTCATGACTCCATTATTATTGTA-3’ .

Para a construção de pdualUTR com o mCherry gene repórter e E. coli variante otimizada por códon do mCherry A sequência de codificação (um presente de Yanina R. Sevastsyanovich, University of Birmingham) foi amplificada por PCR usando o par de iniciadores 5′-GCTGCATATGGTTTCTAAAGGTGAAGAAG-3 ′ e 5′-GCTCGGATCCTTATCATTTATACAGTTCGTCCATAC-3 ′ e digerido com NamHIdeI. O fragmento digerido foi então usado para substituir o bla sequência de codificação em pdualUTR resultando em pdualUTR-mCherry (SOM pdualUTR-mCherry.gb).

Para a construção de todas as combinações de dualUTR, oligonucleotídeos sintéticos recozidos flanqueados por PciI e SacI (Tr-dual UTR) e SacI e NdeI (Tn-dual UTR) extremidades coesivas foram inseridas em pdualUTR ou pdualUTR-mCherry usando os respectivos locais de reconhecimento de enzima de restrição.

Para a construção do PMAU sistema, o PMAU A cassete de expressão foi amplificada por PCR a partir de pSB-B1b 36 usando pares de iniciadores 5′-ATGGAGAAACAGTAGAGAGTTG-3’e 5′-TACATGGCTCTGCTGTAG-3 ’. Cada um dos cinco vectores pdualUTR-mCherry foram amplificadas por PCR utilizando o iniciador inverso 5'-CTCCCGTATCGTAGTT ATC-3 'em combinação com um dos iniciadores directo 5'-CAACTCTCTACTGTTTCTCCATAACATGTTA CCATGATAATGGAG-3', 5'-CAACTCTCTACTGTTTCTCCATAACATGTTACAATAATAACGGAGTCA TG-3 ', 5 ′ -CAACTCTCTACTGTTTCTCCATAACATGTAATAAACTAAAGGAGTTATG-3 ′ 5′-CAACTCTCTACTGTTTCTCCATAACATGTACAATAATAATGGAGTCATGAACATATC-3 ′ cada um tendo como alvo a região UTR dual em r31n47, nr50 e nt47, r31n47, r50 e r31n47, r50, respectivamente 47, nt47 e r50 47, nt47 e r50, respectivamente. Os produtos de PCR tratados com DpnI e purificados com extremidades sobrepostas foram montados usando na Vivo método de recombinação homóloga em E. coli cepa DH5α, levando a pdualUTR-PBAD-mCherry (SOM pdualUTR-PBAD-mCherry.gb). Os construtos corretos foram confirmados por sequenciamento usando a ligação do iniciador reverso à sequência de codificação mCherry, 5′-GATGTCAGCCGGGTGTTTAAC-3 ′.

Geração e triagem de bibliotecas 5 ′ UTR baseadas em pAO-Tr e pAO-Tn

Bibliotecas 5 ′ UTR foram construídas em pAO-Tr e pAO-Tn por clonagem dos oligonucleotídeos degenerados sintéticos entre seus respectivos locais de restrição NdeI e PciI, como descrito anteriormente 18, 30. Após a transformação de DNAs de plasmídeo em E. coli DH5α, bibliotecas com

280.000 transformantes (com base em pAO-Tr) e

Foram gerados 370.000 transformantes (baseados em pAO-Tn).

Análise de expressão de β-lactamase

O ensaio enzimático da β-lactamase foi realizado seguindo o protocolo descrito em outro lugar 37. Para análise de produção de proteína por SDS-PAGE ou Western blot, E. coli RV308 foi usado. E. coli Os clones RV308 foram cultivados em super caldo (32 g / L de peptona, 20 g / L de extrato de levedura e 5 g / L de NaCl). A expressão foi induzida na fase mid-log e as culturas foram colhidas 5 horas após a indução com ácido m-toluico 2 mM. 0,1 g de sedimento (peso úmido) foram lavados com NaCl 0,9% e ressuspensos em 1,5 mL de tampão de lise (Tris-HCl 25 mM, pH 8,0, NaCl 100 mM, EDTA 2 mM) seguido de incubação com lisozima 0,2 g / L em gelo durante 45 min e sonicação (3 min, ciclo de trabalho de 35%, controle de 3 saídas). Após adição de MgCl2 10 mM e tratamento com 125 U de Benzonase Nuclease (Sigma-Aldrich) durante 10 min, o lisado foi centrifugado para separar a fração sobrenadante solúvel do sedimento. A fração de sedimento insolúvel foi ressuspensa em 1,5 mL de tampão de lise. Ambas as frações foram executadas em um SDS-PAGE usando 12% de géis ClearPageTM e tampão ClearPAGETM SDS-R Run (C.B.S. Scientific) seguido por coloração com Coomassie Brilliant blue R-250 (Merck). A análise de Western blot foi realizada conforme descrito em outro lugar 33.

Análise de produção mCherry

A atividade mCherry foi determinada com um leitor de microplaca multifuncional Infinite M200 Pro (Tecan) medindo a fluorescência de 100 μL de cultura não tratada com excitação e emissão de comprimentos de onda de 584 nm (largura de banda de 9 nm) e 620 nm (largura de banda de 20 nm), respectivamente, e normalização contra leitura de absorbância em OD600. Três colônias bacterianas de cada um dos construtos UTR duplos foram transferidas para uma placa de 96 poços (Corning, preto, fundo plano, transparente) com cada poço contendo 100 μL de LB com canamicina. E. coli os clones foram cultivados até atingirem a fase logarítmica intermediária e foram induzidos com L-arabinose a uma concentração final de 0,2% ou com ácido m-toluico nas concentrações especificadas. As culturas induzidas foram cultivadas por 5 e / ou 18 horas (O / N) conforme especificado no texto principal.

Análise de transcrição

Para quantificar relativamente bla e mcherry transcrições, E. coli Os clones RV308 foram cultivados como descrito acima. Para estudos de decaimento de RNA, E. coli clones com construções UTR duplas foram cultivadas até que as culturas atingissem a fase mid-log e foram colhidas 5 horas após a indução com 2 mM mácido -toluico. As amostras para análise de transcrição foram retiradas 2, 4, 6, 8 e 10 minutos após a filtração seguindo o protocolo de lavagem 32. As culturas de células foram tratadas com proteção de RNA (Qiagen) para estabilizar o RNA. Isolamento de RNA, tratamento com DNase, síntese de cDNA e qRT-PCR foram realizados de acordo com protocolos descritos em outro lugar 18. Os seguintes pares de primer foram usados ​​em qPCR: para bla (5'-ACGTTTT CCAATGATGAGCACTT-3'and 5'-TGCCCGGCGTCAACAC-3 ') para mCherry (5'-CCT-CGTTCGCTTGGGACAT 3'and 5'-GATGTCAGCCGGGTGTTTAAC-3', e para o rRNA 16S (5'-A-3 ATTGACGTTACCCGCAGAAGA 'e 5′-GCTTGCACCCTCCGTATTACC-3').

Detalhes da calculadora RBS

As taxas de iniciação da tradução foram determinadas usando a função de engenharia reversa da calculadora RBS 24. A sequência de entrada para a calculadora RBS consistia na sequência de DNA 5 ′ UTR (até 50 nt) e os primeiros 50 nt do bla ou mcherry sequência de codificação. 5 ′ UTRs com características de tradução ideais foram gerados aplicando a função de engenharia direta da calculadora RBS usando a seguinte sequência de modelo 5′-GAGCTCCATTATTATTGT ATATGTnnnnnnnnnnnnnnnnnnnnnnnnnT-3 ’.


DISCUSSÃO

Neste estudo, examinamos sistematicamente o efeito do contexto da sequência de nucleotídeos das 5'-UTRs de Arabidopsis genes no nível de um único nucleotídeo e fornecem evidências de que os nucleotídeos nas posições -1 a 21 têm um efeito pronunciado na eficiência da tradução. Esta conclusão é baseada na análise de 25 5′-UTRs de Arabidopsis genes em sua capacidade de produzir proteínas GFP em protoplastos de tecidos foliares de Arabidopsis. Destes 25 5′-UTRs, a diferença na eficiência translacional entre o 5′-UTR mais forte e o 5′-UTR mais fraco foi mais de 200 vezes. A eficiência de tradução ditada pelo contexto de sequência do 5'-UTR deve ser uma propriedade intrínseca de um mRNA. Portanto, nossa descoberta de que Arabidopsis genes mostram grandes diferenças na eficiência translacional que levanta muitas questões interessantes sobre como os níveis de proteína dos genes são determinados em células vegetais, por que a 5'-UTR de certos mRNAs tem o contexto de sequência que é altamente recalcitrante na tradução e se os níveis transcricionais de os genes têm qualquer correlação com sua eficiência translacional. Atualmente, essas questões permanecem sem resposta.

Nossa descoberta de que a sequência de nucleotídeos do 5′-UTR, em particular, a região a montante imediata das posições de nucleotídeos -1 a -5, é crítica na eficiência da tradução está em um bom acordo com os resultados de muitos estudos anteriores que determinaram o efeito do contexto de sequência do 5′-UTR das posições de nucleotídeo −1 a −4 e também na posição de nucleotídeo +4 na eficiência de tradução (20-23, 39, 41-43). No entanto, neste estudo, examinamos o efeito do contexto de sequência em uma região muito mais longa (a região de 21 nt das posições -1 a 21) das 25 5′-UTRs na eficiência translacional. Como observado anteriormente, a região a montante imediata das posições de nucleotídeo -1 a -4 foi a mais crítica na determinação da eficiência translacional. Além disso, nosso estudo forneceu evidências de que a região mais a montante da posição do nucleotídeo −4 também pode afetar significativamente a eficiência da tradução dependendo dos genes individuais.

Os 5'-UTRs podem exercer um efeito sobre a eficiência da tradução através de vários modos, tanto positiva quanto negativamente, usando motivos de sequência específicos, estrutura secundária ou contexto de sequência em torno do local de iniciação da tradução (5, 44). Destes modos, o efeito do contexto de sequência em torno da 5'-UTR foi extensivamente estudado em células animais (43). De fato, a regra de Kozak descreve que bases A / G na posição -3 com resíduos de pirimidina circundantes e G na posição +4 são cruciais para maior eficiência de tradução em genes animais. No entanto, em genes de plantas, a sequência de consenso, AAAA / CA AUG GC, do local de iniciação da tradução, que foi obtida pela análise de 3643 genes de plantas, não está em conformidade com a sequência de Kozak (19), embora a sequência de consenso também contenha o A e G conservado resíduos nas posições -3 e +4, respectivamente. No entanto, não foi avaliado sistematicamente como a sequência de consenso está correlacionada com o nível de tradução nas células vegetais. Na verdade, um 5′-UTR sintético de 28 nt de comprimento que por acaso mostrou um alto nível de eficiência de tradução não está em conformidade com a sequência de Kozak, levantando assim uma questão quanto à importância da sequência de Kozak na eficiência de tradução em sistemas de plantas ( 45). Na verdade, em plantas, o resíduo A nas posições -1 a -4 é mais favorável na eficiência translacional (20, 21, 35, 36, 38-41). Nesse aspecto, nossos resultados são consistentes com os achados anteriores. Além disso, e apoiando ainda mais esta ideia, é que a introdução de três As em uma 5′-UTR "fraca" nas posições -1 a -5 aumentou muito a eficiência translacional.

Outra observação importante que fizemos neste estudo é que os tipos de nucleotídeos e sua posição no 5′-UTR de 21 nt de comprimento têm efeitos diferentes na eficiência translacional. No geral, o resíduo A foi o nucleotídeo mais favorável não apenas nas posições -1 a -4, mas também em toda a região 21 nt das 5′-UTRs que examinamos. No entanto, um estudo anterior mostrou que a introdução de um trecho de nucleotídeos A no 5'-UTR do gene da álcool oxidase de levedura reduziu muito a eficiência da tradução de uma maneira dependente do comprimento (46), sugerindo que a introdução de poli (A) para o 5′-UTR nem sempre é favorável para tradução. Em contraste, o resíduo T era o nucleotídeo menos favorável nas 5'-UTRs. Em particular, a introdução de três Ts em um bom 5′-UTR nas posições -1 a -5 suprimiu bastante a eficiência translacional. However, in certain cases, the T residue located in the more 5′ side of the 21 nt-long 5′-UTR increased the translational efficiency, suggesting that the exact location of the T nucleotide is important for the translational efficiency. In the case of the C nucleotide, its effect on the translation was also position-dependent introduction of three C residues in the positions −1 to −5 of the 5′-UTR greatly suppressed the translational efficiency, whereas the 3 C residues in the middle of the 21 nt region of the 5′-UTR did not affect or only slightly increased the translational efficiency. Introduction of G residues throughout the entire 21 nt region of the 5′-UTR generally suppressed the translational efficiency. These results strongly suggest that although the translational efficiency is in general most critically dependent on the immediate upstream region, for example the region from the positions −1 to −4, of the 5′-UTR from the AUG start codon, the translational efficiency of a particular 5′-UTR is determined by the sequence context of the entire nucleotide sequence of the 5′-UTR. Currently, however, it is not clearly understood at the molecular level how the different types of nucleotides affect differently the translational efficiency.

One of the most crucial events for the translation is the assembly of the initiation complex at the AUG start codon of an mRNA ( 5). Thus, one possible explanation for the differential effect of the nucleotide sequence context around the initiation site on the translation efficiency is that the assembly of the translation initiation complex is affected by the nucleotide sequence around the AUG start codon. One of most well-characterized sequence motifs in the 5′-UTR that affect the assembly of the initiation complex is the Shine-Dalgarno (SD) box in the 5′-UTR of prokaryotic mRNAs. The sequence in the SD box is involved in base-pairing with the 3′-end of 16S rRNA of ribosomes, thereby facilitates the formation of the initiation complex at the AUG start codon ( 47). However, the mechanism of initiation complex assembly in eukaryotic cells is different from that of prokaryotic cells. Multiple initiation factors are involved in assembly of the 40S ribosomal subunit in the AUG initiation codon. Of these initiation factors, eIF1A is involved in the selection of the initiation codon ( 48). Thus, the sequence context may play a role in the selection of the first AUG by eIF1A. In addition, other factors may also be involved in the 40S ribosomal subunit assembly. Interestingly, in the case of the omega leader sequence found in TMV, HSP101 is involved in the omega sequence-mediated translational enhancing ( 49). HSP101 directly binds to the poly(CAA) region of the omega leader sequence and mediates recruitment of two eukaryotic translational initiation factors, eIF4G and eIF3 to promote translation initiation ( 39). However, eIF4G binds the cap structure at the 5′-end of mRNA, thus playing a role in the initial recognition of mRNAs. Another important sequence element affecting the translational efficiency is the oligopyrimidine track in the 5′-end of the 5′-UTR which is present in many ribosomal protein genes. This oligopyrimidine track causes suppression of translation in both animal and plant cells ( 50). However, the oligopyrimidine track was located close to the 5′ cap structure in the 5′-UTR. Thus, the exact mechanism underlying the inhibitory effect of T or C residues in the oligopyrimidine track may not be the same as that of T or C residues in the positions −1 to −5 in this study. The sequence analysis of the 5′-UTRs of 15 971 Arabidopsis genes revealed that two sequence motifs, TAGGGTTT and AAAACCCT, are presented in many Arabidopsis genes, raising the possibility that these sequence elements may play a role in translational efficiency. Indeed, of the two sequence elements, the sequence motif TAGGGTTT has been shown to confer a higher translational efficiency ( 51). However, it is not known how these two sequence motifs confer their translational enhancing activity. One possibility is that an unknown factor may recognize these motifs. In contrast to these sequence motifs, the mechanism of how the secondary structure in the 5′-UTR affects the translational efficiency is well understood. It impedes the scanning process of the 40S subunit from the 5′ cap structure ( 52). Indeed, 5′-UTRs were, on average, less structured than the coding region in Arabidopsis and yeast transcripts ( 10, 53). However, in contrast to this notion, Li et al. ( 53) recently reported results showing that the overall secondary structure of transcripts facilitates translation. This conclusion was based on the fact that the more structured transcripts were significantly more ribosome-associated than the less structured transcripts. These results raise the possibility that the secondary structure in the 5′-UTRs and coding region regulates the translation efficiency at multiple levels.

In summary, we have demonstrated here how in plants the sequence context around the initiation codon affects the translational efficiency. In particular, the presence of multiple A nucleotides at −1 to −5 from the AUG initiation codon is crucial for high translational efficiency. However, it remains elusive how this occurs at the molecular level. To elucidate the exact mechanism in detail, it will be imperative to identify the factor(s) involved in this process and to characterize them at the molecular and biochemical levels.


Conteúdo

Although this term is also sometimes used interchangeably with exon, it is not the exact same thing: the exon is composed of the coding region as well as the 3' and 5' untranslated regions of the RNA, and so therefore, an exon would be partially made up of coding regions. The 3' and 5' untranslated regions of the RNA, which do not code for protein, are termed non-coding regions and are not discussed on this page. [4]

There is often confusion between coding regions and exomes and there is a clear distinction between these terms. While the exome refers to all exons within a genome, the coding region refers to a singular section of the DNA or RNA which specifically codes for a certain kind of protein.

In 1978, Walter Gilbert published "Why Genes in Pieces" which first began to explore the idea that the gene is a mosaic—that each full nucleic acid strand is not coded continuously but is interrupted by "silent" non-coding regions. This was the first indication that there needed to be a distinction between the parts of the genome that code for protein, now called coding regions, and those that do not. [5]

The evidence suggests that there is a general interdependence between base composition patterns and coding region availability. [7] The coding region is thought to contain a higher GC-content than non-coding regions. There is further research that discovered that the longer the coding strand, the higher the GC-content. Short coding strands are comparatively still GC-poor, similar to the low GC-content of the base composition translational stop codons like TAG, TAA, and TGA. [8]

GC-rich areas are also where the ratio point mutation type is altered slightly: there are more transitions, which are changes from purine to purine or pyrimidine to pyrimidine, compared to transversions, which are changes from purine to pyrimidine or pyrimidine to purine. The transitions are less likely to change the encoded amino acid and remain a silent mutation (especially if they occur in the third nucleotide of a codon) which is usually beneficial to the organism during translation and protein formation. [9]

This indicates that essential coding regions (gene-rich) are higher in GC-content and more stable and resistant to mutation compared to accessory and non-essential regions (gene-poor). [10] However, it is still unclear whether this came about through neutral and random mutation or through a pattern of selection. [11] There is also debate on whether the methods used, such as gene windows, to ascertain the relationship between GC-content and coding region are accurate and unbiased. [12]

In DNA, the coding region is flanked by the promoter sequence on the 5' end of the template strand and the termination sequence on the 3' end. During transcription, the RNA Polymerase (RNAP) binds to the promoter sequence and moves along the template strand to the coding region. RNAP then adds RNA nucleotides complementary to the coding region in order to form the mRNA, substituting uracil in place of thymine. [13] This continues until the RNAP reaches the termination sequence. [13]

After transcription and maturation, the mature mRNA formed encompasses multiple parts important for its eventual translation into protein. The coding region in an mRNA is flanked by the 5' untranslated region (5'-UTR) and 3' untranslated region (3'-UTR), [1] the 5' cap, and Poly-A tail. During translation, the ribosome facilitates the attachment of the tRNAs to the coding region, 3 nucleotides at a time (codons). [14] The tRNAs transfer their associated amino acids to the growing polypeptide chain, eventually forming the protein defined in the initial DNA coding region.

The coding region can be modified in order to regulate gene expression.

Alkylation is one form of regulation of the coding region. [16] The gene that would have been transcribed can be silenced by targeting a specific sequence. The bases in this sequence would be blocked using alkyl groups, which create the silencing effect. [17]

While the regulation of gene expression manages the abundance of RNA or protein made in a cell, the regulation of these mechanisms can be controlled by a regulatory sequence found before the open reading frame begins in a strand of DNA. The regulatory sequence will then determine the location and time that expression will occur for a protein coding region. [18]

RNA splicing ultimately determines what part of the sequence becomes translated and expressed, and this process involves cutting out introns and putting together exons. Where the RNA spliceosome cuts, however, is guided by the recognition of splice sites, in particular the 5' splicing site, which is one of the substrates for the first step in splicing. [19] The coding regions are within the exons, which become covalently joined together to form the mature messenger RNA.

Mutations in the coding region can have very diverse effects on the phenotype of the organism. While some mutations in this region of DNA/RNA can result in advantageous changes, others can be harmful and sometimes even lethal to an organism's survival. In contrast, changes in the coding region may not always result in detectable changes in phenotype.

Mutation types Edit

There are various forms of mutations that can occur in coding regions. One form is silent mutations, in which a change in nucleotides does not result in any change in amino acid after transcription and translation. [21] There also exist nonsense mutations, where base alterations in the coding region code for a premature stop codon, producing a shorter final protein. Point mutations, or single base pair changes in the coding region, that code for different amino acids during translation, are called missense mutations. Other types of mutations include frameshift mutations such as insertions or deletions. [21]

Formation Edit

Some forms of mutations are hereditary (germline mutations), or passed on from a parent to its offspring. [22] Such mutated coding regions are present in all cells within the organism. Other forms of mutations are acquired (somatic mutations) during an organisms lifetime, and may not be constant cell-to-cell. [22] These changes can be caused by mutagens, carcinogens, or other environmental agents (ex. UV). Acquired mutations can also be a result of copy-errors during DNA replication and are not passed down to offspring. Changes in the coding region can also be de novo (new) such changes are thought to occur shortly after fertilization, resulting in a mutation present in the offspring's DNA while being absent in both the sperm and egg cells. [22]

Edição de prevenção

There exist multiple transcription and translation mechanisms to prevent lethality due to deleterious mutations in the coding region. Such measures include proofreading by some DNA Polymerases during replication, mismatch repair following replication, [23] and the 'Wobble Hypothesis' which describes the degeneracy of the third base within an mRNA codon. [24]

While it is well known that the genome of one individual can have extensive differences when compared to the genome of another, recent research has found that some coding regions are highly constrained, or resistant to mutation, between individuals of the same species. This is similar to the concept of interspecies constraint in conserved sequences. Researchers termed these highly constrained sequences constrained coding regions (CCRs), and have also discovered that such regions may be involved in high purifying selection. On average, there is approximately 1 protein-altering mutation every 7 coding bases, but some CCRs can have over 100 bases in sequence with no observed protein-altering mutations, some without even synonymous mutations. [25] These patterns of constraint between genomes may provide clues to the sources of rare developmental diseases or potentially even embryonic lethality. Clinically validated variants and de novo mutations in CCRs have been previously linked to disorders such as infantile epileptic encephalopathy, developmental delay and severe heart disease. [25]

While identification of open reading frames within a DNA sequence is straightforward, identifying coding sequences is not, because the cell translates only a subset of all open reading frames to proteins. [26] Currently CDS prediction uses sampling and sequencing of mRNA from cells, although there is still the problem of determining which parts of a given mRNA are actually translated to protein. CDS prediction is a subset of gene prediction, the latter also including prediction of DNA sequences that code not only for protein but also for other functional elements such as RNA genes and regulatory sequences.

In both prokaryotes and eukaryotes, gene overlapping occurs relatively often in both DNA and RNA viruses as an evolutionary advantage to reduce genome size while retaining the ability to produce various proteins from the available coding regions. [27] [28] For both DNA and RNA, pairwise alignments can detect overlapping coding regions, including short open reading frames in viruses, but would require a known coding strand to compare the potential overlapping coding strand with. [29] An alternative method using single genome sequences would not require multiple genome sequences to execute comparisons but would require at least 50 nucleotides overlapping in order to be sensitive. [30]


3 respostas 3

Sim, claro. Exons are not limited to the protein coding regions. Many UTRs are in exons. In fact, you even have various cases of UTRs being multiple exons, and being spliced.

What is strange in your file is not so much that you have exons beyond the stop codon, but that you also have them marked as CDS (coding sequence). That isn't possible, no. While there can indeed be exons in the UTRs, those are not coding and shouldn't be called CDS. That's probably just a minor nomenclature issue though and what you are looking at is a spliced UTR.

So, the exons (or the parts of the exons) that fall between the start and stop codons will be translated, while those that fall outside that regions will not be (UTRs).

For example, this is the exonic structure shown for ENST00000617185, one of the transcripts of the human P53 gene:

The boxes are exons and the lines are introns. The colored boxes are protein coding exons, while the empty ones are UTR exons. Note how they are also spliced and that this particular transcript has 3 non-coding exons on the 5' end and one on the 3' end.


Effect of Alcohol on the Regulation of α-Synuclein in the Human Brain

The Effect of Genetic Variation on miRNA-Mediated α-Synuclein Regulation

The 3′-UTR of SNCA contains many SNPs that have the potential to alter miRNA-mediated regulation of α-synuclein. A polymorphism may affect the binding of a miRNA to its binding site within the 3′-UTR of α-synuclein, by altering the secondary structure or unfolding of the 3′-UTR and inhibiting access to the site ( Kertesz et al., 2007 ). Changes to a miRNA-binding site in the SNCA 3′-UTR may abolish or strengthen the binding affinity a miRNA has for its target, and also has the potential to create a new miRNA-binding site. Thus, genetic variation within a miRNA-binding site has the potential to alter gene expression and can influence the susceptibility of an individual developing an alcohol abuse phenotype ( Chen et al., 2008 Georges et al., 2007 ).

As previously mentioned two SNPs, rs356221 and rs356219, were found to be associated with alcohol dependence in a subpopulation of individuals who also experienced craving ( Foroud et al., 2007 ). Results in a 2015 study suggested that the rs356219/356221 G-A haplotype may reduce the risk of developing an alcohol abuse phenotype however, this did not appear to influence the expression of α-synuclein in the prefrontal cortex of human alcoholics ( Janeczek et al., 2015 ). Although the rs356219 and rs356221 are located further downstream of the SNCA 3′-UTR, they may still have the potential to influence α-synuclein expression. There are several SNPs within the SNCA 3′-UTR of each of the individual splice variants, future studies should investigate whether any SNPs within or near any known miRNA-binding sites have the potential to influence α-synuclein expression and are associated with alcohol abuse phenotypes. Although it is unlikely that an SNP would have a significant impact on α-synuclein gene expression, it may be one factor contributing to the altered expression changes seen in alcoholic brain. Genetic variation within the 3′-UTR and the effect of this on miRNA-mediated regulation of α-synuclein is a topic that requires further investigation as more miRNA:SNCA interactions are validated.

Since the α-synuclein splice variants are predicted to be targeted by different miRNAs, it may be possible to regulate the amounts of each of these variants in vivo using synthetic miRNAs. miRNAs may have therapeutic potential in protecting the brain against alcohol-induced damage by altering selective α-synuclein splice variants to promote neuroprotection. Based on previous studies, it has been suggested that α-synuclein may play a role in neuroprotection ( Seo et al., 2002 ), and that one of the splice variants may be specifically involved in protecting the brain from damage. Thus, synthetic miRNAs could be used to selectively reduce expression levels of the α-synuclein splice variants or antagomirs could be used to knock down specific miRNAs allowing the up-regulation of selective splice variants. MiR-7 and miR-153 are potential candidates for such studies.

Down-regulation of α-synuclein is seen in the prefrontal cortex of alcoholics. Lower levels of α-synuclein may therefore increase susceptibility of neurons to the neurotoxic effects of alcohol due to a loss of its neuroprotective effects. Since α-synuclein also plays a role in trafficking of neurotransmitter transporters, neurons with lowered α-synuclein levels may lose the ability to adapt to the continual presence of alcohol in the brain. Therefore, it is thought that α-synuclein may play a part in the alcohol addiction pathway. Normal physiological regulation of α-synuclein may be affected by genetic variation increasing the susceptibility of individuals who consume alcohol long term at high levels to the disease.


Hypophosphatasia

Translation, Self-Association, and Subsequent Modification

A portion of exon 2 is untranslated and the single unambiguous start codon is located in the middle of the exon. A leucine-rich, 17-residue signal peptide allows for docking of the bTNAP/ribosome complex with the endoplasmic reticulum (ER), followed by insertion of the nascent peptide into the membrane and secretion into the ER lumen ( Fig. 1 ). Further processing occurs at the C terminus with the recognition of a signal for cleavage and transfer of the mature peptide to a glycosylphosphatidy-linositol (GPI) anchor. The anchor is synthesized in the ER membrane separately from the peptide target, and the transfer is a one-step transamidation reaction requiring a target recognition sequence [ 46–48 ], activating a carboxyl group (Asp 484 in PLAP [ 49 ]), which becomes the final peptide of the mature enzyme [ 50 ]. In bTNAP, the homologous position for acceptable ω amino acid (G, A, S, C, D, or E preferred) and ω +2 amino acid (G, A, or S preferred) residues [ 51 ] suggests that Ser 487 in the C-terminal segment SSAG 487 SLAAGP is a likely acceptor site, but direct experimental verification of this reaction in purified bTNAP has not been reported.

As with all ALPs, self-assembly into noncovalently associated homodimers occurs soon after translation, but the relationship of this self-assembly step to the protein folding events and anchoring to the phosphatidylglycan membrane moiety is not known. The emergent 66-kDa peptide then undergoes glycosylation during its transport to the Golgi apparatus, becoming an

80-kDa peptide at the cell surface [ 52 ]. As much as 10% of the nascent peptide may escape membrane attachment and be secreted directly [ 53 ].


Assista o vídeo: Откровения. Массажист 16 серия (Janeiro 2022).