Em formação

Sequências de referências de DNA ribossomal


Estou tendo problemas para pesquisar esta informação. Estou fazendo um estudo relacionado à suscetibilidade filogenética de hospedeiros a patógenos (com base em uma publicação recente da Nature), especificamente à gripe. Isso requer conhecer o referência Sequência de DNA ribossômico 18S para galinhas, patos selvagens, cavalos, porcos e humanos (entre outros). Existe um recurso que nos permite fazer o download deles facilmente?


Para pássaros, você pode começar pesquisando 18s em http://birdgenenames.org/cgnc/

Mas, geralmente, o banco de dados de Nucleotídeos do NCBI deve fornecer todas as informações e números de acesso. Veja esta pesquisa ampla: http://www.ncbi.nlm.nih.gov/nuccore/?term=18S+ribosomal+RNA+gene

Adicionando especificações de espécies e outros parâmetros, você pode encontrar o que está procurando. Por exemplo, consulte o gene de RNA ribossômico 18S de frango


Posso estar me precipitando aqui, mas presumindo que você não tenha pesquisado o NCBI ou o conjunto, faria isso primeiro.

Essencialmente, todas as informações genômicas são mantidas por uma colaboração entre o US NIH, EU EBI e o Japão. Todos os bancos de dados são sincronizados entre si e, portanto, os dados devem (teoricamente) ser os mesmos (na prática, nunca são). Eu sugiro que você escolha um servidor e se atenha a ele.

No meu laboratório, preferimos usar o NCBI, mas isso difere de laboratório para laboratório.

Você pode pesquisar NCBI seguindo o tutorial aqui (http://www.ncbi.nlm.nih.gov/guide/howto/find-published-info-gene-sequence/) ou ensembl bu seguindo o tutorial aqui (http: / /www.ebi.ac.uk/training/online/course/ensembl-browsing-chordate-genomes/how-search-ensembl)

Um exemplo de pesquisa por frango fornece isso (http://www.ncbi.nlm.nih.gov/gene/100861561) com três entradas para DNA genômico e uma para mRNA. Eu escolheria uma sequência completa em vez de uma sequência parcial.

Você também pode querer pesquisar na ajuda deles o significado de cds (sequência de codificação; você a encontrará)


Confiabilidade taxonômica de sequências de DNA em bancos de dados de sequências públicas: uma perspectiva fúngica

As sequências de DNA são cada vez mais vistas como uma das principais fontes de informação para a identificação de espécies em muitos grupos de organismos. Tais abordagens, popularmente conhecidas como código de barras, são sustentadas pela suposição de que os bancos de dados de referência usados ​​para comparação são suficientemente completos e apresentam entradas anotadas de forma correta e informativa.

Metodologia / Principais conclusões

O presente estudo usa um grande conjunto de sequências de DNA de fungos do banco de dados internacional de sequências de nucleotídeos para mostrar que a amostragem de táxons de fungos está longe de ser completa, que cerca de 20% das entradas podem ser identificadas incorretamente em nível de espécie e que a maioria de entradas não têm anotações descritivas e atualizadas.

Conclusões

Os problemas com confiabilidade taxonômica e anotações insuficientes em repositórios públicos de DNA formam um obstáculo tangível para a identificação de espécies baseada em sequência, e é manifesto que os maiores desafios para o código de barras biológico serão de natureza taxonômica, ao invés de técnica.

Citação: Nilsson RH, Ryberg M, Kristiansson E, Abarenkov K, Larsson K-H, Kõljalg U (2006) Taxonomic Reliability of DNA Sequences in Public Sequence Databases: A Fungal Perspective. PLoS ONE 1 (1): e59. https://doi.org/10.1371/journal.pone.0000059

Editor Acadêmico: Cecile Fairhead, Pasteur Institute, França

Recebido: 16 de outubro de 2006 Aceitaram: 26 de outubro de 2006 Publicados: 20 de dezembro de 2006

Direito autoral: © 2006 Nilsson et al. Este é um artigo de acesso aberto distribuído sob os termos da Licença de Atribuição Creative Commons, que permite o uso irrestrito, distribuição e reprodução em qualquer meio, desde que o autor original e a fonte sejam creditados.

Financiamento: Este trabalho foi apoiado pelas fundações de Helge Axe: filho Johnson, Wilhelm e Martina Lundgren, e Lars Hierta.

Interesses competitivos: Os autores declararam que não existem interesses conflitantes.


Resumo

O sequenciamento ambiental expandiu enormemente nosso conhecimento da diversidade e ecologia micro-eucariótica, revelando linhagens até então desconhecidas e sua distribuição. No entanto, o valor desses dados é criticamente dependente da qualidade dos bancos de dados de referência usados ​​para atribuir uma identidade às sequências ambientais. Os bancos de dados existentes contêm erros e lutam para acompanhar a rápida mudança da taxonomia eucariótica, o influxo de nova diversidade e os desafios computacionais relacionados à montagem de alinhamentos e árvores de alta qualidade necessários para a caracterização precisa da diversidade de linhagens. EukRef (eukref.org) é uma iniciativa contínua voltada para a comunidade que aborda esses desafios, reunindo taxonomistas com experiência que abrange a árvore da vida eucariótica e ecologistas microbianos, que usam dados de sequência ambiental para desenvolver bancos de dados de referência confiáveis ​​em toda a diversidade de eucariotos microbianos. EukRef organiza e facilita a mineração rigorosa e anotação de dados de sequência, fornecendo protocolos, diretrizes e ferramentas. O pipeline de EukRef e as ferramentas permitem que os usuários interessados ​​em um determinado grupo de eucariotos microbianos recuperem todas as sequências pertencentes a esse grupo da Colaboração do Banco de Dados de Sequência de Nucleotídeos Internacional (INSDC) (GenBank, Arquivo Europeu de Nucleotídeos [ENA] ou Banco de Dados de DNA do Japão [ DDBJ]), para colocar essas sequências em uma árvore filogenética e para curar informações taxonômicas e ambientais para o grupo. Fornecemos diretrizes para facilitar o processo e padronizar as anotações taxonômicas. Os resultados finais desse processo são (1) uma árvore de referência e alinhamento, (2) um banco de dados de sequência de referência, incluindo informações taxonômicas e ambientais, e (3) uma lista de supostas quimeras e outras sequências artificiais. Esses produtos serão úteis para a ampla comunidade à medida que se tornam publicamente disponíveis (em eukref.org) e são compartilhados com bancos de dados de referência existentes.

Citação: del Campo J, Kolisko M, Boscaro V, Santoferrara LF, Nenarokov S, Massana R, et al. (2018) EukRef: curadoria filogenética de RNA ribossomal para melhorar a compreensão da diversidade e distribuição eucariótica. PLoS Biol 16 (9): e2005849. https://doi.org/10.1371/journal.pbio.2005849

Publicados: 17 de setembro de 2018

Direito autoral: © 2018 del Campo et al. Este é um artigo de acesso aberto distribuído sob os termos da Creative Commons Attribution License, que permite o uso irrestrito, distribuição e reprodução em qualquer meio, desde que o autor original e a fonte sejam creditados.

Financiamento: Fundação Gordon e Betty Moore moore.org. Recebido por JdC e LWP. National Science Foundation www.nsf.gov (número de concessão 1545931). Recebido por MB, JdC e LWP. Protistologists.org da Sociedade Internacional de Protistologistas. Recebido por JdC e LWP. Fundação Tula tula.org. Recebido por JdC, VB, MK e PJK. Comissão Europeia de Ações Marie Skłodowska-Curie https://ec.europa.eu/research/mariecurieactions/ (concessão número FP7-PEOPLE-2012-IOF -331450 CAARL). Recebido por JdC. Academia Tcheca de Ciências, Bolsa Purkyne da República Tcheca. Recebido por MK. Fundo Europeu de Desenvolvimento Regional http://ec.europa.eu/regional_policy/en/funding/erdf/ (subvenção número CZ.02.1.01 / 0.0 / 0.0 / 16_019 / 0000759CePaViP). Recebido por MK. National Science Foundation www.nsf.gov (número de concessão OCE1435515). Recebido por LS. Investissements d’Avenir (concessão número ANR-11-BTBR-0008OCEANOMICS). Recebido por CB e CdV. NSERC-DG http://www.nserc-crsng.gc.ca/. Recebido por LWP. Os financiadores não tiveram nenhum papel no desenho do estudo, coleta e análise de dados, decisão de publicar ou preparação do manuscrito.

Interesses competitivos: Os autores declararam que não existem interesses conflitantes.

Abreviações: DDBJ, DNA DataBank of Japan EBI, European Bioinformatics Institute ENA, European Nucleotide Archive EnvO, Environment Ontology HTES, sequenciamento ambiental de alto rendimento INSDC, International Nucleotide Sequence Database Collaboration MAST, stramenopiles marinhos MIxS, Minimum Information about any (x) Sequence NCBI, Centro Nacional de Informações sobre Biotecnologia OTU, unidade taxonômica operacional PR 2, Protist Ribosomal Reference Database SAR, Stramenopiles, Alveolates e Rhizaria SSU rRNA, gene de RNA ribossômico de subunidade pequena 18S rRNA, gene de RNA ribossômico de subunidade pequena eucariótica


Uma revisão do uso de DNA ribossômico (rDNA) para diferenciar entre os crípticos Anopheles espécies

Complexos crípticos de espécies são grupos de espécies intimamente relacionadas que são difíceis ou impossíveis de distinguir por traços morfológicos. Esses complexos são conhecidos por uma ampla variedade de artrópodes e são comuns entre os insetos medicamente importantes bem estudados. Por exemplo, muitos dos vetores anofelinos dos parasitas da malária são membros de complexos de espécies crípticas. Os complexos normalmente incluem espécies de vetores e não vetores, e duas ou mais espécies membros são freqüentemente encontradas simpatricamente. Até o final dos anos 1950, apenas dois desses Anopheles complexos eram conhecidos, o A. gambiae complexo da África e do A. maculipennis complexo da Europa. Hoje, dezenas de Anopheles complexos crípticos de espécies são reconhecidos, e evidências acumuladas sugerem que os vetores da malária mais importantes são provavelmente membros de tais complexos.

Uma variedade de métodos foi desenvolvida para identificar as espécies de espécimes individuais desses complexos, embora até recentemente apenas aqueles baseados em alozimas específicas de espécies e inversões de cromossomos politênicos fossem amplamente usados. As limitações inerentes a esses métodos foram contornadas com procedimentos baseados em DNA, que são especialmente úteis porque ambos os sexos e todos os estágios de desenvolvimento podem ser identificados, e o DNA pode ser recuperado de amostras armazenadas por uma ampla variedade de métodos simples. Várias técnicas de identificação baseadas em DNA foram desenvolvidas, incluindo ensaios de hibridização baseados em sequências de repetição específicas de espécies e fragmentos de PCR de diagnóstico produzidos pelo uso de iniciadores de PCR aleatórios ou pela amplificação de DNA com iniciadores baseados em sequências específicas de espécies conhecidas. Nesta revisão, discutimos os méritos relativos de diferentes métodos de identificação de espécies crípticas, com ênfase no uso de DNA ribossomal como um alvo para ensaios de PCR para diagnóstico de espécies.


Sequências específicas de DNA ribossômico de diversos ambientes ambientais se correlacionam com contaminantes experimentais

A análise filogenética de clones de DNA ribossomal 16S (rDNA) obtidos por PCR de bactérias não cultivadas que habitam uma ampla gama de ambientes aumentou nosso conhecimento sobre a diversidade bacteriana. Um possível problema na avaliação da diversidade bacteriana com base na informação da sequência é que a PCR é extremamente sensível à contaminação do rDNA 16S. Isso levanta a possibilidade de que algumas sequências de rRNA ambientais putativas correspondam de fato a sequências contaminantes. Para documentar potenciais contaminantes, clonamos e sequenciamos fragmentos de rDNA 16S amplificados por PCR obtidos em níveis baixos na ausência de DNA modelo adicionado. Sequências de rDNA 16S intimamente relacionadas aos gêneros Duganella (anteriormente Zoogloea), Acinetobacter, Stenotrophomonas, Escherichia, Leptothrix, e Herbaspirillum foram identificados em bibliotecas de contaminantes e em bibliotecas de clones de diversos habitats, geralmente de baixa biomassa. As sequências de rRNA detectadas possivelmente são contaminantes comuns em reagentes usados ​​para preparar DNA genômico. Consequentemente, sua detecção em amostras ambientais processadas pode não refletir organismos ambientalmente relevantes.

O conhecimento da diversidade microbiana aumentou dramaticamente nos últimos anos, em parte como resultado do sequenciamento de genes de rRNA do DNA obtido diretamente da microbiota não cultivada, muitas vezes pelo uso de PCR e primers específicos de rRNA (2, 21). Esta abordagem foi aplicada para avaliar a diversidade microbiana em uma variedade de ambientes, por exemplo, tundra ártica (34), subsuperfícies marinhas profundas (27), fontes termais de Yellowstone (14), turfeiras (26) e infecções humanas (9 , 12, 17). Embora a abordagem tenha produzido uma coleção diversificada de sequências e expandido nossa visão da diversidade microbiana, a análise de sequências de DNA ribossômico 16S microbiano (rDNA) tem limitações em relacionar sequências de rDNA específicas a organismos no ambiente em estudo e está repleta de artefatos potenciais.

Um artefato potencial na aplicação da PCR à análise da comunidade é a possível introdução de rDNA contaminante durante os procedimentos experimentais, particularmente nas etapas anteriores à PCR. No decurso da compilação de sequências de rDNA 16S ambientais, observamos algumas sequências altamente semelhantes (& # x0003e99 & # x00025) que são obtidas de muitos ambientes física e quimicamente distintos. Os organismos representados por essas sequências podem de fato prevalecer em ambientes tão diversos. No entanto, a dificuldade em preparar DNA genômico absolutamente livre de DNA contaminante, juntamente com a sensibilidade requintada de PCR para amplificar DNA alvo traço, tornam a contaminação um problema sério, particularmente com amostras de baixa biomassa (16, 18, 28, 29). Relatamos aqui um levantamento de sequências de rDNA 16S obtidas de controles de extração negativos, ou seja, extração e purificação de DNA realizadas sem adição de amostra, e a correspondência dessas sequências com algumas recuperadas de diversos ambientes ambientais.

Nós pesquisamos as sequências de rDNA 16S de 96 clones derivados de um produto de PCR resultante de uma extração de controle que não continha uma amostra ambiental. Análises menos extensas foram conduzidas com controles negativos processados ​​independentemente. A extração foi realizada da mesma maneira que com amostras autênticas contendo DNA genômico, usando lisozima, proteinase K, dodecilsulfato de sódio, batimento de esferas e tratamento com fenol como descrito em outro lugar (4). Os detalhes foram os seguintes: o tampão A consistia em 200 mM de Tris HCl (pH 8,0), 200 mM de NaCl e 20 mM de EDTA, batimento de contas (0,5 g de contas lavadas com ácido) foi realizado por 2 min em baixa velocidade e 0,5 min em alta velocidade, e os ácidos nucleicos foram precipitados de NaCl 300 mM e 3 volumes de etanol 100 & # x00025. Todas as soluções foram preparadas com autoclavado, filtrado (filtro de tamanho de poro de 0,2 - & # x003bcm, Sterile Acrodisc Gelman Sciences) ddH2O antes de usar. Embora algumas pequenas bactérias pudessem passar potencialmente pelos poros do filtro de 0,2 - & # x003bcm, um controle negativo na ausência de qualquer modelo, ou seja, sem o material de controle de extração negativo, resultou em nenhum produto de PCR após 40 ciclos. Todos os procedimentos de extração de DNA e manipulações foram realizados em uma capela de fluxo laminar para minimizar a contaminação aérea. A amostra foi dissolvida em 200 & # x003bcl de água e 100 - & # x003bcl PCRs foram realizados com 1 & # x003bcl de modelo (40 ciclos de PCR touchdown, consistindo em 20 ciclos de 1 min a 94 & # x000b0C, 40 s começando em 67 & # x000b0C e diminuindo em 1 & # x000b0C / ciclo e 1 min a 72 & # x000b0C e 20 ciclos de 1 min a 94 & # x000b0C, 1 min a 50 & # x000b0C e 1,5 min mais 1 s / ciclo a 72 & # x000b0C). Cinco unidades de Ampli Taq Ouro (Perkin-Elmer) foi adicionado por 100 & # x003bcl de mistura de reação. Iniciadores específicos para bactérias foram usados ​​para a amplificação (27F, AGAGTTTGATCCTGGCTCAG e 805R, GACTACCAGGGTATCTAATCC). Esses primers correspondem à maioria das sequências no domínio Bactérias na região alvo do primer. Três produtos de reação 100 - & # x003bcl foram precipitados com etanol e a amostra inteira foi resolvida por eletroforese em gel de agarose. Mesmo com essas precauções, produtos de PCR do tamanho de rDNA foram obtidos após longas rodadas de ciclos térmicos. Os produtos de PCR de tamanho de rDNA foram eluídos do gel e clonados, e 96 clones foram analisados ​​por polimorfismos de comprimento de fragmento de restrição (RFLP) usando as enzimas Mspeu e HinP1I conforme detalhado por Hugenholtz et al. (14). Vinte tipos diferentes de RFLP foram identificados e sequenciados. As sequências de rDNA 16S (460 a 780 nucleotídeos & # x0005bnt & # x0005d) foram comparadas a sequências conhecidas usando o algoritmo de busca BLAST com lacuna (1, 5) e foram alinhadas a parentes próximos usando o editor de alinhamento GDE (19). As sequências de rDNA 16S foram colocadas em uma árvore filogenética contendo mais de 7.000 sequências de rDNA bacterianas usando o pacote de software ARB (30).

A análise dos clones do controle de extração negativo revelou uma coleção diversa de sequências contaminantes. Vimos sequências semelhantes em outras análises de rDNAs contaminantes. Sequências 16S rDNA essencialmente idênticas às sequências de controle negativo também foram encontradas por uma série de laboratórios em bibliotecas de clones de uma ampla diversidade de ambientes, conforme resumido na Tabela & # x200B Tabela1. 1 Sequências adicionais do controle negativo, não relatadas nas análises ambientais, estão relacionadas aos rDNAs dos seguintes organismos: Micrococcus luteus (Identidade 98 e # x00025 para MT2), Pseudomonas aeruginosa (Identidade 99 & # x00025 para MT5), um Afipia sp. (Identidade 97 e # x00025 para MT8), Variovorax paradoxus (Identidade 97 e # x00025 para MT11), Gemella haemolysans (Identidade 100 e # x00025 para MT1), Shigella Boydii (Identidade 99 & # x00025 para MT19), e Phyllobacterium myrsinacearum (Identidade 99 e # x00025 para MT17). Algumas sequências eram & # x0003c95 & # x00025 idênticas às de organismos conhecidos. Uma compilação de sequências obtidas de bibliotecas de controle negativo está disponível em nosso site em http://crab2.berkeley.edu/pacelab/177.htm. Este site será atualizado conforme sequências adicionais são determinadas a partir de bibliotecas de controle negativo. As inscrições são bem-vindas.

TABELA 1

Distribuição de clones contaminantes com representantes de estudos ambientais & # x02009

Clone (s) do controle negativoAmbiente e clone & # x0003e98 & # x00025 idêntico ao clone de controle negativo (referência)GenBank no.Organismo mais intimamente relacionado& # x00025 Identidade a
MT3Bentonita / subsuperfície de areia, Canadá, clone K13 (22) <"type": "entrez-nucleotide", "attrs": <"text": "X91528", "term_id": "987803", "term_text": "X91528" >> X91528Stenotrophomonas maltophilia96.7
Drenagem ácida de mina, clone TRA2-7 (11) <"type": "entrez-nucleotide", "attrs": <"text": "AF047649", "term_id": "2944372", "term_text": "AF047649" >> AF047649
MT6Bentonita / subsuperfície de areia, Canadá, clone K9 (22) <"type": "entrez-nucleotide", "attrs": <"text": "X91524", "term_id": "987799", "term_text": "X91524" >> X91524Acinetobacter sp. DSM59099.7
Sedimento marinho profundo, clone JAP752 (27) <"type": "entrez-nucleotide", "attrs": <"text": "U09828", "term_id": "495561", "term_text": "U09828" >> U09828
Água subterrânea / subsuperfície em & # x000c4sp & # x000f6 hard rock lab, Suécia, clone A24otpmn (23) <"type": "entrez-nucleotide", "attrs": <"text": "X91447", "term_id": "1217616", "term_text": "X91447" >> X91447
Águas subterrâneas graníticas profundas, mina de pesquisa Stripa, Suécia, clone Grupo III (10) <"type": "entrez-nucleotide", "attrs": <"text": "L20812", "term_id": "999472", "term_text": "L20812" >> L20812
MT9Bentonita / subsuperfície de areia, Canadá, clone K16 (22) <"type": "entrez-nucleotide", "attrs": <"text": "X91531", "term_id": "987806", "term_text": "X91531" >> X91531Escherichia coli98.0
Prostatite, clone 5725 (17)NA b
MT14, CMT35PÁgua subterrânea / subsuperficial, Gabão, África, clone G4 (24) <"type": "entrez-nucleotide", "attrs": <"text": "X91175", "term_id": "984098", "term_text": "X91175" >> X91175Leptothrix cholodnii96.5
Pulmão de cobaia infectado, clone GPMT16 (31) <"type": "entrez-nucleotide", "attrs": <"text": "AF058793", "term_id": "3075486", "term_text": "AF058793" >> AF058793
Drenagem ácida de mina, clone TRB32 (11) <"type": "entrez-nucleotide", "attrs": <"text": "AF047647", "term_id": "2944370", "term_text": "AF047647" >> AF047647
MT18, CTHB-18Bentonita / subsuperfície de areia, Canadá, clone K11 (22) <"type": "entrez-nucleotide", "attrs": <"text": "X91526", "term_id": "987801", "term_text": "X91526" >> X91526Duganella zoogloeoides (anteriormente Zoogloea ramigera)99.8
Sedimento marinho profundo, clone JAP405 (27) <"type": "entrez-nucleotide", "attrs": <"text": "U09778", "term_id": "495530", "term_text": "U09778" >> U09778
Drenagem ácida de mina, clone AMDke9.1 (11)N / D
Antártico, clone BP-S155 (11)N / D
Areia basáltica subterrânea profunda, clone BS43 (11)N / D
Fonte termal de Yellowstone, clone OPS122B (14) <"type": "entrez-nucleotide", "attrs": <"text": "AF026984", "term_id": "2746093", "term_text": "AF026984" >> AF026984
Solo de tundra siberiana, clone S-41 (34) <"type": "entrez-nucleotide", "attrs": <"text": "AF016752", "term_id": "2323510", "term_text": "AF016752" >> AF016752
Abscesso dentoalveolar (amostra de pus), clone PUS 10.40 (9) <"type": "entrez-nucleotide", "attrs": <"text": "U34035", "term_id": "1039429", "term_text": "U34035" >> U34035
Aqüífero contaminado, clone WFeA1-06 (8) <"type": "entrez-nucleotide", "attrs": <"text": "AF050528", "term_id": "2967704", "term_text": "AF050528" >> AF050528
Água subterrânea / subsuperficial, Gabão, África, clones G22 e G41 (24) <"type": "entrez-nucleotide", "attrs": <"text": "X91274", "term_id": "987022", "term_text": "X91274" >> X91274
Solo havaiano, clone HRS-17 (20) <"type": "entrez-nucleotide", "attrs": <"text": "AF016530", "term_id": "2702342", "term_text": "AF016530" >> AF016530
Ambiente redutor de húmico, isolado molecular de um produto de PCR (6) <"type": "entrez-nucleotide", "attrs": <"text": "AF019941", "term_id": "2443651", "term_text": "AF019941" >> AF019941
Pulmão de cobaia, clone MTseq15 (31) <"type": "entrez-nucleotide", "attrs": <"text": "AF058388", "term_id": "3065808", "term_text": "AF058388" >> AF058388
Mycobacterium tuberculosisporquinho-da-índia infectado, pulmão, clone GPMT3 (31) <"type": "entrez-nucleotide", "attrs": <"text": "AF058387", "term_id": "3065807", "term_text": "AF058387" >> AF058387
MT22Pântano de turfa de baixo pH, clones TM221 e TM252 (26) <"type": "entrez-nucleotide", "attrs": <"text": "X97095", "term_id": "1805658", "term_text": "X97095" >> X97095Herbaspirillum seropedicae98.6
Sedimento da baía de Carolina, clones RB-06 e RB-37 (33) <"type": "entrez-nucleotide", "attrs": <"text": "U62830", "term_id": "1498401", "term_text": "U62830" >> U62830

Vários clones contaminantes e numerosos clones ambientais de diversos ambientes estão intimamente relacionados aos rDNAs do gênero Duganella (anteriormente Zoogloea) Tais organismos (& # x003b2-proteobacteria) comumente contaminam fontes de água e são rotineiramente isolados de ambientes de águas residuais (13) e biofilmes de água potável (15). Sua ocorrência em materiais usados ​​para experimentos de laboratório não é, portanto, surpreendente. Figura & # x200B A Figura 1 1 mostra as relações de algumas das sequências contaminantes e grupos ambientais de sequências para aqueles de Duganella zoogloeoides e Herbaspirillum seropedicae. o Duganella grupo de parentesco, visto como dois clados com ca. 98,5 & # x00025 identidade em sequências de rRNA, consiste principalmente em sequências de rDNA ambientais, todas quase idênticas, de vários estudos publicados (6, 8, 9, 20, 22 & # x0201324, 27, 34). Em adição ao Duganella agrupamento de sequências, uma série de outras sequências de contaminantes prevalentes, listadas na Tabela & # x200B Tabela1, 1, correspondem estreitamente às sequências relatadas de diversos ambientes. Leptothrix spp., por exemplo, como Duganella spp., são encontrados em água doce de fluxo lento e em água poluída e lodo ativado. É notável que sequências de rRNA essencialmente idênticas sejam obtidas de ambientes diferentes, como águas subterrâneas profundas, um sedimento marinho, uma fonte termal de Yellowstone, um pulmão de porquinho-da-índia e um abscesso dentoalveolar (pus ao redor dos dentes). Todas as extrações de amostras ambientais que resultaram em clones equivalentes aos rDNAs contaminantes provavelmente continham níveis muito baixos de biomassa. A extração de DNA de amostras de baixa biomassa é particularmente sensível ao DNA potencialmente contaminante durante o processamento porque o DNA contaminante é minimamente diluído pelo DNA da amostra. As fontes exatas de contaminação não foram determinadas, no entanto, o Taq a polimerase e o tampão de amplificação não estão contaminados de forma detectável, uma vez que as reações sem molde adicionado ou material de controle de extração negativo não produziram produtos amplificados. Portanto, as fontes mais prováveis ​​de contaminação são sais e tampões, lisozima, proteinase K e / ou esferas de zircônia / sílica.

Dendrograma de distância evolutiva mostrando as posições relativas do clone de rDNA 16S ambiental e sequências de cepas para os gêneros Duganella e Herbaspirillum. A barra indica a taxa de substituição de nucleotídeos. O comprimento da sequência em nucleotídeos segue a designação do clone ou cepa. As referências para clones são fornecidas na Tabela & # x200B Tabela1. 1 Os clones estão em negrito, as cepas cultivadas marinho isolado BAL15 (25), ártico isolado arc21 (3) e cepa Mena 23 / 3-3c (32) são mostradas na face clara. As sequências para as espécies bacterianas descritas (itálico) foram obtidas no GenBank (5). A sequência de rDNA de Rhodocyclus purpureus foi usado como um grupo externo. A resolução da árvore mostrada aqui é limitada pela qualidade dos dados da sequência e os comprimentos curtos (menos de 500 nt) de muitas sequências. Seqüências curtas (& # x0003c500 nt) foram inseridas na árvore usando a ferramenta de inserção de parcimônia do programa de software ARB (30). O clone contaminante CTHB-18 foi identificado em uma extração de controle negativo separada, independentemente daquela para a biblioteca de clones MT.

Neste estudo, relatamos que muitas sequências de rRNA de subunidade pequena obtidas de bibliotecas de clones de controle sem amostra estão intimamente relacionadas a sequências recuperadas em outros estudos de diversas amostras ambientais. Essa correspondência de sequências de contaminantes e ambientais pode indicar que algumas das sequências ambientais são derivadas como contaminantes experimentais e não têm relevância para as comunidades ambientais. Uma vez que qualquer fonte de sequências de contaminantes tende a ser idiossincrática, dependente do operador, fonte de reagentes, água, etc., os pesquisadores que examinam a biodiversidade usando técnicas de clonagem ambiental devem estar cientes desse problema e fazer todos os esforços para minimizar, detectar e analisar contaminação potencial. Talvez a mensagem mais importante dos resultados apresentados aqui seja que a prova definitiva para a ocorrência de um organismo indicado por uma sequência de rRNA clonada requer a identificação explícita desse organismo in situ. Atualmente, isso é mais facilmente alcançado pelo uso de técnicas de hibridização por fluorescência baseadas em 16S rRNA (2, 7).

Números de acesso da sequência de nucleotídeos.


Materiais vegetais

Trinta e sete espécies de Paphiopedilum gênero abrangendo todas as sete seções foram analisados ​​neste estudo. As informações sobre as espécies e seções são fornecidas na Tabela 1. As raízes em crescimento ativo foram usadas para a preparação dos cromossomos, enquanto as folhas foram usadas para a extração de DNA genômico.

Preparação de cromossomo

As pontas das raízes foram pré-tratadas com 0,004 M 8-hidroxiquinolina por 4-6 h a 10 ° C e fixadas em fixador preparado de fresco (3: 1 etanol: ácido acético) por 48 h a 10 ° C. As pontas das raízes fixas foram então enxaguadas abundantemente com água da torneira e maceradas em uma mistura de enzimas contendo 2% de celulase (Onozuka R-10, Rpi) e 1% de pectoliase (Aspergillus japonicus Y-23, MP) a 37 ° C durante 30 min. Após refixação em fixador por 15 min, as células meristemáticas foram esmagadas em uma gota de ácido acético a 45% sob uma lamela (22 × 22 mm) em uma lâmina de microscópio. As lâminas foram então mergulhadas em nitrogênio líquido e secas ao ar depois que as lamelas foram cuidadosamente removidas por uma lâmina.

Marcação de sonda e hibridização in situ fluorescente (FISH)

25S rDNA, um 2,3-kb ClaI subclones da região codificadora do rDNA 25S de Arabidopsis thaliana [54] e 5S rDNA (pTa794) [55] foram usados ​​como sondas. O rDNA 25S foi marcado com biotina-16-dUTP (Roche) e o rDNA 5S foi marcado com digoxigenina-11-dUTP (Roche), todos pelo método de tradução de nick usando o kit da Roche. O tampão de hibridização consistia em 50% de formamida desionizada, 2 × SSC, 50 mM de fosfato de sódio (pH 7,0), 10% de sulfato de dextrana e DNA de espermatozoide de salmão tosquiado (Invitrogen) em 100 × excesso de sondas marcadas. As sondas de rDNA 25S e 5S foram misturadas a uma concentração final de cerca de 2 ng / μl e, em seguida, desnaturadas a 94 ° C por 10 min antes de serem usadas. As lâminas com propagações metafásicas foram tratadas com formamida desionizada a 70% em 2 × SSC a 70 ° C durante 2 min. Sondas desnaturadas em tampão de hibridização foram então aplicadas às lâminas, as quais foram incubadas a 37 ° C por 10 h em câmara úmida. As lavagens pós-hibridação e a imunodetecção foram realizadas em um instrumento de hibridização in situ automatizado, o InsituPro VSi (Intavis Bionanalytical Instruments). As lâminas foram lavadas em 2 × SSC à temperatura ambiente por 5 min e duas vezes em 2 × SSC a 50 ° C por 10 min. O sinal de fluorescência foi detectado usando o conjugado anti-digoxigenina-rodamina (Roche) e o conjugado estreptavidina-fluoresceína (Invitrogen). As preparações foram montadas e contrastadas em Vectashield contendo 1,5 μg / ml de DAPI (4 ', 6-diamidino-2-fenilindol) (Vector Laboratories). As imagens foram tiradas por uma câmera CCD preto e branco Zeiss AxioCam MRm em um Imager Zeiss. Microscópio de fluorescência Z1 e então processado uniformemente usando o software Zeiss AxioVision. Os sinais de FISH eram de cor falsa e a fluorescência de DAPI era deixada em tom de cinza.

Amplificação, clonagem e sequenciamento por PCR

O DNA genômico total foi extraído de folhas frescas usando o kit Qiagen DNeasy Plant Mini. A região 5S-NTS foi amplificada por PCR usando os iniciadores degenerados universais: 5'-TGGGAAGTCCTYGTGTTGCA-3 'e 5'-KTMGYGCTGGTATGATCGCA-3' [56]. A amplificação touchdown foi realizada da seguinte forma: uma etapa inicial a 94 ° C por 5 min, seguida por 10 ciclos de 94 ° C por 1 min, recozimento por 1 min (início a 60 ° C, e diminuído em 1 ° C por ciclo) e 72 ° C por 1 min, então 35 ciclos de 94 ° C por 1 min, 50 ° C por 1 min e 72 ° C por 1 min, a etapa final a 72 ° C foi estendida para 10 min. Após a purificação do gel usando o kit de extração de gel QIAquick (Qiagen), os produtos de PCR foram ligados ao vetor de clonagem pDrive e transformados em células competentes QIAGEN EZ (kit de clonagem de PCR Qiagen). Os clones recombinantes foram rastreados pelo método de PCR direto de colônia e foram sequenciados de 7-8 clones por cada espécie usando o primer T7 (5'-TAATACGACTCACTATAGGG-3 ').

Análise de dados

As sequências foram alinhadas usando o servidor web MAFFT (Multiple Alignment using Fast Fourier Transform) no European Bioinformatics Institute [57]. Os parâmetros padrão foram usados: penalidade de abertura de gap = 1,53, penalidade de extensão de gap = 0,123, número de reconstrução da árvore = 1, maxiterate = 0 e executar FFTS = par local. O alinhamento de sequência está disponível como um arquivo FASTA suplementar (arquivo adicional 4).

O polimorfismo 5S-NTS dentro da espécie foi estimado, com base no alinhamento múltiplo mencionado acima, usando DnaSP versão 5.10.01 [58]. A relação entre o número de sítios polimórficos e o número mínimo de sinais de rDNA 5S visíveis foi investigada usando análise de regressão linear (no Microsoft Excel).

A reconstrução filogenética foi realizada usando otimização de máxima verossimilhança disponível através do servidor web RaxML BlackBox [59] rodando RaxML versão 7.2.8 [60]. As configurações padrão foram usadas. Os 8 Phragmipedium besseae as sequências foram indicadas como o grupo externo. RaxML foi chamado usando os seguintes comandos: raxml - # 100 -n colado -o bess1, bess2, bess3, bess4, bess5, bess6, bess7, bess8 -f a -m GTRGAMMA -x 564547904 -p 564547904 -s 0VaDTW. Todas as informações de pesquisa, como foram geradas no site, estão incluídas no arquivo adicional 5.


Caracterização das sequências completas de DNA ribossomal nuclear de Eurytrema pancreaticum

Eurytrema pancreaticum é um dos trematódeos mais comuns em bovinos e ovinos, podendo também infectar humanos ocasionalmente, causando grandes perdas econômicas e custos médicos. Neste estudo, as sequências das unidades de repetição do DNA ribossômico nuclear completo (rDNA) de cinco indivíduos de E. pancreaticum foram determinadas pela primeira vez. Eles tinham 8306-8310 bp de comprimento, incluindo a subunidade pequena (18S) rDNA, espaçador transcrito interno 1 (ITS1), rDNA 5.8S, espaçador transcrito interno 2 (ITS2), subunidade grande (28S) rDNA e espaçador intergênico (IGS) . Não houve variações de comprimento em qualquer uma das sequências de rDNA investigadas 18S (1996 bp), ITS1 (1103 bp), 5.8S (160 bp), ITS2 (231 bp) ou 28S (3669 bp), enquanto as sequências de rDNA IGS de E pancreaticum teve uma variação de comprimento de 4 bp, variando de 1147 a 1151 bp. As variações intraespecíficas dentro de E. pancreaticum foram 0–0,2% para 18S rDNA, 0–0,5% para ITS1, 0% para 5,8S rDNA e ITS2, 0–0,2% para 28S rDNA e 2,9–20,2% para IGS. Havia nove tipos de sequências repetidas em ITS1, dois tipos em rDNA 28S, mas nenhum em IGS. Uma análise filogenética baseada nas sequências de rDNA 18S classificou E. pancreaticum na família Dicrocoeliidae de Plagiorchiata, intimamente relacionada com a subordem Opisthorchiata. These results provide useful information for the further study of Dicrocoeliidae trematodes.


Restriction Digestion


Restriction enzymes are endonucleases which cleave double-stranded DNA at specific oligonucleotide sequences. The specific sites at which they cleave the nucleic acids in order to generate a set of smaller fragments are called restriction sites. The natural function of restriction enzymes in bacteria may be the destruction of foreign DNA that may enter the bacterial cell. But the cells own DNA is not cleaved by these restriction enzymes. This self protection is achieved by the help of the specific DNA methyltransferase enzyme which will methylates the specific DNA sequence for its respective restriction enzymes by transferring methyl groups to adenine or cytosine residues to produce N6-methyladenine or 5-methylcytosine. An interesting feature of restriction endonuclease is that they commonly recognize recognition sequences that are mostly palindromes - they shows the same forward (5' to 3' on the top strand) and backward (5' to 3' on the bottom strand) sequences. The DNA fragments of varying length can be separated by gel electrophoresis and stained with ethidium bromide and can be photographed for future studies.


Corneo, G., Ginelli, E., and Polli, E., J. Mol. Biol., 33, 331 (1968).

Corneo, G., Ginelli, E., and Polli, E., J. Mol. Biol., 48, 319 (1970).

Coudray, Y., Quetier, F., and Guille, E., Biochim. Biophys. Acta, 217, 259 (1970).

Birnstiel, M., Wallace, H., Sirlin, J. L., and Fischberg, M., Nat. Cancer Inst. Monog., 23, 431 (1966).

Birnstiel, M., and Keddes, L. H., Nature New Biology, 230, 165 (1971).

John, H. A., Birnstiel, M., and Jones, K. W., Natureza, 223, 582 (1969).

Pardue, M. L., and Gall, J., Proc. US Nat. Acad. Sci., 64, 600 (1969).

Chamberlain, M., and Berg, P., Proc. US Nat. Acad. Sci., 48, 81 (1961).

MacGreggor, H. C., and Kezer, J., Chromosoma, 33, 167 (1971).

Court Brown, W. M., Buckton, K. E., Jacobs, P. A., Tough, I. M., Kunsberg, E. V., and Knox, J. D. E., Eugenics Lab. Memoirs, 42 (Cambridge University Press, 1966).

Sumner, A. T., Evans, H. J., and Buckland, R. A., Nature New Biology, 232, 31 (1971).

Jones, K. W., Natureza, 225, 912 (1970).

Pardue, M. L., and Gall, J. G., Ciência, 168, 1556 (1970).

Hennig, W., and Walker, P. M. B., Natureza, 225, 915 (1970).

Jones, K. W., and Robertson, F. W., Chromosoma, 31, 331 (1970).

Arrighi, F., Hsu, T. C., Saunders, P., and Saunders, G. F., Chromosoma, 32, 224 (1971).


Assista o vídeo: Me Salva! GEN06 - Genética - Código genético (Novembro 2021).