Em formação

Criopreservação de oócitos: genes de três pais?


Recentemente, ouvi falar de algo chamado criopreservação de oócitos, em que um óvulo (fertilizado, eu acho) de uma mulher é extraído, congelado e posteriormente descongelado e reinserido na mulher para atrasar a gravidez.

Agora, isso é apenas uma ideia, eu não sei se isso é realmente possível, mas esse ovo congelado pode ser implantado em um diferente mulher, quem não é o dono original do ovo? Se sim, quais genes a criança herdaria? Ele obteria genes de todos os três pais ou apenas do dono original do espermatozóide e do óvulo?


Resumindo: sim, é possível doar um oócito para outra mulher. Isso normalmente é feito na reprodução assistida e combinado com a fertilização in vitro. A criança herdaria apenas os genes do oócito doador e do esperma, pois o material genético está contido no oócito e no esperma. Não há contribuição genética do receptor.

Você pode encontrar mais informações na página correspondente da wikipedia: Doação de óvulos


A troca de material genético nuclear entre oócitos e embriões oferece uma nova opção reprodutiva para a prevenção de doenças mitocondriais hereditárias. A disfunção mitocondrial foi reconhecida como uma causa significativa de uma série de doenças multiorgânicas graves. Tecidos com alta demanda metabólica, como cérebro, coração, músculos e sistema nervoso central, são freqüentemente afetados. A doença mitocondrial pode ser devida a mutações no DNA mitocondrial ou em genes nucleares envolvidos na função mitocondrial. Não há tratamento curativo para pacientes com doença mitocondrial. Dada a falta de tratamentos e as limitações do diagnóstico pré-natal e pré-implantação, a atenção tem se voltado para a prevenção da transmissão de doenças mitocondriais por meio da terapia de substituição gênica da linha germinativa. Como o DNA mitocondrial é estritamente herdado da mãe, duas abordagens foram propostas. No primeiro, o genoma nuclear do zigoto do estágio pronuclear de uma mulher afetada é transferido para um zigoto doador enucleado. Uma segunda técnica envolve a transferência do fuso metafase II do oócito não fertilizado de uma mulher afetada para um oócito doador enucleado. Nosso grupo relatou recentemente uma transferência de fuso bem-sucedida entre oócitos humanos, resultando no desenvolvimento de blastocisto e derivação de células-tronco embrionárias, com níveis muito baixos de heteroplasmia. Nesta revisão, resumimos essas novas técnicas de reprodução assistida e seu uso para prevenir a transmissão de doenças mitocondriais. As promessas e os desafios são discutidos, enfocando sua potencial aplicação clínica.

P.A. não tem nada a divulgar. M.T. não tem nada a divulgar. EM. não tem nada a divulgar. S.M. tem uma patente pendente (no. 61 / 172.644).


Criopreservação de oócitos: genes de três pais? - Biologia

& ldquo E quanto a Dúvidas sobre ciclismo no exterior? Podemos ajudá-lo a obter as respostas de que precisa. & rdquo
- Seus amigos PVED
Entrar!

Freqüentemente, os pacientes com infertilidade se perguntam se a tecnologia afetará o resultado de seus bebês. Fomos tranquilizados por vários relatórios sobre os resultados obstétricos e risco de defeitos congênitos com a criopreservação de oócitos humanos.

Chian et al. (2008) relataram os resultados obstétricos de mais de 200 bebês resultantes da vitrificação de oócitos em três centros, comparando-os a recém-nascidos concebidos espontaneamente ou com ART. O peso médio ao nascer e a taxa de anomalias foram semelhantes

Noyes et al. publicou uma meta-análise de mais de 600 bebês nascidos de criopreservação de oócitos, quase metade de vitrificação, que mostrou uma taxa de 1,3% de defeitos congênitos, bem dentro da taxa esperada para bebês concebidos naturalmente.

Forman et al. (2012) não encontraram aumento nos erros cromossômicos embrionários quando óvulos vitrificados foram comparados com óvulos não vitrificados. Esses pesquisadores utilizaram ciclos de 44 pacientes com idade média de cerca de 30 anos, utilizando 588 oócitos maduros. As taxas de fertilização usando ICSI e as taxas de desenvolvimento de blastocisto foram menores com a vitrificação. No entanto, as taxas de gravidez foram semelhantes quando os blastocistos foram transferidos (54% vs. 58%).

Recentemente, Goldman et al (2015) usando controles pareados por idade, demonstraram que, embora as taxas de blastulação (desenvolvimento para blastocisto) de óvulos vitrificados fossem menores do que com óvulos frescos (54,5% vs 66,2%), eles tinham taxas equivalentes de euploidia, implantação e nascidos vivos quando comparados aos blastocistos derivados de oócitos frescos. Neste estudo, todos os embriões foram biopsiados e submetidos a triagem genética pré-implantação (array Comparative Genome Hybridization).

Embora estudos adicionais sejam necessários, parece que podemos tranquilizar as pacientes de que não há risco aumentado associado à vitrificação do oócito.

A Dra. Patricia McShane está envolvida na medicina reprodutiva desde os primeiros dias da fertilização in vitro nos Estados Unidos. Ela foi diretora médica de um grande centro privado de fertilidade e também ensinou e praticou medicina acadêmica. Ela ficou muito satisfeita quando o congelamento de óvulos se tornou uma realidade clínica prática. Dr. McShane é o diretor médico do Banco Mundial de Ovos.

Dr. Kimball O. Pomeroy é o Diretor de Ciência do Banco Mundial de Ovos. Ele dirigiu vários laboratórios clínicos nos Estados Unidos. Ele foi formado em Bristol, Inglaterra como embriologista humano e antes disso foi educado na Colorado State University, recebendo um PhD em Fisiologia Animal, e depois trabalhou no Salk Institute for Biological Studies, onde fez pós-doutorado em biologia molecular . No Salk Institute, o Dr. Pomeroy foi um biólogo molecular e trabalhou com o Dr. Glen Evans no Projeto Genoma Humano (cromossomo 7) e fez um trabalho com transgênicos.

RC Chian et al. Resultado obstétrico e perinatal em 200 bebês concebidos a partir de oócitos vitrificados. Reproductive BioMedicine Online 16: 608-610, 2008

N Noyes, E Porcu, A Borini. Mais de 900 bebês com criopreservação de oócitos nascidos sem aumento aparente de anomalias congênitas. Reproductive BioMedicine Online 18: 769-776, 2009

E Forman et al. A vitrificação do oócito não aumentou o risco de aneuploidia embrionária ou diminuiu o potencial de implantação de blastocistos criados após injeção intracitoplasmática de espermatozóide: um novo ensaio clínico randomizado emparelhado controlado usando impressões digitais de DNA. Fertil Steril 98: 644-649, 2012

K Goldman et al. A criopreservação de longo prazo de oócitos humanos não aumenta a aneuploidia embrionária. Fertil. Steril.103: 662-668, 2015

A Dra. Patricia McShane está envolvida na medicina reprodutiva desde os primeiros dias da fertilização in vitro nos Estados Unidos. Ela foi diretora médica de um grande centro privado de fertilidade e também ensinou e praticou medicina acadêmica. Ela ficou muito satisfeita quando o congelamento de óvulos se tornou uma realidade clínica prática. Dr. McShane é o diretor médico do Banco Mundial de Ovos.


Opções de preservação da fertilidade na reatribuição de gênero

A preservação da fertilidade e os cuidados de saúde para transgêneros são áreas de rápido crescimento da pesquisa e da prática clínica. Os Padrões de Cuidado da Associação Profissional Mundial de Saúde para Transgêneros (WPATH) recomendam em sua sétima versão que as pessoas que buscam tratamentos de confirmação de gênero sejam informadas sobre suas opções de preservação da fertilidade antes de iniciar qualquer tratamento. No momento, porém, há conhecimento limitado sobre as opções disponíveis e sua viabilidade para pessoas trans e aqueles que as apoiam.

Atualmente, as opções de serviços de fertilidade estabelecidas para homens transexuais são a criopreservação de oócitos e, no caso de uma parceria, a criopreservação de embriões. Para mulheres transexuais, a criopreservação de espermatozoides é o protocolo estabelecido. Teoricamente, também existe a possibilidade de criopreservar o tecido gonádico, mas estas envolvem técnicas experimentais para o uso futuro do tecido e, portanto, não são o método de preservação da fertilidade estabelecido de escolha.

Dragana Gordic / Shutterstock.com

Desejos dos pais
Descobriu-se que metade dos homens trans tem desejos dos pais, mas estudos mais recentes e focados identificaram que 39% dos entrevistados designados do sexo feminino no nascimento e 21,9% do masculino ao nascer tinham desejos dos pais. Embora esses números contemporâneos sejam mais baixos, eles ainda indicam que uma grande proporção de pessoas trans deseja ter filhos. Os desejos dos pais podem ser alcançados por meio de métodos sociais ou biológicos, como adoção de crianças antes ou depois dos tratamentos de confirmação de gênero, barriga de aluguel (em algumas regiões) ou acesso a serviços de fertilidade para técnicas de reprodução assistida.

Todas as opções têm uma ampla gama de questões a serem consideradas. As barreiras identificadas por pessoas trans para não buscar a satisfação dos desejos dos pais incluem preocupações relacionadas ao procedimento de adoção e preconceitos que podem ser vividos dentro dele. Eles percebem que esses preconceitos também farão com que qualquer filho que tenham seja discriminado e que eles podem, como pais transgêneros, sofrer discriminação. Embora os transexuais possam ter medo da discriminação, eles também estão preocupados que satisfazer o desejo dos pais usando seu próprio material genético pode ser extremamente caro financeiramente. Os métodos sociais para alcançar o desejo dos pais, como adoção e barriga de aluguel, não são considerados aqui, mas são opções que precisam de uma discussão mais aprofundada. As opções de tratamento de fertilidade biológica são exploradas por Kelly Tilleman e seus colegas e descritas aqui.

Estudos recentes identificaram que 39% dos entrevistados designados do sexo feminino no nascimento e 21,9% designados do sexo masculino ao nascer tinham desejos parentais.

Homem de nascimento atribuído
Para pessoas designadas do sexo masculino ao nascimento (AMAB), a opção de preservação da fertilidade de congelamento de esperma (criopreservação de esperma) está disponível por meio de serviços de fertilidade desde 1950, é eficaz e considerada fácil de executar. Apesar disso, é importante observar a carga psicológica potencial, pois pode não ser fácil para a AMAB coletar uma amostra de sêmen por masturbação. O esperma também pode ser coletado e congelado antes de qualquer tratamento de confirmação de sexo por meio de extração cirúrgica, mas esta é uma técnica cirúrgica com seus riscos associados.

Monkey Business Images / Shutterstock.com

A outra opção é teórica e experimental e envolve a recolha cirúrgica de tecido testicular que é congelado com vista a descongelar e amadurecer posteriormente in vitro ou por transplante seguido de técnicas de reprodução assistida. O uso de tecido testicular para obter espermatozóides maduros nunca foi usado em humanos.

Mulheres designadas ao nascimento
Como é o caso da AMAB, as opções de preservação da fertilidade para pessoas designadas do sexo feminino no nascimento (AFAB) são limitadas e cada abordagem precisa de consideração cuidadosa antes de qualquer intervenção ser realizada. As três opções são criopreservação de oócitos, criopreservação de embriões e criopreservação experimental de tecido ovariano. Cada um está repleto de desafios.

A criopreservação de oócitos requer que os ovários AFAB sejam estimulados e os oócitos maduros sejam coletados. Isso requer monitoramento de ultrassom vaginal durante o período de estimulação ovariana, o que pode ser repugnante para mulheres que desejam confirmar seu sexo masculino.

A criopreservação de embriões envolve a colheita de oócitos maduros que podem ser fertilizados in vitro. Uma decisão antecipada relacionada à amostra de esperma usada na fertilização é adquirida.

A terceira opção é experimental, exigindo a coleta de tecido ovariano que contém folículos com oócitos imaturos. O tecido é então congelado, pronto para os oócitos amadurecerem in vitro no futuro. Essa técnica pode, em tese, não exigir um adiamento do gênero confirmando a jornada terapêutica. Na verdade, poderia, na prática, ser realizado após o início da terapia com hormônio testosterona e durante a cirurgia de confirmação de gênero.

Tilleman e seus colegas exploram as opções disponíveis para pessoas transgênero e de gênero diverso. rumruay / Shutterstock.com

Coleta de tecido ovariano (para ganhar oócitos imaturos)
Este método ex-vivo já é usado em mulheres que iniciam o tratamento do câncer, o que pode torná-las inférteis. O uso de tecido ovariano (para ganhar oócitos imaturos) para preservação da fertilidade em mulheres com câncer tem sido uma técnica bem-sucedida, mas para AFAB ela permanece experimental, especialmente durante a terapia com testosterona. Tilleman e colegas realizaram estudos detalhados para estabelecer a viabilidade dessa forma de preservação da fertilidade.

A coleta de tecido ovariano para coleta de oócitos imaturos poderia, para AFAB, ser realizada durante ooforectomia como parte da cirurgia de confirmação de gênero. Isso reduziria a intervenção médica durante sua jornada de confirmação de gênero e removeria os obstáculos associados à coleta de oócitos maduros para facilitar a preservação da fertilidade. Isso também elimina a necessidade de tomar decisões parentais antes que a pessoa tenha estabelecido seus desejos parentais.

No momento, ainda existem algumas opções de tempo limitado para a preservação da fertilidade para pessoas transgênero e de gênero diverso.

Tecido ovariano após terapia com testosterona
Oócitos de tecido ovariano (OTO) são diferentes em mulheres com AFAB após a terapia com testosterona para aquelas submetidas a tratamento oncológico. O córtex ovariano é mais rígido na AFAB, apesar disso os folículos, dos quais emergem os oócitos imaturos, não são destruídos. Esses oócitos imaturos são coletados como complexos cúmulos-oócitos (COCs) de dentro dos folículos do tecido ovariano. Depois que esses COCs foram coletados de homens transgêneros, geralmente no momento da ooforectomia e histerectomia, eles foram amadurecidos in vitro. Estes COCs maturados in vitro foram examinados quanto à estrutura do fuso e alinhamento cromossômico que parecia normal antes e após o congelamento; eles mostraram ter fusos meióticos normais. Infelizmente, os oócitos do tecido ovariano maturados in vitro (OTO-IVM) durante o tratamento com testosterona, mostram baixa capacidade de desenvolvimento e têm uma viabilidade de fertilidade muito baixa.

oneinchpunch / Shutterstock.com

OTO-IVM
Em sua publicação recente, Lierman et al. descobriram que a taxa de sobrevivência da OTO após o aquecimento era de 72,6%, mas a taxa de fertilização desses oócitos era de apenas 34,5%. Metade desses embriões atingiu o dia 3 com mais ou igual a 6 células. No dia 5, apenas um blastocisto, um embrião que consiste em três partes, células internas, cavidade preenchida com fluido e células externas, havia se desenvolvido. Padrões anormais de clivagem (desenvolvimento) foram encontrados em 45,8% das OTO-IVM e a parada embrionária precoce foi observada em 91,7%. A análise genética dos embriões mostrou padrões cromossômicos normais em 42% dos embriões analisados.

Conclusão
Apesar do rápido crescimento da preservação da fertilidade, da pesquisa em saúde para transgêneros e da prática clínica, no momento ainda existem algumas opções de tempo limitado para a perseverança da fertilidade para pessoas trans. O WPATH recomenda opções de preservação da fertilidade que são eficazes e são discutidas com aqueles que exploram a transição de gênero em um estágio inicial. Dado o conhecimento atual, se isso não for realizado no início da jornada de confirmação de gênero, antes ou depois da cessação do tratamento com hormônio cruzado, as pessoas trans podem perder a oportunidade de fertilidade no momento em que identificam os desejos dos pais.

Para a AMAB, a criopreservação do esperma é a única técnica de preservação da fertilidade estabelecida. Para a AFAB, dado o conhecimento atual da pesquisa disponível, existem, de forma realista, apenas duas opções de criopreservação de oócitos ou criopreservação de embriões.

Resposta pessoal

O que vem a seguir para sua pesquisa?

Estamos no processo de elaboração de um protocolo de pesquisa para a AFAB colher ovários antes do tratamento com testosterona. Neste momento, os ovários ainda não foram expostos à testosterona. Podemos usar essas doações para otimização da técnica OTO-IVM. Se isso valesse a pena, poderia omitir o fardo de passar por estimulação ovariana acompanhada de monitoramento de ultrassom endovaginal e resultar em oócitos maduros e fertilizáveis.


A vitrificação de oócitos ovinos maturados in vitro afeta o desenvolvimento pré-implantação in vitro e a abundância de mRNA †

Sara Succu e Daniela Bebbere contribuíram igualmente para este trabalho.

Resumo

O impacto dos procedimentos de vitrificação no conteúdo de mRNA de ovócitos ovinos maturados in vitro (IVM) e na capacidade de se submeter a fertilização, clivagem e desenvolvimento embrônico com sucesso foi avaliado. Vitrificados-aquecidos (n = 113) e controle (n = 140) oócitos IVM foram fertilizados in vitro e cultivados até o estágio de blastocisto sob condições padrão. Oócitos vitrificados mostraram menor taxa de clivagem (47% vs. 75%, P & lt 0,001) e desenvolvimento até o estágio de blastocisto (17% vs. 57%, P & lt 0,001) do que os controles. Além disso, os tempos da primeira clivagem e produção de blastocistos foram significativamente atrasados ​​no grupo aquecido com vitrificação (P & lt 0,001 em ambos os casos). Em paralelo, analisamos por transcriptase reversa PCR em tempo real a abundância relativa de β-actina, histona H2A.Z, Poli A Polimerase (PAP), Proteína de choque térmico 90β (HSP90β), P34 cdc2, Ciclina b, Na / K- Transcritos de ATPase e caderina Tipo I (E-Cad) em controles IVM únicos (n = 24) e oócitos aquecidos com vitrificação (n = 40). Os resultados foram normalizados contra o padrão de mRNA de α-globina de coelho exógeno e o gene de manutenção de β-actina e, de forma semelhante, descreveram uma abundância mais baixa da maioria dos mRNAs em oócitos submetidos a procedimentos de vitrificação. Quando normalizados contra o mRNA exógeno padrão, todos os transcritos, exceto para β-actina e H2A.Z, mostraram uma abundância significativamente diferente nas duas classes de oócitos. Os mesmos resultados foram obtidos após a normalização contra o padrão interno, exceto para os transcritos de HSP90β e E-Cad, cuja menor abundância em oócitos aquecidos vitrificados resultou proeminente, mas não significativo (P = 0,083 e P = 0,068, respectivamente). A menor abundância de transcritos de oócitos após a vitrificação pode ser um indicador precoce de má qualidade em boa correlação com os dados de desenvolvimento até o estágio de blastocisto. Mol. Reprod. Dev. 75: 538–546, 2008. © 2007 Wiley-Liss, Inc.


A idade materna avançada altera a expressão de genes de efeito materno que são essenciais para a qualidade do oócito humano

Para investigar os efeitos da idade materna na qualidade dos oócitos, usamos o sequenciamento de RNA de uma única célula para detectar o transcriptoma gênico global e identificar os principais genes afetados pela idade avançada em oócitos humanos maduros. Isolamos mRNA de oócitos maduros obtidos de pacientes de FIV ou ICSI (três oócitos de pacientes mais jovens (≤30 anos) e três oócitos de pacientes mais velhos (≥40 anos) para scRNA-seq. Identificamos 357 genes diferencialmente expressos entre oócitos maduros de mais velhos e mulheres mais jovens. Os genes regulados positivamente foram significativamente enriquecidos com anotações relacionadas à ativação transcricional, estresse oxidativo e função imunológica, enquanto os genes regulados negativamente foram enriquecidos com atividade catalítica. O gene candidato-chave TOP2B foi encontrado por análise de rede de interação de proteínas, e a verificação knockdown em oócitos mais jovens de camundongos maturados mostrou que TOP2B foi um gene-chave que afeta a qualidade do oócito e o desenvolvimento embrionário inicial. Esses resultados contribuirão com novos conhecimentos sobre os mecanismos moleculares do envelhecimento ovário feminino e estabelecerão um critério para avaliação da qualidade dos oócitos em mulheres com idade materna avançada.

Palavras-chave: Envelhecimento do ovário de oócito humano TOP2B scRNA-seq.

Declaração de conflito de interesse

CONFLITOS DE INTERESSES: Os autores declaram não haver conflito de interesses.


Fazer bebês com três pais genéticos é ouvido pela FDA

As tecnologias reprodutivas que casam o DNA de três indivíduos serão julgadas no tribunal da opinião pública esta semana. Essas tecnologias podem ser promissoras para evitar certas doenças geneticamente herdadas transmitidas por meio de mutações às mitocôndrias, a bateria celular.

Os cientistas já tiveram sucesso com esse tipo de abordagem reprodutiva em macacos e em embriões humanos e agora estão ansiosos para lançar testes clínicos em humanos. Primeiro, no entanto, eles devem obter luz verde da Food and Drug Administration dos EUA, que convocará uma audiência pública perante um comitê consultivo em 25 de fevereiro.

A tecnologia, chamada de modificação do oócito (mas às vezes apelidada de & ldquothree-parent IVF & rdquo), envolve retirar DNA mitocondrial potencialmente mutado (mtDNA) de um óvulo de mulher e substituí-lo pelo mtDNA de uma mulher doadora não afetada. O processo é projetado para prevenir a transmissão de algumas doenças mitocondriais hereditárias debilitantes, que podem resultar em perda de visão, convulsões e outras doenças. Essas doenças hereditárias, muitas vezes conhecidas por siglas de nomes médicos complexos que incluem LHON, para Neuropatia Óptica Hereditária de Leber, junto com MELAS, MERRF e NARP, ocorrem em cerca de um em cada 5.000 nascidos vivos e são incuráveis.

Uma vez que o mtDNA foi trocado, o óvulo poderia ser fertilizado no laboratório pelo espermatozóide do pai e o embrião seria implantado de volta na mãe, onde a gravidez continuaria. A criança resultante seria a descendência genética da mãe pretendida, mas carregaria genes mitocondriais saudáveis ​​do doador.

Embora o genoma mitocondrial seja muito pequeno, os próprios genes são reprodutores ávidos, de modo que uma célula individual contém centenas ou milhares de cópias de seu DNA. A taxa de mutação do mtDNA é muito maior do que a do DNA nuclear e esses erros podem causar danos graves a qualquer parte do corpo.

Os cientistas já têm evidências da promessa desse tipo de modificação oocitária. Shoukhrat Mitalipov, da Oregon Health & amp Science University, e seus colegas criaram embriões humanos dessa forma, embora não tenham implantado esses embriões para fazer bebês. Suas descobertas foram publicadas em outubro de 2012 em Natureza. Outro trabalho da mesma equipe também descobriu que em macacos o processo pode levar ao nascimento de uma prole saudável que permanece livre de complicações até a idade adulta. (Americano científico faz parte do Nature Publishing Group).

Um ensaio clínico em humanos seria a próxima fronteira, e Mitalipov diz que já propôs conduzi-lo ao FDA, embora seus detalhes permaneçam confidenciais. Em uma audiência de dois dias a partir de hoje, o comitê consultivo da FDA discutirá amplamente o estado da ciência da modificação de oócitos e como devem ser os ensaios clínicos para procedimentos projetados para modificar óvulos humanos.

Mas adotar esse tipo de abordagem também envolve questões éticas. Marcy Darnovsky, diretora executiva do Centro de Genética e Sociedade, teme que essa abordagem reprodutiva possa em breve levar à adulteração de outras características, como inteligência ou habilidade esportiva. "A vida é cheia de encostas escorregadias e precisamos de freios", diz ela. "Isso é descrito como o de salvar vidas, mas não se destina a pessoas doentes", acrescenta ela. O comitê consultivo do FDA não planeja considerar questões éticas nesta reunião. Em vez disso, ele se concentrará nos aspectos científicos de futuras considerações de ensaios clínicos, incluindo o risco de longo prazo de transmissão de mtDNA anormal, os benefícios e danos potenciais para as mães e futuros filhos e a necessidade de acompanhamento multigeracional em quaisquer ensaios (porque feminino crianças podem transmitir doenças mitocondriais a descendentes futuros). & ldquoNosso trabalho será puramente levar a questão ao público & ldquo, diz Evan Snyder, presidente do comitê e diretor do Programa de Biologia Regenerativa e Células Tronco do Instituto de Pesquisa Médica Sanford & ndashBurnham em La Jolla, Califórnia & ldquoWe & rsquore não vai para sair no final da reunião e dizer que estamos defendendo ensaios clínicos ou qualquer técnica em particular. Isso é educacional ”, diz ele.

Sem a manipulação de oócitos, a principal abordagem atual para tentar contornar as mutações envolve um processo chamado diagnóstico genético pré-implantação, que depende do exame cuidadoso das células embrionárias desde o início. Mas pode ser um mau preditor de mutações do mtDNA. "O problema é que a carga de mutação em uma célula não é preditiva do que está nas outras células", diz Mitalipov. Embora uma célula possa parecer relativamente livre de mutação, as outras ainda podem ter cargas de mutação mais altas porque a mutação não foi eliminada e as células muitas vezes não são uniformes.

O Reino Unido também está lutando contra essas questões ao considerar como proceder com as aplicações terapêuticas da modificação de oócitos. Espera-se que o seu Parlamento aborde a questão este ano. O Nuffield Council on Bioethics, com sede em Londres, considerou as ramificações éticas dessa abordagem e concluiu que, se ela se mostrasse segura e eficaz, e desde que informações e apoio adequados fossem oferecidos, seria ético para as famílias usarem essas técnicas como tratamento para bloquear a transmissão da doença mitocondrial hereditária.

Enquanto isso, os pesquisadores também estão interessados ​​em explorar como & mdashor if & mdashoocyte modification abordagens poderiam ajudar algumas mulheres a superar os problemas de infertilidade. Não há um consenso científico atual sobre se a qualidade e a quantidade do mtDNA afetam a fertilidade, mas alguns pesquisadores se perguntam se existe uma forte ligação entre os dois. A teoria é que talvez o acúmulo de mutações ao longo da vida de uma mulher possa contribuir para o declínio da fertilidade relacionado à idade. “Não acho que seja conclusivo que se trata de mitocôndrias em ação e não outra coisa. Acho que a ciência ainda tem um caminho a percorrer para estabelecer a ligação entre a fertilidade e a função mitocondrial ”, diz Dieter Egli, pesquisador sênior da Fundação de Células-Tronco de Nova York, acrescentando que precisaria ser testado em camundongos ou macacos antes de passar para ensaios em humanos.

Quando se trata de pesquisas mais estabelecidas para a modificação de oócitos e herança genética, "devemos nos concentrar em se o campo está pronto para testes clínicos para aliviar esse horrível sofrimento humano real", diz Snyder.


Materiais e métodos

Neste estudo experimental, todos os produtos químicos e meios foram obtidos da Sigma-Aldrich (St. Louis, MO), salvo indicação em contrário.

Todos os procedimentos foram aprovados pelo Comitê de Ética da Universidade de Ciências Médicas Shahid Beheshti, Teerã, Irã. Os camundongos foram mantidos a 20-28 & # x000b0C com ciclos de 12 horas / 12 horas de luz / escuridão e tiveram livre acesso a comida e água.

Coleta de oócitos

Ratinhos fêmeas B6D2F1 (6 a 8 semanas de idade) foram adquiridos do Instituto Pasteur, Teerão, Irão e superovulados com injecção intraperitoneal de 10 UI de gonadotrofina de soro de égua grávida (PMSG). Após 48 horas, foram administrados 10 UI de gonadotrofina coriônica humana (HCG). Após 14 horas, os complexos cumulus-oócito foram coletados da ampola oviductal em meio de retenção (FHM) com 4 mg / mL de albumina de soro bovino (BSA). Para remover oócitos das células do cumulus, eles foram imediatamente colocados em meio contendo hialuronidase.

Oócitos metafase II (M ..) com morfologia normal, contornos regulares e coloração clara foram selecionados e armazenados em meio simplex otimizado modificado K + (KSOM) a 37 & # x000b0C com 5% de CO2 até a hora da vitrificação.

Em seguida, os oócitos no estádio M .. foram agrupados em três grupos, a saber, grupo controle fresco, grupo vitrificado e grupo de tratamento.

Vitrificação de oócitos de camundongo

Oócitos MII de camundongo foram vitrificados em um procedimento de duas etapas usando o KIT DE Vitrificação KITAZATO (Kitazato Biopharmaceuticals, Japão). Para a vitrificação, o criotopo (Kitazato) foi utilizado como portador. O teste foi realizado por meio de procedimento relatado por Kuwayama (17). Primeiro, os oócitos foram pré-tratados com solução de equilíbrio (ES) consistindo em 7,5% (v / v) de etilenoglicol (EG) e 7,5% (v / v) de dimetilsulfóxido (DMSO) por 9 minutos em temperatura ambiente e, em seguida, transferidos para solução de vitrificação (VS) consistindo em 15% (v / v) EG, 15% (v / v) DMSO e 0,5 M de sacarose. Depois de serem lavados 3 vezes em menos de 60 segundos, quatro a seis oócitos em VS mínimo (& # x0003c1 & # x000b5L) foram transferidos para o transportador criotop. O criotop foi imerso em nitrogênio líquido. Posteriormente, uma tampa de plástico foi colocada sobre o canudo, antes do armazenamento em nitrogênio líquido.

Tratamento com ácido anacárdico em vitrificação

Uma solução 25 - & # x000b5M de AA foi feita em DMSO. Os oócitos foram pré-incubados com 25 & # x000b5M AA em meio KSOM por 40 minutos, depois vitrificados em ES e VS com 25 & # x000b5M AA como segue: no primeiro, os oócitos foram pré-tratados em ES consistindo em 7,5% (v / v) EG e 7,5% (v / v) DMSO durante 9 minutos à temperatura ambiente, e depois colocado em VS consistindo em 15% (v / v) EG, 15% (v / v) DMSO e 0,5 M de sacarose. Após lavagem em menos de 60 segundos, os oócitos foram transferidos para o carreador criotópico e armazenados em nitrogênio líquido.

Descongelamento de oócitos

Oócitos vitrificados foram mantidos em nitrogênio líquido por duas semanas. Os oócitos foram descongelados usando um procedimento de diluição de quatro etapas (Kitazato Biopharmaceuticals, Japão). Resumidamente, a tampa protetora foi removida do criotopo contendo os oócitos e imersa em solução de aquecimento (0,5 M de sacarose a 37 & # x000b0C) por 1 minuto. Em seguida, os oócitos foram colocados em soluções diluentes contendo sacarose 0,25 M por 3 minutos e sacarose 0,125 M por 5 minutos.

Em seguida, os oócitos foram colocados em solução de lavagem sem sacarose por 1 minuto.

Os oócitos foram transferidos para gotículas de meio KSOM após o aquecimento e, em seguida, incubados a 37 & # x000b0C com 5% de CO2 por pelo menos 1 hora. A taxa de sobrevivência de oócitos nos grupos vitrificados e de tratamento foi avaliada após o descongelamento. Posteriormente, os oócitos foram lavados em meio FHM com 4 mg / mL de BSA e, a seguir, preparados para o processo de imunomarcação.

Análise de AcH4K12 de oócitos por coloração imunocitoquímica

Oócitos MII de todos os três grupos foram imunocorados com anticorpo contra AcH4K12 (Abcam, Cambridge, UK, diluição 1: 500). Em cada um dos três grupos, 23 oócitos foram examinados.

O processo de imunomarcação foi realizado conforme descrito anteriormente (18, 19), com pequenas modificações. As amostras foram fixadas por 30 minutos em paraformaldeído a 4% e permeabilizadas usando Triton X-100 a 0,2% em solução salina tamponada com fosfato (PBS) por 1 hora a 4 & # x000b0C. Os oócitos fixados foram bloqueados em PBS contendo BSA a 3% durante 1 hora à temperatura ambiente e incubados com anticorpo primário a 4 & # x000b0C, durante a noite. No dia seguinte, após lavagem extensiva em FHM contendo 0,1% de álcool polivinílico (PVA), os oócitos foram marcados com anticorpo conjugado com isotiocianato de fluoresceína secundária (FITC) (diluição 1: 200) por 1 hora a 37 & # x000b0C. Finalmente, as amostras foram lavadas usando FHM contendo PVA 0,1% e o estado nuclear dos oócitos foi avaliado por coloração com 4 & # x02019,6-diamidino-2-fenilindol (DAPI, 10 & # x000b5g / mL) por 1 minuto em temperatura ambiente em o escuro. As amostras foram montadas em lâminas após lavagem extensa. A fluorescência foi monitorada por um microscópio de epifluorescência (Nikon, Japão) com filtros UV (371 nm). Para estudar a acetilação do H4K12, as fotografias foram analisadas por meio do software ImageJ (Versão 1.45S, National Institutes of Health, EUA). No grupo de controle negativo, as células não foram incubadas com o anticorpo primário.

Extração simultânea de RNA e síntese de cDNA

Os oócitos de todos os três grupos (isto é, grupos de controle, vitrificados e de tratamento) foram colocados em tubos Eppendorf contendo tampão de lise 1,5 & # x000b5L (20). Both Reverse Transcription (RT) and PCR were performed on an applied thermocycler (Bio-Rad, Hercules, CA). Afterwards, 2 µL random hexamer and 5 µL water were added to each 2 µL of oocyte sample, which were then transferred to the thermocycler for 5 minutes at 75ଌ. Next, the tubes were placed on ice, and 5X RT Buffer, 200 U/µl RT Enzyme, 10 mM dNTP, and 10 U/µl RNase inhibitor were added to the reaction mixture.

In order to perform the reverse transcription step, the amplification program was followed at 25ଌ for 10 minutes, at 37ଌ for 15 minutes, at 42ଌ for 45 minutes and at 72ଌ for 10 minutes. After completion of the reverse transcriptase reaction, the samples were kept at 4ଌ, overnight Then, to each sample PCR mixture containing 1.25 µL Taq Polymerase, 20.75 µL Master Mix 2 µL cDNA and 2 µL specific primer, was added ( Table 1 ).

Tabela 1

Primer sequences used in reverse transcription polymerase chain reaction (RT-PCR) and real time quantitative PCR

Entrez gene symbolGene nameAccession numberPrimer sequence (5´-3 ´ )Product length (bp)
Hat1Histone acetyltrasnferase1 <"type":"entrez-nucleotide","attrs":<"text":"NM_026115.4","term_id":"209954845","term_text":"NM_026115.4">> NM_026115.4F: TATGGCAATACAGGCACAGC102
R: TCAGCATCGCTCATGTCAG
Hdac1Histone deacetylases1 <"type":"entrez-nucleotide","attrs":<"text":"NM_008228.2","term_id":"118130866","term_text":"NM_008228.2">> NM_008228.2F: GGCATTGACGACGAATC157
R: TGGCGTGTCCTTTGATG
Hprt1Hypoxanthine Phosphoribosyltransferas1 <"type":"entrez-nucleotide","attrs":<"text":"NM_013556.2","term_id":"96975137","term_text":"NM_013556.2">> NM_013556.2F: TCCCAGCGTCGTGATTAG138
R: CGAGCAAGTCTTTCAGTCC

The endogenous control, Hypoxanthine Phosphoribosyltransferase 1 (Hprt1), Hat1 and Hdac1 genes were used with initial denaturation at 94ଌ for 5 minutes followed by denaturation at 94ଌ for 15 seconds, annealing at 60ଌ for 30 seconds and extension at 72ଌ for 45 seconds repeated for 35 cycles. Final elongation step was performed at 72ଌ for 7 minutes. The mixture of 10 µL of PCR product with 1 mL loading buffer was electrophoresed on 2% agarose gel in TAE (Tris-acetate- EDTA) for 25 minutes. The products were visualized under shortwave UV.

Real-time quantitative polymerase chain reaction

To assess the expression levels of Hat1 e Hdac1 genes, real-time quantitative PCR was performed by using Rotor-Gene Q instrument (QIAGEN). A total volume of 13 µL DNA Master SYBR Green I mix (Roche Applied Sciences) was used for real-time PCR according to the manufacturer’s instructions.

For each gene, 1 µM of primer was added ( Table 1 ). The PCR procedure was done as follows: 5 seconds at 95ଌ, 3 minutes at 95ଌ for denaturation, 15 seconds at 60ଌ, 10 seconds at 72ଌ for amplification and 40 cycles of extension. The specificity of all individual amplification reactions was confirmed by melting curve analysis. Hprt1 was used as the housekeeping gene. Three replications were performed and the expression of target mRNA was normalized against Hprt1.

Análise estatística

Data analyses were performed using SPSS Ver.20 (SPSS, Chicago, IL, USA). Means of fluorescent intensity of epigenetic markers were compared by nonparametric Mann- Whitney test. The relative levels of mRNA were analyzed by REST 2009 Software (QIAGEN). Data are expressed as means ± SD. P=0.05 and P=0.001 were considered significant and all experiment were performed at least in triplicates.


Introdução

Cryopreservation technology applied to mammalian embryos of livestock such as cattle, goats, sheep, and other model animals has led to many successful developments since the 1980s (see [ 1] for a review). This, however, is not the case regarding cryopreservation of porcine embryos, which has faced many challenges over the years (see [ 2] for a review).

It has only fairly recently become feasible to produce progeny from frozen porcine embryos [ 2– 5], although the highly variable cryotolerance of pig embryos over the developmental stages has limited applications for embryos at certain developmental stages [ 2, 6]. Porcine embryos at the perihatching stage are known to be most resistant to freezing [ 6, 7], and their cryopreservation by the conventional freezing method has successfully led to offspring production [ 2, 8]. Conventional freezing, however, has been plagued by a low survival rate in that after thawing, even perihatching-stage embryos showed poor survival, at about 30% [ 2].

Vitrification has improved the survival rate of perihatching-stage porcine embryos subsequent to cryopreservation (see [ 9] for a review). Moreover, technological improvements have led to higher survival rates in porcine morulae and early blastocysts, which are notoriously sensitive to damage by conventional freezing [ 10]. This technique has been further improved to achieve more stable vitrification using the open pulled straw [ 11] and minimum volume cooling (MVC) [ 12] methods such that higher embryo viability is provided [ 13].

In an effort to improve survival after cryopreservation, alternative approaches have been directed at increasing cryotolerance of porcine embryos. Nagashima et al. [ 14, 15] showed that delipation, which removes cytoplasmic lipid droplets in embryos, remarkably improves embryo viability following cryopreservation. And since then, the transfer of delipated porcine morulae and blastocysts was demonstrated to provide a practically feasible birth rate after cryopreservation [ 16, 17].

These advancements in cryopreservation of porcine embryos have been successful only for in vivo-derived embryos, whereas in recent pig cloning research, an in vitro-matured (IVM) oocyte is usually employed [ 18– 22], as is also the case with transgenic pig production [ 23] and in vitro fertilization [ 24]. Because improvements in cryopreservation technology of in vitro-produced (IVP) embryos will further facilitate studies on pig cloning and the establishment of a gene bank of transgenic pigs, it is necessary to establish cryopreservation technology for embryos derived from IVM oocytes. Successful cryopreservation of IVP embryos, however, remains elusive.

These considerations led to the present study, which describes a cryopreservation method for IVP porcine embryos. As a model, we used embryos that were parthenogenetically developed from IVM oocytes. Postvitrification viability of embryos at the perihatching stage was first investigated due to their high resistance to cryopreservation, after which embryos were vitrified at the early cleavage stages with the future intent to transfer IVP embryos to the recipient’s oviduct. We also report on the effect of delipation on cryotolerance of IVP porcine embryos, and on the successful vitrification of porcine IVP embryos, which were delipated by a newly developed noninvasive method.


Opinion: Three-Parent Embryos—A Slippery Slope?

John D. Loike and Alan Kadish
Jun 14, 2018

ISTOCK, VCHAL John D. Loike, a Professor of Biology at Touro College and University Systems, writes a regular column on bioethics for O cientista.

O n June 7, news reports emerged that Valery Zukin, director of Nadiya Clinic of Reproductive Medicine in Ukraine, and his colleagues had created four children from &ldquoinfertile&rdquo older women using DNA obtained from three different parents. The technique, called pronuclear transfer, has entered clinical trials in the U.K. to help fertile women with devastating mitochondrial DNA (mtDNA) mutations to have healthy babies, but not to treat infertility. It&rsquos our position that it is premature to apply pronuclear transfer to treat infertile women for both scientific and ethical reasons until more clinical research has been performed on women with mtDNA mutations.

In pronuclear transfer, a man&rsquos sperm is used to generate two fertilized eggs: one obtained from his female partner who.

On several occasions, the US Food and Drug Administration (FDA) issued warnings about using DNA from three parents in clinical trials. The FDA and other groups highlight many ethical challenges associated with mitochondrial transfer (MRT). For example, will MRT actually produce a healthy child resulting from the mixing of two women’s DNA in a single egg? Secondly, how would the addition of a third genetic parent affect the parental identity of the child? Marcy Darnovsky, head of the Center for Genetics and Society, also expressed concern that this technology will lead physicians to slide down a slippery slope toward the creation of designer babies that incorporate “foreign genes” to enhance intelligence or athleticism.

Zukin’s effort is the first recorded case where pronuclear transfer has been successfully used to allow an infertile couple to have a child. However, in 1998, mitochondrial transfer was reportedly performed in infertile women in the U.S. using another technique called cytoplasmic mitochondrial transfer. Donor oocyte–derived cytoplasm containing mtDNA is directly injected into a patient’s oocytes to treat an infertility case of insufficient embryonic development. In total, about 17 live births were reported in the U.S. using this technique. However, because there were multiple severe side effects in some of the babies born, the FDA decided to stop these studies.

From an ethical perspective, the use of pronuclear transfer for infertile women and for women with mitochondrial mutations has a common, beneficent objective: to allow women to have healthy children. We believe the problem in using this technique for infertile women is that until researchers explore and document the efficacy and potential side effects of pronuclear transfer in women with mitochondrial mutations, it seems scientifically premature to apply this procedure to other medical conditions such as infertility.

The ethical concern that this technology is heading down a slippery slope toward “designer babies” may not be as justified as the public may believe. In 1978, when the first “test-tube baby” was born, similar fears were raised about using in vitro fertilization (IVF) to create designer babies. Since then, there have been almost 6 million babies born via IVF without any reported evidence of its use to create designer babies. Perhaps in some situations society possesses a moral compass to regulate the application of biotechnologies. We believe that this moral compass will apply to pronuclear transfer and gene editing to restrict its applications to medical conditions. Thus, continuing research in using pronuclear transfer for women with mtDNA mutations is ethically sound. Because there are a variety of new technologies that can be used to help infertile women, society should be patient in applying pronuclear transfer to infertility until we learn more about its potential risks.

One must also keep in mind that there are other methods to transfer healthy mitochondrial DNA into an embryo (for example, spindle nuclear transfer, nuclear genome transfer, and polar body genome transfer) that should also be rigorously and carefully examined with federally funded research. Interestingly, spindle nuclear transfer (SNT) was applied to an infertile, older couple to produce a baby in Mexico in 2016. In SNT, DNA from the mother’s egg is removed and transferred into a donor egg stripped of its own nucleus. The resulting reconstituted egg is fertilized with the father’s sperm and then implanted into the mother’s womb to create a child. The ethical advantage of SNT over pronuclear transfer is that the sperm of the father is only used to fertilize one oocyte. The destruction of a nonfertilized oocyte is less ethically challenging that the destruction of a fertilized oocyte. We should, therefore, consider researching the use of SNT for women with mitochondrial mutations.

In addition to the problem of which technology to use, another unresolved issue is both bioethical and legal in nature. Who are the parents of the child born from three DNA donors? Some ethicists have argued that because the mtDNA represents less than 0.1 percent of the human genes, it should not play a role in determining parenthood. Other ethicists claim that without mtDNA no fetus could survive and therefore its critical role in forming a fetus justifies granting parenthood status to the donor of the mitochondria. I believe that one way to manage this issue is to have the three individuals involved in creating the embryo sign a legal document before engaging in this protocol designating the legal parents of the child. Such a document could be designed to prevent the child from knowing and identifying the source of his or her mtDNA.

As society continues to develop innovative techniques in genomic manipulation and editing, it is important to recognize and balance the positive medical outcomes with the potential negative ethical falllout. We need to research mitochondrial transfer in women with mtDNA mutations with caution and under ethical governmental guidelines.

John D. Loike is Professor of Biology at Touro College and University Systems, of which Alan Kadish é President.

Correction (August 15): There are no ongoing clinical trials of pronuclear transfer in Singapore as the first paragraph originally stated. O cientista lamenta o erro.


Assista o vídeo: GENÉTICA NO VESTIBULAR: LEIS DE MENDEL, GENES, DNA E CROMOSSOMOS. QUER QUE DESENHE? (Dezembro 2021).