Em formação

O potencial zeta de uma nanopartícula geralmente leva em consideração a carga do ligante?


Por exemplo, se eu tivesse uma nanopartícula de ponto quântico com peptídeos ligantes conjugados tampados com tratos de poliarginina.

A localização da carga negativa da arginina mudaria o potencial zeta do complexo np-peptídeo geral?

Ou o trato de poliarginina tem sua própria camada estacionária e seu próprio potencial zeta separado daquele do QD? Especialmente se se estender para fora do plano de deslizamento do QD?


Este pedido reivindica prioridade para o Pedido de Patente Provisório dos EUA nº 62 / 515.474 depositado em 5 de junho de 2017, o Pedido de Patente Provisório dos EUA nº 62 / 564.129 depositado em 27 de setembro de 2017 e o Pedido de Patente Provisório dos EUA nº 62 / 664.045 depositado em 27 de abril de 2018, cada um dos quais é incorporado por referência em sua totalidade como se totalmente estabelecido neste documento.

REFERÊNCIA À LISTAGEM DE SEQUÊNCIAS

Um arquivo de texto legível por computador, intitulado "17-116-WO-PCT Sequence Listing_ST25.txt", criado em 5 de junho de 2018, com um tamanho de arquivo de 260 KB, contém a listagem de sequência para este aplicativo e é aqui incorporado por referência em sua totalidade.

CAMPO DA DIVULGAÇÃO

A divulgação atual fornece portos seguros genômicos (GSH) para terapias genéticas em células-tronco humanas e nanopartículas projetadas para fornecer terapias genéticas direcionadas. O GSH divulgado e / ou nanopartículas associadas podem ser usados ​​para tratar com segurança e eficiência uma variedade de doenças genéticas, infecciosas e malignas.

ANTECEDENTES DA DIVULGAÇÃO

A terapia gênica específica do paciente tem grande potencial para tratar doenças genéticas, infecciosas e malignas. Por exemplo, a adição de genes mediada por retrovírus em células-tronco hematopoéticas (HSC) e células-tronco hematopoéticas e células progenitoras (HSPC) demonstrou resultados curativos para várias doenças genéticas nos últimos 10 anos, incluindo imunodeficiências hereditárias (por exemplo, ligada ao X e adenosina desaminase deficiência imunodeficiência combinada grave (SCID)), hemoglobinopatias, síndrome de Wiskott-Aldrich e leucodistrofia metacromática. Além disso, essa abordagem de tratamento também melhorou os resultados para diagnósticos de mau prognóstico, como glioblastoma. O uso de HSPC autólogo corrigido por gene, ou “self”, elimina o risco de respostas imunes enxerto-hospedeiro, negando a necessidade de drogas imunossupressoras. No entanto, a implementação eficaz da terapia gênica HSPC enfrenta vários desafios importantes. O atual estado da arte inclui a remoção de células do paciente por meio de aspirado de medula óssea ou sangue periférico mobilizado, classificando esta população em massa para HSPC autólogo por imunosseleção de células que expressam o marcador de superfície CD34, em seguida, cultivando essas células na presença de citocinas e o vetor retrovírus terapêutico especificado antes da colheita. A re-administração de células ao paciente pode exigir condicionamento citorredutor para permitir o enxerto das células corrigidas do gene. Atualmente, apenas os centros com instalações em conformidade com as Boas Práticas de Fabricação (GMP) e a infraestrutura para apoiá-los são capazes de administrar produtos de células modificadas por genes. Embora uma plataforma de manufatura simplificada para automatizar esse processo em um pequeno espaço móvel tenha sido desenvolvida, quantidades severamente limitadas de vetores terapêuticos disponíveis continuaram a criar um gargalo significativo para o uso generalizado da tecnologia.

Além do desafio de fabricar quantidades suficientes de vetores terapêuticos, permanece um risco conhecido de genotoxicidade e outras limitações associadas ao uso de vetores virais para transferência de genes. Por exemplo, os riscos de genotoxicidade são evidenciados pelo desenvolvimento de malignidade devido à mutagênese de inserção em pacientes tratados com terapia gênica HSPC. Este efeito colateral adverso decorre da natureza semi-aleatória da entrega do transgene mediado por retrovírus no genoma da célula hospedeira. A desregulação de genes próximos pela sequência do transgene inserido tem sido a base molecular para a expansão clonal e transformação maligna observada em alguns pacientes de terapia genética, mas as interações recíprocas entre o transgene inserido e o contexto genômico circundante também podem causar atenuação ou silenciamento do transgene, diminuindo os efeitos terapêuticos . Outras limitações associadas ao uso de vetores virais específicos incluem indução de respostas imunes, uma eficácia diminuída ao longo do tempo em células em divisão (por exemplo, vetores adeno-associados), uma incapacidade de direcionar adequadamente tipos de células selecionados in vivo (por exemplo, vetores retrovirais), e, conforme indicado, uma incapacidade de controlar o local de inserção e o número de inserções (por exemplo, vetores lentivirais).

Os últimos 5 anos viram uma explosão na edição de genes como uma alternativa mais segura para a transferência de genes mediada por retrovírus, possibilitada pelo desenvolvimento de RNA guia e nucleases projetadas que visam sequências de DNA específicas e geram previsivelmente quebras de fita dupla de DNA (DSB) no sequência alvo. Até o momento, esses complexos programáveis ​​têm sido mais eficazes no fornecimento de terapias promissoras quando a remoção ou silenciamento de um gene problemático (ou seja, gerando uma mutação de perda de função) é necessária. Isso ocorre porque os DSBs são mais comumente reparados por junção de extremidade não homóloga propensa a erros (NHEJ), que resulta em inserções e deleções de oligonucleotídeos (indels) no local DSB.

Para adição de gene ou correção de uma mutação específica, o reparo direcionado por homologia (HDR) menos comum do DSB é necessário. Nesta situação, uma carga útil mais complexa, incluindo o RNA guia projetado e a nuclease, bem como um modelo de reparo direcionado por homologia, devem ser entregues em conjunto. A prova de conceito para esta abordagem foi demonstrada em HSPC, mas também exigiu eletroporação em tandem de alguns componentes de edição de genes seguida por transdução com vetores virais não integrados, particularmente vetores virais recombinantes adeno-associados (rAAV) para entregar modelos de DNA, ou eletroporação simultânea de concentrações definidas de componentes de nuclease projetados com modelo de oligonucleotídeo de fita simples quimicamente modificado em concentrações de células especificadas. Além disso, cada RNA guia projetado, nuclease e modelo de reparo dirigido por homologia teve que ser projetado exclusivamente para cada alvo genético especificado, exigindo avaliação separada de entrega, atividade e especificidade em linhas celulares e HSPC.

Assim, embora tenha havido muitos avanços interessantes na capacidade de realizar terapias genéticas em locais específicos dentro do genoma, a contínua falta de um veículo de entrega seguro e potente tem impedido a tradução clínica de sistemas de edição de genes, em particular, com HSPCs.

O conceito de porto seguro genômico (GSH) para modificação genética foi introduzido pela primeira vez em 2011 por Papapetrou e colegas (Nature Biotechnology. 2011 29 (1): 73-8). Os principais critérios propostos para definir um sítio GSH são (1) a capacidade de acomodar novo material genético com, (2) função previsível e (3) sem alterações potencialmente prejudiciais na atividade genômica da célula hospedeira. O benefício de identificar tal locus simplificaria muito os esforços de desenvolvimento para abordagens de adição de genes direcionados. Vários loci foram avaliados no genoma humano, mas até o momento nenhum local GSH validado de boa-fé que satisfaça os critérios acima foi identificado. Papapetrou et al., Mol. Ther. 2016 24 (4): 678-84.

RESUMO DA DIVULGAÇÃO

A divulgação atual fornece avanços significativos na capacidade de realizar terapias genéticas para uma variedade de doenças genéticas, infecciosas e malignas, fornecendo a identificação de portos seguros genômicos (GSH) dentro de células-tronco hematopoéticas humanas (HSC) e células-tronco hematopoiéticas e células progenitoras (HSPC). Em modalidades particulares, o GSH adicionalmente se qualifica como os locais de porto seguro HSC universal mais rigorosamente definidos, conforme descrito em detalhes adicionais neste documento.

A divulgação atual também fornece nanopartículas projetadas especificamente para fornecer todos os componentes necessários para a edição genética, por exemplo, nos locais GSH. As nanopartículas podem ser usadas para terapias onde uma mutação de perda de função é necessária, mas o mais importante, também podem fornecer todos os componentes necessários para a adição de genes ou correção de uma mutação específica. As abordagens descritas são seguras (ou seja, sem toxicidade fora do alvo), confiáveis ​​(a cromatina de células GSH alvo é acessível e passível de adição de cassete terapêutico), escalonável, fácil de fabricar, sintético, plug-and-play (ou seja, o mesmo básico plataforma pode ser usada para entregar diferentes ácidos nucleicos terapêuticos) e compatível com a fácil administração in vivo (através, por exemplo, de uma seringa).

Modalidades particulares incluem uma nanopartícula com componentes para fornecer uma mutação de perda de função direcionada. Essas modalidades incluem um elemento de direcionamento (por exemplo, RNA guia) e um elemento de corte (por exemplo, uma nuclease) associado à superfície da nanopartícula. Em modalidades particulares, o elemento de direcionamento é conjugado à superfície da nanopartícula por meio de um ligante tiol. Em modalidades particulares, o elemento de direcionamento e / ou o elemento de corte são conjugados à superfície da nanopartícula por meio de um ligante tiol. Em modalidades particulares, o elemento de direcionamento é conjugado à superfície da nanopartícula através de um ligante tiol e o elemento de corte é ligado ao elemento de direcionamento para formar um complexo de ribonucleoproteína (RNP). O elemento de direcionamento direciona o elemento de corte para um local específico para corte e reparo NHEJ.

Modalidades particulares incluem uma nanopartícula com componentes para fornecer uma mutação de ganho de função direcionada (por exemplo, adição ou correção de gene). Em modalidades particulares, essas modalidades incluem uma nanopartícula de metal (por exemplo, uma nanopartícula de ouro) associada a um elemento de direcionamento, um elemento de corte, um modelo de reparo direcionado por homologia e uma sequência de DNA terapêutica. O elemento de direcionamento direciona o elemento de corte para um local específico para corte, o modelo de reparo direcionado por homologia fornece reparo de HDR, em que após o reparo de HDR, a sequência de DNA terapêutica foi inserida no local alvo. Juntos, modelos de reparo direcionados por homologia e sequências de DNA terapêuticas podem ser referidos aqui como modelos de doadores. Em modalidades particulares, o elemento de direcionamento é conjugado à superfície da nanopartícula por meio de um ligante tiol. Em modalidades particulares, o elemento de direcionamento e / ou o elemento de corte são conjugados à superfície da nanopartícula por meio de um ligante tiol. Em modalidades particulares, o elemento de direcionamento é conjugado à superfície da nanopartícula através de um ligante tiol e o elemento de corte é ligado ao elemento de direcionamento para formar um complexo de ribonucleoproteína (RNP). Nessas modalidades, o complexo RNP está mais próximo da superfície da nanopartícula do que o material do modelo do doador. Esta configuração é benéfica quando, por exemplo, o elemento de direcionamento e / ou o elemento de corte são de origem bacteriana. Isso ocorre porque muitos indivíduos que podem receber nanopartículas aqui descritas podem ter imunidade pré-existente contra componentes derivados de bactérias, como componentes de edição de genes derivados de bactérias. Incluir componentes de edição de genes derivados de bactérias em uma camada interna da nanopartícula totalmente formulada permite que componentes não derivados de bactérias (por exemplo, modelos de doadores) protejam os componentes derivados de bactérias (por exemplo, elementos de direcionamento e / ou elementos de corte) do sistema imunológico do paciente sistema. Isso protege os componentes derivados de bactérias do ataque e também evita ou reduz as respostas inflamatórias indesejadas contra as nanopartículas após a administração. Além disso, isso pode permitir a administração repetida das nanopartículas in vivo sem inativação pela resposta imune do hospedeiro.

Modalidades particulares utilizam edição do gene CRISPR. Em modalidades particulares, a edição do gene CRISPR pode ocorrer com o RNA guia CRISPR (crRNA) e / ou uma nuclease CRISPR (por exemplo, Cpf1 (também referido como Cas12a) ou Cas9).

Modalidades particulares adotam recursos que aumentam a eficiência e / ou precisão de HDR. Por exemplo, Cpf1 tem um único crRNA curto e corta o DNA alvo de forma escalonada com saliências de 5 ′ 2-4 nucleotídeos (nt) chamadas extremidades pegajosas. As extremidades pegajosas são favoráveis ​​para HDR, Kim et al. (2016) Nat Biotechnol. 34 (8): 863-8. Além disso, modelos de doadores devem ser liberados das nanopartículas antes que ocorra o corte do genoma pelo RNP para promover HDR. Por conseguinte, em modalidades particulares divulgadas neste documento, os modelos doadores são encontrados mais longe da superfície da nanopartícula do que os elementos de direcionamento e os elementos de corte. A divulgação atual também descobriu inesperadamente que a entrega de componentes de edição de genes em uma nanopartícula de ouro aumenta a eficiência e / ou precisão de HDR. Consequentemente, modalidades particulares entregam componentes de edição de genes utilizando nanopartículas de ouro.

Em modalidades particulares, as moléculas de direcionamento podem ser usadas para direcionar a nanopartícula a uma célula específica, de modo que a atividade do sistema de edição de genes possa ser controlada espacial ou temporalmente. Por exemplo, a atividade e o destino do sistema de edição de genes podem ser controlados por uma molécula de direcionamento que distribui seletivamente a nanopartícula às células direcionadas. Em modalidades particulares, a molécula de direcionamento pode incluir um domínio de ligação de anticorpo que se liga a CD34. Em modalidades particulares, pares de moléculas de direcionamento podem ser usados, por exemplo, um domínio de ligação de anticorpo que se liga a CD34 e um domínio de ligação de anticorpo que se liga a CD90.

BREVE DESCRIÇÃO DAS DIVERSAS VISTAS DOS DESENHOS

Muitos dos desenhos aqui apresentados são mais bem compreendidos em cores. O requerente considera as versões coloridas dos desenhos como parte da submissão original e reserva-se o direito de apresentar imagens coloridas dos desenhos em procedimentos posteriores.

FIGO. 1 Esquemático que mostra o projeto e a sequência de agrupamentos regulares de repetição palindrômica curta (CRISPR) RNA (crRNA) (SEQ ID NO: 244) e modelos de homologia (HT) (SEQ ID NOs: 247, 248) para um porto seguro genômico (GSH) localização (SEQ ID NOs: 242, 243, 245, 246) para permitir a edição do genoma direcionado em células-tronco hematopoéticas humanas (HSC) e células-tronco hematopoiéticas e células progenitoras (HSPC).

FIGO. 2 Um traço de um resultado de sequenciamento Sanger mostrando uma mutação em um local GSH alvo em células K562 (SEQ ID NOs: 249 e 250).

FIGO. 3 Esquemático mostrando o projeto e a sequência de crRNA (SEQ ID NO: 253) e modelo de reparo direcionado por homologia (também referido neste documento como um modelo de homologia (HT ou HDT)) (SEQ ID NOs: 256, 257) para uma segunda localização de GSH (SEQ ID NOs: 251, 252, 254, 255) dentro de HSC e HSPC humanos.

FIGO. 4 Dois sítios GSH (SEQ ID NOs: 258, 259) dentro do gene CCRS humano dentro do cromossomo 3p21 juntamente com crRNA (SEQ ID NO: 260) e HT (SEQ ID NOs: 261, 262) para uma fita não alvo e alvo. O objetivo da escolha do CCR5 foi validar a nanoformulação. Uma mutação de ocorrência natural bem conhecida no gene CCR5 torna as células sanguíneas de uma pessoa resistentes à infecção por HIV. Para os fins da presente divulgação, este local forneceu um meio para comparar as nucleases Cas9 e Cpf1 diretamente porque há uma sequência de DNA perto do local desta mutação de ocorrência natural que contém um local de corte idêntico para ambos Cpf1 e Cas9. A mutação PAM no modelo de homologia para a fita alvo está em itálico, em negrito e sublinhado.

FIGO. 5 Esquema do esquema de produção inicial de nanopartículas de ouro (AuNPs), um andaime de entrega sintético escalonável com compatibilidade in vivo estabelecida.

FIGO. 6 O tamanho do AuNP determina o tecido de destino / via de eliminação em humanos.

FIGS. 7A-7D. Esquemas que representam um AuNP exemplar associado a todos os componentes de edição de genes necessários para adição e / ou correção de genes. (FIG. 7A) Representação de um AuNP exemplar configurado com todos os componentes para adição de gene em um GSH. Os componentes representados incluem crRNA, uma nuclease Cpf1 e ssDNA para fornecer uma sequência de ácido nucleico terapêutica (por exemplo, um gene ou porção corrigida do mesmo). A modalidade representada na FIG. 7A inclui adicionalmente uma molécula de direcionamento (por exemplo, um domínio de ligação de anticorpo ou um aptâmero). (FIG. 7B) Representação esquemática de um processo de síntese para criar e carregar AuNP com componentes de edição de genes exemplares. (FIG. 7C) Esquemático de um AuNP "em camadas" formulado que pode ser usado para entregar grandes oligonucleotídeos, como modelos de doadores, incluindo modelos de reparo direcionados por homologia, sequências de DNA terapêuticas e outros elementos potenciais. Os modelos doadores estão localizados mais longe da superfície AuNP do que o complexo de ribonucleoproteína (RNP) representado (FIG. 7D) Geração bem-sucedida de AuNP de 50 nm carregando todos os componentes de edição de genes necessários para a inserção de uma sequência de DNA terapêutica. Imagens de microscopia eletrônica de transmissão de nanoformulações AuNP e AuNP / CRISPR. A modalidade representada inclui um AuNP associado com crRNA, Cpf1, ssDNA, ligantes de tiol, espaçadores de polietilenoglicol (PEG) e PEI2K. Mais particularmente, os ligantes tiol são ligados diretamente à superfície do AuNP e crRNA. O uso de tal ligante permite a conjugação de mais crRNA à superfície do AuNP, em parte porque os espaços reduzem a repulsão entre a carga negativa das moléculas baseadas em RNA e a carga negativa da superfície do AuNP. Cpf1 está ligado ao crRNA para formar um RNP. Para melhorar a eficiência do HDR, o ssDNA deve ser liberado do AuNP antes que ocorra o corte do genoma. Consequentemente, o ssDNA é encontrado mais longe da superfície do AuNP do que o RNP.

FIGO. 8 AuNPs totalmente carregados são monodispersos e exibem bom potencial zeta.

FIGS. 9A-9D. Gráficos e imagens digitais mostrando as propriedades características de AuNPs sintetizados e concentrações de carregamento ideais. (FIG. 9A) Picos de ressonância plasmônica de superfície localizada (LSPR) de AuNPs sintetizados. (FIG. 9B) Picos LSPR das nanoformulações AuNP e AuNP / CRISPR. (FIG. 9C) Eletroforese em gel mostrando relação de carregamento w / w de AuNP / ssDNA ideal. (FIG. 9D) Concentração de carregamento de nanoformulações AuNP / CRISPR.

FIGS. 10A-10C. Concentrações de carregamento ideais. (FIG. 10A) AuNP / crRNA 50 nm (proporção 6) AuNP / crRNA 15 nm (proporção 1) e AuNP / crRNA / Cpf1 / PEI / DNA 15 nm (proporção 0,5) (FIG. 10B) AuNP ideal 50 nm / DNA razão p / p (FIG. 100) AuNPs menores triplicam a área de superfície disponível com as mesmas quantidades de reagente inicial. Ao diminuir o tamanho, a área de superfície e a proporção de conjugação dos NPs aumentam.

FIGS. 11A, 11B. (FIG. 11A) Os HSPC absorvem AuNPs totalmente carregados in vitro. Imagem de lapso de tempo no microscópio confocal de disco giratório. Células CD34 + mobilizadas por humanos → Cultura O / N → Adicionar AuNPs (4 horas) ΔAnalyze. (FIG. 11B) Imagem de microscópio confocal mostrando a absorção de componentes de edição CRISPR em células CD34 +.

FIGS.12A-12D. Gráficos que mostram a eficiência de corte de genes em células K562 e células CD34 +. (FIGS. 12A, 12B) Resultados do ensaio de Rastreamento Indels por Decomposição (TIDE) mostrando a porcentagem de eficiência de corte em células K562 e células CD34 +. (FIG. 12C) Viabilidade percentual após a entrega com AuNPs e método de eletroporação. (FIG. 12D) Dose de administração de componentes CRISPR.

FIGO. 13 Até 10% de edição de genes e HDR foram observados in vitro em células CD34 + primárias obtidas de um doador adulto saudável mobilizado com G-CSF. As células CD34 + foram descongeladas usando um método de descongelamento rápido e cultivadas durante a noite em meio de Dulbecco modificado por Iscove (IMDM) contendo 10% de FBS e 1% de Pen / Strep. Na manhã seguinte, AuNPs foram semeados e montados da seguinte forma: semeie adicione crRNA com um espaçador de PEG para evitar repulsões eletrostáticas, adicione a proteína Cpf1 e permita que RNPs forme um revestimento com PEI ramificado 2K e ssODN. Neste exemplo, não houve modificações químicas de crRNA além das adições de tiol terminal para promover a ligação covalente com a superfície AuNP para fixação. SsODN foi usado como o modelo de reparo direcionado por homologia (HDT), aqui uma inserção de 8 bp usando um local NotI flanqueado por 40 nt de homologia (simétrico) para o locus alvo CCRS. AuNPs formulados foram adicionados às células e incubados por 48 horas com mistura suave em placas. Após 48 horas, as células foram colhidas, lavadas e o gDNA foi isolado para amplificação e análise por PCR.

FIGO. 14 Resultados do ensaio TIDE mostrando indels após a edição com nanoformulações AuNP / CRISPR em células CD34 +.

FIGS. 15A-15D. (FIG. 15A) 10 μg / mL AuNP é uma concentração ideal para HDR em células CD34 + onde a edição de gene máxima é alcançada sem perda de viabilidade. O mesmo protocolo foi usado conforme descrito em relação à FIG. 13, exceto que as células CD34 + foram inicialmente obtidas de um doador humano diferente. (FIGS. 15B, 15C) A análise de viabilidade celular por ensaio Live-Dead (FIG. 15D) resulta em resultados de viabilidade celular representativos em formato de gráfico de barras.

FIGO. 16 O objetivo do estudo que conduz aos dados apresentados na FIG. 16 foi comparar Cpf1 e Cas9 entregues por AuNP ou eletroporação, respectivamente. Os mesmos procedimentos foram usados ​​conforme descrito em relação à FIG. 13, exceto que as células CD34 + foram inicialmente obtidas de um doador humano diferente. Todas as condições de formulação foram as mesmas, de modo que as únicas variáveis ​​são Cpf1 vs. Cas9 AuNP vs. Modelo de reparo direcionado por homologia de eletroporação (HDT ssODN) presente vs. ausente. Condições de eletroporação: cubetas de eletroporação de 1 mm 125 mV 5 ms. Editando análise por TIDE. Uma sequência não alvo CCR5 do locus CCR5 é representada (SEQ ID NO: 263)

FIGS. 17A-17C. As condições de mídia de suporte de HSPC sem soro melhoram (17A) edição, (17B) HDR, e (17C) viabilidade celular.

FIGS. 18A, 18B. (FIG. 18A) Não há impacto significativo na aptidão de HSPC in vitro por qualquer nuclease ou método de entrega, conforme determinado por um primeiro ensaio de formação de colônia em metilcelulose (H4434). As células CD34 + foram semeadas a 200 células por placa de 35 mm com um tempo total de incubação de 14 dias. (FIG. 18B) Melhoria da aptidão de galvanização secundária de HSPC in vitro com AuNP / Cpf1. As placas de colônia (FIG. 18A) foram colhidas e 10% da suspensão de células resultante foi plaqueada novamente em um segundo ensaio de formação de colônia em metilcelulose (H4434). Este é um teste simples para determinar se as células iniciadoras de colônias de longo prazo foram afetadas pelas condições experimentais. O tempo total de incubação foi de 14 dias. A única diferença significativa observada foi no número de colônias para as células tratadas com AuNP + Cpf1 / crRNA, que exibiram mais células formadoras de colônias de longo prazo. Não foram observadas diferenças significativas no tipo de colônias formadas em cada grupo experimental.

FIGO. 19 Células CD34 + tratadas com AuNP enxertam in vivo. Notas experimentais e metodologia. Os mesmos procedimentos foram usados ​​conforme descrito em relação à FIG. 13, exceto que as células CD34 + foram inicialmente obtidas de um doador humano diferente. Após 48 horas, as células foram colhidas, lavadas e injetadas em camundongos NSG adultos irradiados subletalmente (8-12 semanas). As reservas celulares foram utilizadas para avaliar os ensaios de colônias em placas e isolar o gDNA para amplificação e análise por PCR.

FIGS. 20A-20C. Análise in vitro de células transplantadas em camundongos NSG. (FIG. 20A) 10% de HDR foi observado por TIDE sem indels significativos no locus alvo em células CD34 + humanas no momento do transplante. (FIG. 20B) Tanto a digestão de restrição T7E1 quanto NotI foram observadas apenas em células que receberam nanoformulações AuNP totalmente carregadas. (FIG. 20C) Curiosamente, o aumento da capacidade de formação de colônias para este doador foi observado apenas quando as células foram tratadas com AuNPs. Não foram observadas diferenças significativas nos tipos de colônias formadas em cada condição.

FIGS. 21A-21J. Análise in vivo de células transplantadas em camundongos NSG. Células hCD34 + tratadas com AuNP enxertam melhor do que células tratadas com simulação. (FIGS. 21A, 21B) Camundongos transplantados com células tratadas com AuNP exibiram níveis mais elevados de enxerto de células CD45 + humanas do que camundongos transplantados com células simuladas. (FIGS. 21C, 21D) Nenhuma diferença significativa na frequência de células CD20 + humanas foi observada entre os grupos. (FIGS. 21E, 21F) Nenhuma diferença significativa na frequência de células CD14 + humanas foi observada entre os grupos. (FIGS. 21G, 21H) Diferenças significativas na frequência de células CD3 + humanas foram observadas em 14 semanas e nos camundongos que receberam AuNPs totalmente carregados que exibiram o menor enxerto humano global. Este resultado pode ser um artefato de baixos níveis de enxerto.

FIGO. 22 A análise pós-transplante inicial sugere enxerto de células editadas por genes. O sangue periférico foi coletado para análise de gDNA 6 semanas após o transplante (seta na FIG. 21I). Em todos os camundongos tratados com AuNPs totalmente carregados, 7/10 exibiram edição detectável variando de 0,5-6% por TIDE. Em um camundongo (edição total de 5%), 1,7% de HDR foi observado por análise de TIDE.

FIGO. 23 Sequências que apóiam a divulgação.

DESCRIÇÃO DETALHADA

A terapia gênica específica do paciente tem grande potencial para tratar doenças genéticas, infecciosas e malignas. Por exemplo, a adição de genes mediada por retrovírus em células-tronco hematopoéticas (HSC) e células-tronco hematopoéticas e células progenitoras (HSPC) demonstrou resultados curativos para várias doenças genéticas nos últimos 10 anos, incluindo imunodeficiências hereditárias (por exemplo, ligada ao X e adenosina desaminase deficiência imunodeficiência combinada grave (SCID)), hemoglobinopatias, síndrome de Wiskott-Aldrich e leucodistrofia metacromática. Além disso, essa abordagem de tratamento também melhorou os resultados para diagnósticos de mau prognóstico, como glioblastoma. O uso de HSPC autólogo corrigido por gene, ou “self”, elimina o risco de respostas imunes enxerto-hospedeiro, negando a necessidade de drogas imunossupressoras. No entanto, a implementação eficaz da terapia gênica HSPC enfrenta vários desafios importantes. O atual estado da arte inclui a remoção de células do paciente por meio de aspirado de medula óssea ou sangue periférico mobilizado, classificando esta população em massa para HSPC autólogo por imunosseleção de células que expressam o marcador de superfície CD34, em seguida, cultivando essas células na presença de citocinas e o vetor retrovírus terapêutico especificado antes da colheita. A re-administração de células ao paciente pode exigir condicionamento citorredutor para permitir o enxerto das células corrigidas do gene. Atualmente, apenas os centros com instalações em conformidade com as Boas Práticas de Fabricação (GMP) e a infraestrutura para apoiá-los são capazes de administrar produtos de células modificadas por genes. Embora uma plataforma de manufatura simplificada para automatizar esse processo em um pequeno espaço móvel tenha sido desenvolvida, quantidades severamente limitadas de vetores terapêuticos disponíveis continuaram a criar um gargalo significativo para o uso generalizado da tecnologia.

Além do desafio de fabricar quantidades suficientes de vetores terapêuticos, permanece um risco conhecido de genotoxicidade associado ao uso de vetores retrovirais para transferência de genes, evidenciado pelo desenvolvimento de malignidade devido à mutagênese de inserção em pacientes tratados com terapia gênica HSPC. Este efeito colateral adverso decorre da natureza semi-aleatória da entrega do transgene mediado por retrovírus no genoma da célula hospedeira. A desregulação de genes próximos pela sequência do transgene inserido tem sido a base molecular para a expansão clonal e transformação maligna observada em alguns pacientes de terapia genética, mas as interações recíprocas entre o transgene inserido e o contexto genômico circundante também podem causar atenuação ou silenciamento do transgene, diminuindo os efeitos terapêuticos .

Os últimos 5 anos viram uma explosão na edição de genes como uma alternativa mais segura para a transferência de genes mediada por retrovírus, possibilitada pelo desenvolvimento de RNA guia projetado associado a nucleases que visam sequências de DNA específicas e geram previsivelmente quebras de fita dupla de DNA (DSB) em a sequência alvo. Até o momento, esses complexos programáveis ​​têm sido mais eficazes no fornecimento de terapias promissoras quando a remoção ou silenciamento de um gene problemático (ou seja, gerando uma mutação de perda de função) é necessária. Isso ocorre porque os DSBs são mais comumente reparados por junção de extremidade não homóloga propensa a erros (NHEJ), que resulta em inserções e deleções de oligonucleotídeos (indels) no local DSB.

Para adição de gene ou correção de uma mutação específica, o reparo direcionado por homologia (HDR) menos comum do DSB é necessário. Nesta situação, uma carga útil mais complexa incluindo o RNA guia projetado e nuclease e um modelo de reparo direcionado por homologia com homologia para o locus DSB alvo deve ser co-entregue. A prova de conceito para esta abordagem foi demonstrada em HSPC, mas também exigiu eletroporação em tandem de componentes de edição de genoma seguida por transdução com vetores virais não integrados, particularmente vetores virais recombinantes adeno-associados (rAAV) para entregar modelos de DNA, ou vetores simultâneos eletroporação de concentrações definidas de componentes de nuclease projetados com modelo de oligonucleotídeo de fita simples quimicamente modificado em concentrações de células especificadas. Além disso, cada RNA guia, nuclease e modelo de reparo dirigido por homologia teve que ser exclusivamente projetado para cada alvo genético especificado, exigindo avaliação separada de entrega, atividade e especificidade em linhas celulares e HSPC.

Assim, embora tenha havido muitos avanços interessantes na capacidade de realizar terapias genéticas em locais específicos dentro do genoma, a contínua falta de um veículo de entrega seguro e potente tem impedido a tradução clínica de sistemas de edição de genes, em particular, com HSPCs.

O conceito de porto seguro genômico (GSH) para modificação genética foi introduzido pela primeira vez em 2011 por Papapetrou e colegas (Nature Biotechnology. 2011 29 (1): 73-8). Os principais critérios propostos para definir um sítio GSH são (1) a capacidade de acomodar novo material genético com, (2) função previsível e (3) sem alterações potencialmente prejudiciais na atividade genômica da célula hospedeira. O benefício de identificar tal locus simplificaria muito os esforços de desenvolvimento para abordagens de adição de genes direcionados. Vários loci foram avaliados no genoma humano, mas até o momento nenhum local GSH validado de boa-fé que satisfaça os critérios acima foi identificado. Papapetrou et al., Mol. Ther. 201624 (4): 678-84.

A divulgação atual fornece avanços significativos na capacidade de realizar terapias genéticas para uma variedade de doenças genéticas, infecciosas e malignas, fornecendo a identificação de portos seguros genômicos (GSH) dentro de células-tronco hematopoéticas humanas (HSC) e células-tronco hematopoiéticas e células progenitoras (HSPC). Alguns dos GSH identificados também se qualificam como os locais de porto seguro HSC universal mais rigorosamente definidos, conforme descrito em detalhes adicionais neste documento.

A divulgação atual também fornece nanopartículas projetadas especificamente para fornecer todos os componentes necessários para a edição genética, por exemplo, nos locais GSH. As nanopartículas podem ser usadas para terapias onde uma mutação de perda de função é necessária, mas o mais importante, também podem fornecer todos os componentes necessários para a adição de genes ou correção de uma mutação específica. As abordagens descritas são seguras (ou seja, sem toxicidade fora do alvo), confiáveis ​​(a cromatina de células GSH direcionadas é acessível e passível de adições terapêuticas), escalonáveis, fáceis de fabricar, sintéticas, plug-and-play (ou seja, a mesma plataforma básica pode ser usado para entregar diferentes ácidos nucleicos terapêuticos) e compatível com a fácil administração in vivo (por meio, por exemplo, de uma seringa).

Modalidades particulares incluem uma nanopartícula com componentes para fornecer uma mutação de perda de função direcionada. Essas modalidades incluem um elemento de direcionamento (por exemplo, RNA guia) e um elemento de corte (por exemplo, uma nuclease) associado à superfície da nanopartícula. Em modalidades particulares, o elemento de direcionamento é conjugado à superfície da nanopartícula por meio de um ligante tiol. Em modalidades particulares, o elemento de direcionamento e / ou o elemento de corte são conjugados à superfície da nanopartícula por meio de um ligante tiol. Em modalidades particulares, o elemento de direcionamento é conjugado à superfície da nanopartícula através de um ligante tiol e o elemento de corte é ligado ao elemento de direcionamento para formar um complexo de ribonucleoproteína (RNP). O elemento de direcionamento direciona o elemento de corte para um local específico para corte e reparo NHEJ.

Modalidades particulares incluem uma nanopartícula com componentes para fornecer uma mutação de ganho de função direcionada (por exemplo, adição ou correção de gene). Essas modalidades incluem um elemento de direcionamento, um elemento de corte, um modelo de reparo direcionado por homologia e uma sequência de DNA terapêutica associada à superfície da nanopartícula. O elemento de direcionamento direciona o elemento de corte para um local específico para corte, o modelo de reparo direcionado por homologia fornece reparo de HDR, em que após o reparo de HDR, a sequência de DNA terapêutica foi inserida no local alvo. Juntos, modelos de reparo direcionados por homologia e sequências de DNA terapêuticas podem ser referidos aqui como modelos de doadores. Em modalidades particulares, o elemento de direcionamento é conjugado à superfície da nanopartícula por meio de um ligante tiol. Em modalidades particulares, o elemento de direcionamento e / ou o elemento de corte são conjugados à superfície da nanopartícula por meio de um ligante tiol. Em modalidades particulares, o elemento de direcionamento é conjugado à superfície da nanopartícula através de um ligante tiol e o elemento de corte é ligado ao elemento de direcionamento para formar um complexo de ribonucleoproteína (RNP). Nessas modalidades, o complexo RNP está mais próximo da superfície da nanopartícula do que o material do modelo do doador. Esta configuração é benéfica quando, por exemplo, o elemento de direcionamento e / ou o elemento de corte são de origem bacteriana. Isso ocorre porque muitos indivíduos que podem receber as nanopartículas aqui descritas podem ter imunidade pré-existente contra componentes derivados de bactérias, tais como componentes de edição de genes derivados de bactérias. Incluir componentes de edição de genes derivados de bactérias em uma camada interna da nanopartícula totalmente formulada permite que componentes não derivados de bactérias (por exemplo, modelos de doadores) protejam os componentes derivados de bactérias (por exemplo, elementos de direcionamento e / ou elementos de corte) do sistema imunológico do paciente sistema. Isso protege os componentes derivados de bactérias do ataque e também evita ou reduz as respostas inflamatórias indesejadas contra as nanopartículas após a administração. Além disso, isso pode permitir a administração repetida das nanopartículas in vivo sem inativação pela resposta imune do hospedeiro.

Modalidades particulares utilizam edição do gene CRISPR. Em modalidades particulares, a edição do gene CRISPR pode ocorrer com o RNA guia CRISPR (crRNA) e / ou uma nuclease CRISPR (por exemplo, Cpf1 ou Cas9).

Modalidades particulares adotam recursos que aumentam a eficiência e / ou precisão de HDR. Por exemplo, Cpf1 tem um único crRNA curto e corta o DNA alvo de forma escalonada com saliências de 5 ′ 2-4 nucleotídeos (nt) chamadas extremidades pegajosas. As extremidades pegajosas são favoráveis ​​para HDR, Kim et al. (2016) Nat Biotechnol. 34 (8): 863-8. Além disso, modelos de doadores devem ser liberados das nanopartículas antes que ocorra o corte do genoma pelo RNP para promover HDR. Por conseguinte, em modalidades particulares divulgadas neste documento, os modelos doadores são encontrados mais longe da superfície da nanopartícula do que os elementos de direcionamento e os elementos de corte. A divulgação atual também descobriu inesperadamente que a entrega de componentes de edição de genes em uma nanopartícula de ouro aumenta a eficiência e / ou precisão de HDR. Consequentemente, modalidades particulares entregam componentes de edição de genes utilizando nanopartículas de ouro.

Em modalidades particulares, as moléculas de direcionamento podem ser usadas para direcionar a nanopartícula a uma célula específica, de modo que a atividade do sistema de edição de genes possa ser controlada espacial ou temporalmente. Por exemplo, a atividade e o destino do sistema de edição de genes podem ser controlados por uma molécula de direcionamento que se liga a um marcador de superfície celular, como CD34 ou CD90.

Em modalidades que utilizam componentes de edição de genes de origem bacteriana, a divulgação atual também leva em consideração que muitos indivíduos que podem receber nanopartículas aqui descritas podem ter imunidade pré-existente contra tais componentes. Para abordar esta potencial imunidade pré-existente, componentes de edição de genes de origem bacteriana podem ser conjugados diretamente à superfície de nanopartículas, seguido pela adição de modelos de doadores. Nesta configuração, os modelos de doadores podem proteger os componentes de edição de genes do ataque imunológico e evitar ou reduzir as respostas inflamatórias indesejadas contra as nanopartículas após a administração.

Os seguintes aspectos da divulgação são agora descritos com detalhes adicionais e opções para apoiar os ensinamentos da divulgação da seguinte forma: (I) Genomic Safe Harbors (GSH) e Universal HSC Safe Harbor Loci em Human HSC e HSPC (II) Gene Editing Systems e componentes para direcionar e modificar locais GSH (III) Nanopartículas (IV) Conjugação de componentes ativos em nanopartículas (V) Eficiência de edição de genes (VI) Composições de nanopartículas e formulações celulares (VII) Métodos exemplares de uso e (VIII) Níveis de referência derivados de Populações de controle (IX) kits e (X) modalidades exemplificativas.

(I) Genomic Safe Harbors (GSH) e Universal HSC Safe Harbor Loci em Human HSC e HSPC. Conforme indicado, uma desvantagem com as terapias gênicas existentes é que o local de inserção dos vetores retrovirais não pode ser controlado de forma adequada. Os sistemas de edição de genes permitem o controle sobre os locais alvo de terapias genéticas, no entanto, antes da divulgação atual, nenhum local de GSH validado de boa-fé foi identificado no genoma humano (Papapetrou et al., Mol. Ther. 2016 24 (4): 678 -84), uma vez que o conceito foi proposto por Papapetrou e colegas na Nature Biotechnology.2011 29 (1): 73-8) (ou seja, (1) a capacidade de acomodar novo material genético com, (2) função previsível e (3) sem alterações potencialmente prejudiciais na atividade genômica da célula hospedeira).

Um dos desafios da incorporação de material genético nas células é determinar onde dentro dos cromossomos o material genético pode ser incorporado com segurança. A presente divulgação resolve este problema ao fornecer regiões acessíveis à cromatina na célula CD34 + e subtipo CD34 (CD45RA - e CD90 +) em células de primatas humanos e não humanos (ver, por exemplo, WO 2017/218948 e Radtke et al., Sci . Transl. Med. 2017 9 (414) que têm alta eficiência de edição e baixa probabilidade de interromper o potencial celular. Em modalidades particulares, os sites se qualificam como locais de porto seguro HSC universal. Em modalidades particulares, para atender aos critérios de um seguro HSC universal porto loci, os locais de cromatina devem estar & gt150 kb longe de um oncogene conhecido, & gt30 kb longe de um local de início de transcrição conhecido e não têm sobreposição com o mRNA de codificação. Em modalidades particulares, para atender aos critérios de loci de porto seguro HSC universal, locais de cromatina deve estar & gt200 kb longe de um oncogene conhecido, & gt40 kb longe de um local de início da transcrição conhecido e não ter sobreposição com o mRNA de codificação. Em modalidades particulares, para atender aos critérios de loci de porto seguro HSC universal, locais de cromatina deve estar & gt300 kb longe de um oncogene conhecido, & gt50 kb longe de um local de início da transcrição conhecido e não ter nenhuma sobreposição com o mRNA de codificação. Em modalidades particulares, um loci de porto seguro HSC universal atende aos critérios anteriores (& gt150 kb, & gt200 kb ou & gt300 kb longe de um local de início de transcrição conhecido e não tem sobreposição com a codificação de mRNA & gt40 kb, ou & gt50 kb longe de um local de início de transcrição conhecido sem sobreposição com o mRNA de codificação) e, adicionalmente, é 100% homólogo entre o primata não humano e o genoma humano para permitir a tradução clínica rápida dessas populações editadas por genes. Em modalidades particulares, um local de porto seguro de HSC universal atende aos critérios anteriores e demonstra uma proporção de 1: 1 de orientações diretas: reversas de integração LV, demonstrando ainda que os locais não impactam o material genético circundante.

O processo para identificar GSH dentro do genoma humano começou avaliando o resultado biológico do enxerto de longo prazo de células CD34 + autólogas modificadas pelo gene de lentivírus (LV) no macaco pigtailed (M. Nemestrina), um modelo de primata não humano estabelecido usado para avaliações pré-clínicas de terapia gênica HSC e HSPC. Uma análise de alto rendimento de locais de integração LV foi usada para identificar locais GSH candidatos. Os LVs podem transduzir células que não se dividem e se integrar preferencialmente em unidades de transcrição ativas no genoma da célula hospedeira. O locus de integração é determinado no momento da transferência do gene e é herdado por cada célula filha. 150.000 locais de integração LV identificados em células sanguíneas coletadas de doze animais ao longo de um período de 2-7 anos após o transplante foram analisados ​​em 1.077 janelas genômicas de 25 kb exibindo frequências de integração significativamente enriquecidas em relação ao resto do genoma (Tabela 1).

Espera-se que um locus acessível benigno exiba uma proporção de 1: 1 de orientações para a frente: reversa da integração VE. A lista foi então analisada em 664 janelas genômicas com orientação direta e reversa equivalente de eventos de integração. Destas, 662 janelas continham eventos de integração que foram representados por 3 ou mais réplicas biológicas (≥3 de 12 macacos analisados).

As janelas foram filtradas com base na homologia com o genoma humano (hg38) e um total de 171 janelas foram identificadas com ≥90% de homologia. Para aumentar a segurança, essas janelas foram cruzadas com o banco de dados de genes de câncer COSMIC. As janelas só foram mantidas se estivessem a & gt300 kb de um oncogene conhecido. Este filtro resultou em 122 janelas. Quaisquer janelas dentro de 50 kb de um local de início da transcrição foram removidas, o que resultou em 24 janelas, todas preferencialmente localizadas em sequências intrônicas. Duas regiões genômicas foram altamente enriquecidas nessas 24 janelas: cromossomo 11q13.2 e cromossomo 16p12.1.

Ambos os loci ricos em genes são expressos constitutivamente em células sanguíneas, indicando que (1) a expressão de transgenes não deve transativar genes próximos que devem ser silenciados nas células sanguíneas, e (2) as sequências transgênicas inseridas não serão atenuadas ou silenciadas durante a diferenciação hematopoiética [University of California at Santa Cruz (UCSC) Genome Browser and ENCODE]. Esses dois loci foram analisados ​​adicionalmente pelos seguintes critérios: subdomínios alvo foram identificados como sequências únicas com (1) 100% de homologia entre os genomas de primata (RheMac3) e humano (hg38), e (2) sem sobreposição com o mRNA de codificação. O último critério excluiu o cromossomo 16p12.1 como um locus GSH porque ele se sobrepõe a vários mRNAs.

Os seguintes locais identificados pela análise são 100% homólogos entre o genoma humano e o genoma rhesus.

Essas áreas do cromossomo 11q13.2 representam locais de porto seguro do HSC universal. Os seguintes locais também demonstraram permissividade à modificação genética sem consequências biológicas adversas, mesmo sob pressão seletiva in vivo e representam locais GSH: chr11: 67523429-67533593 chr11: 67681215-67741765 chr11: 67805337-67845629 chr11: 67895738-67941098 chr5: 66425332- CHR8: 28980753-29006178 chr16: 28151114-28175716 Chr1: 39189118-39214131 chr17: 2149700-2174592 CHR14: 35658075-35685512 chr18: 9198556-9223041chr5: 140463887-140488886 CHR11: 68563075-68.588.007 ChR2: 43459415-43484174 CHR11: 68.517.649-68.542.970 Chr1 : 8600474-8624530 chr12: 50609483-50635221 chr16: 28175717-28199134 chr17: 63329602-63353111 chr1: 107643312-107672400 chr17: 65870579-65895504 chr2: 224533608272542245111 chr2: 22453360827-2245111: 50027507-2447-224294592: 50027507-2447-2214294294594: 224525427-47-2429422459 Em modalidades particulares, chr11: 67681215-67741765, chr11: 67805337-67845629 e / ou chr11: 67895738-67941098 são direcionados para modificação genética.

Os loci da janela de porto seguro de HSC universal em chr11 que são particularmente relevantes para a edição de genes (conforme descrito em mais detalhes em relação à edição de genes abaixo) incluem: 67935219-67935243 67911598-67911622 67939901-67939925 67927758-67927782 67917930-67917954 679148042-6793 67931497 67936715-67936739 67921126-7921150 67914940-67914964 67928284-67928308 67936068-67936092 67922372-67922396 67811255-67811279 67840351-67840375 67821576-67821600 67827279-67827303 67822563-7822587 67823914-67823938 67818875-67818899 67811907-67811931 67811630-67811654 7836644-67836668 67806757 -67806781 67823923-67823947 67841379-67841403 67808086-7808110 67823903-67823927 67686904-67686928 67692610-67692634 67692462-67692486 67692618-67692642 67705405-67705429 67686651-67686675 67686788-67686812 67684033-7684057 67681565-67681589 67704652-67704676 67689328-67689352 67688546-67688570 67693464-67693488 67682343-67682367 67689948-67689972 67684785-67684809 67684738-67684762 67684260-67684284 67684173- 67684197 67687315-67687339 67682671-67682695 67691534-67691558 67690743-67690767 67693746-67693770 67690174-67690198 67692535-67692559 67687605-67687629 67694747-67694771 67681441-67681465 67691508-67691532 67692057-67692081 67692573-67692597 67690331-67690355 67697247-67697271 67695745-67695769 67695241 -67695265 67691931-67691955 67691017-67691041 67694689-67694713 67721934-67721958 67696164-67696188 67736715-67736739 67681498-67681522 67690926-67690950 67694271-67694295 67682715-67682739 67694107-67694131 67692129-67692153 67721153-67721177 67726733-67726757 67694551-67694575 67684767-67684791 67686717-67686741 67692858-67692882 67694890-67694914 7706343-67706367 67681596-67681620 67684153-67684177 67690025-67690049 67691225-67691249 67692361-67692385 67692291-67692315 67684752-67684776 67690917-67690941 67695354-67695378 67685964-67685988 67690852-67690876 67698221-67698245 67713445- 67713469 67693965-67693989 67689830-67689854 67690151-67690175 67718079-67718103 67692663-67692687 67 684143-67684167 67702560-67702584 67689807-67689831 67734305-67734329 67691410-67691434 67691162-67691186 67702695-67702719 67689612-67689636 67697284-67697308 67691567-67691591 67685635-67685659 67689900-67689924 67696035-67696059 67687462-67687486 67689863-67689887 67690831-67690855 67696956- 67696980 67703966-67703990 67692382-67692406 67693741-67693765 67682707-67682731 67689891-67689915 67695833-67695857 67689800-67689824 67693566-67693590 67681587-67681611 67702113-67702137 67701288-67701312 67689761-67689785 67723825-67723849 67686892-67686916 67698097-67698121 67687614-67687638 67703251 -67703275 67690109-67690133 67719750-67719774 67691762-67691786 67691654-67691678 67695445-67695469 67694579-67694603 67693002-67693026 67731932-67731956 67689608-67689632 67691726-67691750 67704995-67705019 67694095-67694119 67688285-67688309 67692918-67692942 67735442-67735466 67694119-67694143 67694791-67694815 67695843-67695867 67695032-67695056 67703734-67703758 67690809-67690833 67697085-676 97109 67690629-67690653 67701642-67701666 67693639-67693663 67703876-67703900 67690054-67690078 67695062-67695086 67689878-67689902 67696347-67696371 67694806-67694830 67690245-67690269 67695377-67695401 67694295-67694319 67705602-67705626 67693729-67693753 67694696-67694720 67694318-67694342 67697768 -67697792 67694989-67695013 67687551-67687575 67694309-67694333 67693926-67693950 67693602-67693626 67693896-67693920 67718020-67718044 67700346-67700370 67696171-67696195 67729142-67729166 67684112-67684136 67693375-67693399 67691807-67691831 67700198-67700222 67697504-67697528 67701370-67701394 67703871-67703895 67683323-67683347 e 67690737-67690761. Esses sites representam SEQ ID NOs. 1-194 conforme fornecido na Tabela 3 abaixo.

Embora os loci GSH aqui descritos sejam idealmente adequados para manipulação genética em HSC, incluindo um subconjunto para células CD34 +, CD34 + CD45RA - CD90 + HSC), outros tipos de células sanguíneas apropriados incluem células progenitoras hematopoiéticas (HPC), células-tronco hematopoiéticas e células progenitoras (HSPCs) , Células T, células assassinas naturais (NK), células B, macrófagos, monócitos, células-tronco mesenquimais (MSC), glóbulos brancos (WBC), células mononucleares (MNC), células endoteliais (EC), células do estroma e medula óssea fibroblastos. Esses tipos de células podem ser referidos coletivamente como "células do sangue".

(II) Sistemas e componentes de edição de genes para direcionar e modificar locais GSH. A identificação do GSH acima descrito e dos loci de porto seguro HSC universal mais rigorosamente definidos permite o direcionamento com sistemas de edição de genes, aumentando significativamente a segurança das terapias genéticas. Dentro dos ensinamentos da divulgação atual, qualquer sistema de edição de gene capaz de direcionamento e modificação de sequência precisa pode ser usado. Esses sistemas normalmente incluem um elemento de direcionamento para direcionamento preciso e um elemento de corte para cortar o sítio genético direcionado. O RNA guia é um exemplo de um elemento de direcionamento, enquanto várias nucleases fornecem exemplos de elementos de corte. Os elementos de direcionamento e os elementos de corte podem ser moléculas separadas ou ligadas, por exemplo, por uma nanopartícula. Alternativamente, um elemento de direcionamento e um elemento de corte podem ser ligados entre si em uma molécula de duplo propósito. Quando a inserção de uma sequência de ácido nucleico terapêutica é pretendida, os sistemas também incluem um modelo de reparo direcionado por homologia (que pode incluir braços de homologia) associado à sequência de ácido nucleico terapêutica. Conforme detalhado mais abaixo, no entanto, diferentes sistemas de edição de genes podem adotar diferentes componentes e configurações, mantendo a capacidade de direcionar, cortar e modificar precisamente os sítios genômicos selecionados.

Modalidades particulares utilizam nucleases de dedo de zinco (ZFNs) como agentes de edição de genes. ZFNs são uma classe de nucleases específicas do local projetadas para ligar e clivar o DNA em posições específicas. ZFNs são usados ​​para introduzir quebras de fita dupla (DSBs) em um local específico em uma sequência de DNA que permite que as ZFNs tenham como alvo sequências únicas dentro de um genoma em uma variedade de células diferentes. Além disso, após a quebra de fita dupla, o reparo direcionado por homologia (HDR) ou a junção de extremidade não homóloga (NHEJ) ocorre para reparar o DSB, permitindo assim a edição do genoma.

ZFNs são sintetizados pela fusão de um domínio de ligação de DNA de dedo de zinco a um domínio de clivagem de DNA. O domínio de ligação ao DNA inclui três a seis proteínas de dedo de zinco que são fatores de transcrição. O domínio de clivagem de DNA inclui o domínio catalítico de, por exemplo, endonuclease FokI. O domínio FokI funciona como um dímero que requer duas construções com domínios de ligação de DNA únicos para locais na sequência alvo. O domínio de clivagem FokI cliva dentro de uma sequência espaçadora de cinco ou seis pares de bases que separa os dois meios-locais invertidos.

Para obter informações adicionais sobre ZFNs, consulte Kim, et al. Proceedings of the National Academy of Sciences dos Estados Unidos da América 93, 1156-1160 (1996) Wolfe, et al. Revisão anual de biofísica e estrutura biomolecular 29, 183-212 (2000) Bibikova, et al. Science 300, 764 (2003) Bibikova, et al. Genetics 161, 1169-1175 (2002) Miller, et al. The EMBO journal 4, 1609-1614 (1985) e Miller, et al. Nature biotechnology 25, 778-785 (2007)].

Modalidades particulares podem usar ativador de transcrição como nucleases efetoras (TALENs) como agentes de edição de genes. TALENs referem-se a proteínas de fusão, incluindo uma proteína de ligação de DNA efetora do tipo ativador de transcrição (TALE) e um domínio de clivagem de DNA. TALENs são usados ​​para editar genes e genomas induzindo DSBs no DNA, que induzem mecanismos de reparo nas células. Geralmente, dois TALENs devem se ligar e flanquear cada lado do sítio de DNA alvo para que o domínio de clivagem de DNA dimerize e induza um DSB. O DSB é reparado na célula por NHEJ ou HDR se um fragmento de DNA doador de fita dupla exógeno estiver presente.

Conforme indicado, os TALENs foram projetados para se ligar a uma sequência alvo de, por exemplo, um genoma endógeno e cortar o DNA no local da sequência alvo. Os TALEs de TALENs são proteínas de ligação ao DNA secretadas por Xanthomonas bactérias. O domínio de ligação ao DNA de TALEs inclui uma repetição altamente conservada de 33 ou 34 aminoácidos, com resíduos divergentes nas posições 12ª e 13ª de cada repetição. Estas duas posições, referidas como Repetir Variável Diresidue (RVD), mostram uma forte correlação com o reconhecimento de nucleotídeos específicos. Consequentemente, a especificidade de direcionamento pode ser melhorada alterando os aminoácidos no RVD e incorporando aminoácidos RVD não convencionais.

Exemplos de domínios de clivagem de DNA que podem ser usados ​​em fusões TALEN são endonucleases FokI de tipo selvagem e variantes. Para obter informações adicionais sobre TALENs, consulte Boch, et al. Science 326, 1509-1512 (2009) Moscou, & amp Bogdanove, Science 326, 1501 (2009) Christian, et al. Genetics 186, 757-761 (2010) e Miller, et al. Nature biotechnology 29, 143-148 (2011).

Modalidades particulares utilizam MegaTALs como agentes de edição de genes. MegaTALs têm uma estrutura de nuclease de clivagem rara de cadeia única na qual um TALE é fundido com o domínio de clivagem de DNA de uma meganuclease. As meganucleases, também conhecidas como endonucleases homing, são cadeias peptídicas únicas que têm reconhecimento de DNA e função de nuclease no mesmo domínio. Em contraste com o TALEN, o megaTAL requer apenas a entrega de uma única cadeia de peptídeo para atividade funcional.

Em modalidades particulares, GSH pode ser direcionado usando sistemas de edição de genes CRISPR. O sistema de nuclease CRISPR é um sistema imunológico procariótico que confere resistência a elementos genéticos estranhos, como plasmídeos e fagos, e fornece uma forma de imunidade adquirida. CRISPRs são loci de DNA contendo pequenas repetições de sequências de bases. No contexto de um sistema imunológico procariótico, cada repetição é seguida por segmentos curtos de DNA espaçador pertencentes a elementos genéticos estranhos aos quais o procariota foi exposto. Esta matriz CRISPR de repetições intercaladas com espaçadores pode ser transcrita em RNA. O RNA pode ser processado para uma forma madura e associado a uma nuclease cas (associada a CRISPR). Um sistema CRISPR-Cas incluindo um RNA tendo uma sequência que pode hibridizar com os elementos genéticos estranhos e nuclease Cas pode então reconhecer e cortar esses elementos genéticos exógenos no genoma.

Um sistema CRISPR-Cas não requer a geração de proteínas personalizadas para alvejar sequências específicas, mas em vez disso, uma única enzima Cas pode ser programada por uma molécula de RNA guia curta (crRNA) para reconhecer um alvo de DNA específico. Os sistemas CRISPR-Cas de imunidade adaptativa bacteriana e arquea apresentam extrema diversidade de composição de proteínas e arquitetura de loci genômico. Os loci do sistema CRISPR-Cas têm mais de 50 famílias de genes e não há genes estritamente universais, indicando evolução rápida e extrema diversidade da arquitetura dos loci. Até agora, adotando uma abordagem multifacetada, há uma identificação abrangente do gene cas de 395 perfis para 93 proteínas Cas. A classificação inclui perfis de genes de assinatura mais assinaturas da arquitetura do locus. Uma nova classificação de sistemas CRISPR-Cas é proposta em que esses sistemas são amplamente divididos em duas classes, Classe 1 com complexos efetores de subunidades múltiplas e Classe 2 com módulos efetores de subunidade única exemplificados pela proteína Cas9. Foi demonstrada a edição de genes eficiente em células CD34 + humanas usando eletroporação de mRNA CRISPR / Cas9 e oligodeoxirribonucleotídeo de fita simples (ssODN) como um modelo de doador para HDR. De Ravin e col. Sci Transl Med. 2017 9 (372): eaah3480. Novas proteínas efetoras associadas aos sistemas Classe 2 CRISPR-Cas podem ser desenvolvidas como ferramentas poderosas de engenharia de genoma e a previsão de novas proteínas supostas efetoras e sua engenharia e otimização são importantes. Além dos sistemas de Classe 1 e Classe 2 CRISPR-Cas, mais recentemente uma classe putativa Classe 2, Tipo V CRISPR-Cas exemplificada por Cpf1 foi identificada Zetsche et al. (2015) Cell 163 (3): 759-771.

Informações adicionais sobre os sistemas CRISPR-Cas e seus componentes são descritos na Patente US Nos. 8.697.359, 8.771.945, 8.795.965, 8.865.406, 8.871.445, 8.889.356, 8.889.418, 8.895.308, 8.906.616, 8.932.814, 8.945.839, 8.993.233 e 8.999.641 e pedidos relacionados a eles e 8.889.356, 8.889.418, 8.895.308, 8.906.616, 8.932.814, 8.945.839, 8.993.233 e 8.999.641 e pedidos relacionados com os mesmos e WO36 / 0935/018142014 093655, WO2014 / 093661, WO2014 / 093694, WO2014 / 093701, WO2014 / 093709, WO2014 / 093712, WO2014 / 093718, WO2014 / 145599, WO2014 / 204723, WO2014 / 204724, WO2014 / 204725, WO272014, WO272014 WO2014 / 204728, WO2014 / 204729, WO2015 / 065964, WO2015 / 089351, WO2015 / 089354, WO2015 / 089364, WO2015 / 089419, WO2015 / 089427, WO2015 / 089462, WO2015 / 0894654, WO2015 / 089364, WO2015 / 089419, WO2015 / 089427, WO2015 / 089462, WO2015 / 089465, WO892015 / 0891573 e WO892015 / 089473, WO572016 / 057.1173 WO2017 / 106657, WO2017 / 127807 e aplicações relacionadas com os mesmos.

A nuclease Cpf1, em particular, pode fornecer flexibilidade adicional na seleção do local alvo por meio de uma sequência de reconhecimento de três pares de bases curta (TTN), conhecida como o motivo adjacente ao protoespaçador ou PAM.O local de corte da Cpf1 está a pelo menos 18 bp de distância da sequência PAM, portanto, a enzima pode cortar repetidamente um locus especificado após a formação do indel (inserção e deleção), aumentando a eficiência do HDR. Além disso, os DSBs escalonados com extremidades pegajosas permitem a inserção do modelo do doador com orientação específica, o que é vantajoso em células que não se dividem.

Três janelas de locais GSH identificados no cromossomo 11q13.2 foram pesquisados ​​para locais alvo Cpf1 que continham a sequência PAM mais preferida (TTTA) e um 21 bp adjacente de DNA que era completamente único para o genoma humano. Um total de 194 locais de corte alvo foram identificados por esses critérios e estão listados na Tabela 3. Cada uma dessas sequências identificadas fornece um local benéfico para o alvo específico para terapia gênica. As sequências de ácido nucleico divulgadas são mostradas usando abreviaturas de letras padrão para bases de nucleotídeos, conforme definido em 37 C.F.R. 1.822. Apenas uma fita de cada sequência de ácido nucleico é mostrada, mas a fita complementar é entendida como incluída por qualquer referência à fita exibida na seguinte Tabela 3 e / ou como aqui fornecido:

crRNA para o alvo SEQ ID NO: 132 inclui

crRNA para o alvo SEQ ID NO: 108 inclui

Os locais alvo de crRNA Cpf1 e locais PAM em chr11: 67681215-67741765 incluem

Os locais alvo de crRNA Cpf1 e locais PAM em chr11: 67805337-67845629 incluem

Os locais alvo de crRNA Cpf1 e locais PAM em chr11: 67895738-67941098 incluem:

Em modalidades particulares, uma sequência alvo de crRNA Cpf1 inclui TTTGGAGCTGTTGGCATCATGTTCCTG (SEQ ID NO: 203), e um crRNA para o alvo inclui

Em modalidades particulares, uma sequência alvo de crRNA Cpf1 inclui TTTATCCAAACCTCCTAAATGATAC (SEQ ID NO: 210) localizada em chr11: 67839126-67839150, e um crRNA para o alvo inclui:

Em modalidades particulares, uma sequência alvo de crRNA Cpf1 inclui TTTACACCCGATCCACTGGGGAGCA (SEQ ID NO: 212) localizada em chr3: 46373915-46373939, e um crRNA para o alvo inclui

Os crRNAs também foram projetados com base na seguinte sequência de local de corte de 27 nt CRISPR / Cpf1: TTTTTGATTCTTTTCTATCTCAGGACA (SEQ ID NO: 213) localizado em chr11: 67812443-67812469.

Os modelos de reparo direcionado por homologia para HDR também foram projetados para pares guia-nuclease com braços de homologia simétricos ou assimétricos, conforme descrito por Richardson et al., Nat Biotechnol. 201634 (3): 339-44. Cada modelo de doador incluiu braços de homologia (modelo de reparo direcionado por homologia) flanqueando um elemento de código de barras de DNA aleatório de 20 bp para rastreamento de clone, a montante de um promotor de fosfoglicerato quinase (PGK) humano (por exemplo, SEQ ID NO: 214) dirigindo a expressão de um verde melhorado gene repórter da proteína fluorescente (GFP) (para fins experimentais, mas semelhante a uma sequência de DNA terapêutica em uso clínico). A proteína Cpf1 humanizada foi sintetizada por um fabricante comercial (Aldevron), e o RNA guia com duas modificações, um espaçador de oligoehtilenoglicol de átomo e um tiol 3 'terminal também foi obtido de uma fonte comercial (Integrated DNA Technologies). DNA molde de homologia de fita simples (ssODN) também foi sintetizado por um fabricante comercial (Integrated DNA Technologies). Para exemplos de tais sequências, consulte as FIGS. 1, 3, 4 e 16.

Conforme indicado, em modalidades particulares, sistemas de edição de genes para fornecer uma terapia genética dentro de um GSH incluirão RNA guia e uma nuclease. Em modalidades particulares, modelos de doadores podem ser usados, especialmente ao realizar uma terapia de ganho de função ou uma terapia de perda de função precisa. Em modalidades particulares, os sistemas de edição de genes incluem um modelo de reparo direcionado por homologia e uma sequência de ácido nucleico terapêutica.

Todos os componentes baseados em ácido nucleico de sistemas de edição de genes podem ser de fita simples, fita dupla ou podem ter uma mistura de regiões de fita simples e dupla. Por exemplo, o RNA guia ou um modelo de doador pode ser um DNA de fita simples, um RNA de fita simples, um DNA de fita dupla ou um RNA de fita dupla. Em modalidades particulares que utilizam nanopartículas aqui descritas, a extremidade de um ácido nucleico mais distante da superfície da nanopartícula pode ser protegida (por exemplo, da degradação exonucleolítica) por métodos conhecidos pelos versados ​​na técnica. Por exemplo, um ou mais resíduos de didesoxinucleotídeo podem ser adicionados ao terminal 3 'de uma molécula linear e / ou oligonucleotídeos auto-complementares são ligados a uma ou ambas as extremidades. Ver, por exemplo, Chang et al. (1987) Proc. Natl. Acad Sci USA 84: 4959-4963 Nehls et al. (1996) Science 272: 886-889. Métodos adicionais para proteger polinucleotídeos exógenos da degradação incluem adição de grupo (s) amino terminal (s) e o uso de ligações internucleotídicas modificadas, tais como, por exemplo, fosforotioatos, fosforamidatos e O-metil ribose ou resíduos de desoxirribose. O mRNA quimicamente modificado pode ser usado para aumentar a estabilidade intracelular, enquanto braços de homologia assimétrica e modificação de fosforotioato podem ser incorporados no ssODN para melhorar a eficiência de HDR. Em modalidades particulares que utilizam nanopartículas aqui descritas, os ácidos nucleicos podem ser protegidos de repulsões eletrostáticas (baseadas em carga) por, por exemplo, adição de um espaçador de proteção de carga. Em modalidades particulares, um espaçador de blindagem de carga pode incluir um espaçador de oligoetilenoglicol (OEG) de 18 átomos adicionado a uma ou ambas as extremidades. Em modalidades particulares, um espaçador de proteção de carga pode incluir um espaçador de oligoetilenoglicol (OEG) de 10-26 átomos adicionado a uma ou ambas as extremidades.

Os modelos doadores podem ser de qualquer comprimento, por exemplo, 10 nucleotídeos ou mais, 50 nucleotídeos ou mais, 100 nucleotídeos ou mais, 250 nucleotídeos ou mais, 500 nucleotídeos ou mais, 1000 nucleotídeos ou mais, 5000 nucleotídeos ou mais, etc.

Em modalidades particulares, um modelo de reparo direcionado por homologia é projetado para servir como um modelo em recombinação homóloga, tal como dentro ou perto de uma sequência alvo cortada ou clivada por uma enzima (por exemplo, nuclease) de um sistema de edição de gene. Um polinucleotídeo modelo de reparo direcionado por homologia pode ser de qualquer comprimento adequado, tal como 10, 15, 20, 25, 50, 75, 100, 150, 200, 500, 1000, 2000, 3000, 4000, 5000 ou mais nucleotídeos. Em modalidades particulares, o polinucleotídeo modelo de reparo dirigido por homologia é complementar a uma porção de um polinucleotídeo incluindo a sequência alvo. Quando alinhado de maneira ideal, um polinucleotídeo modelo de reparo direcionado por homologia se sobrepõe a um ou mais nucleotídeos de uma sequência alvo (por exemplo, 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100 ou mais nucleotídeos).

Em modalidades particulares, o modelo de reparo direcionado por homologia pode incluir homologia suficiente para uma sequência genômica no local de clivagem, por exemplo, 70%, 80%, 85%, 90%, 95% ou 100% de homologia com as sequências de nucleotídeos que flanqueiam o local de clivagem, por exemplo, dentro de 50 bases ou menos do local de clivagem, por exemplo, dentro de 30 bases, dentro de 15 bases, dentro de 10 bases, dentro de 5 bases, ou imediatamente flanqueando o local de clivagem, para suportar HDR entre ele e a sequência genômica com a qual ele possui homologia. 25, 50, 100 ou 200 nucleotídeos ou mais de 200 nucleotídeos de homologia de sequência entre um modelo de reparo direcionado por homologia e uma sequência genômica direcionada (ou qualquer valor integral entre 10 e 200 nucleotídeos, ou mais) podem suportar HDR. Braços de homologia ou sequências de flanqueamento são geralmente idênticos à sequência genômica, por exemplo, à região genômica em que ocorre a quebra de fita dupla (DSB). No entanto, a identidade absoluta não é necessária.

Em modalidades particulares, o modelo de doador inclui uma sequência de ácido nucleico terapêutica heteróloga flanqueada por duas regiões de homologia, de modo que o reparo dirigido por homologia entre a região de DNA alvo e as duas sequências de flanqueamento resulta na inserção da sequência de ácido nucleico terapêutico heteróloga no alvo região.

Em alguns exemplos, os braços de homologia ou sequências de flanqueamento de modelos de reparo direcionados por homologia são assimétricos.

Conforme indicado, em modalidades particulares, os modelos de doadores incluem uma sequência de ácido nucleico terapêutica. As sequências de ácido nucleico terapêuticas podem incluir uma sequência de gene corrigida, uma sequência de gene completa e / ou um ou mais elementos reguladores associados à expressão do gene. Uma sequência de gene corrigida pode ser uma parte de um gene que requer correção ou pode fornecer uma cópia de substituição completa de um gene. Uma sequência de gene corrigida pode fornecer uma cópia completa de um gene, sem necessariamente substituir um gene defeituoso existente. Um versado na técnica reconhecerá que a remoção de um gene defeituoso ao fornecer uma cópia corrigida pode ou não ser necessária. Ao inserir um gene em um porto seguro genético, uma sequência de ácido nucleico terapêutica deve incluir uma região codificadora e todos os elementos reguladores necessários para sua expressão.

Exemplos de genes terapêuticos e produtos gênicos incluem proteína esquelética 4.1, glicoforina, p55, o alelo Duffy, genes da família da globina WAS phox distrofina piruvato quinase CLN3 ABCD1 arilsulfatase A SFTPB SFTPC NLX2.1 Genes da família ribossomal ABCA3 GATA1 PARK2 PARK TERT TERC DKC1 TINF2 CFTR2 PART TERT TERC DKC1 TINF2 TINF2 CFTR2 TINF2 CFRT TERC DKC1 PARK2 PARK2 TINF2 TERT TERC DKC1 PARK2 PARK2 PART2.1 ABCA3 TERC DKC1 TINF2 PARK2 PART2.1 ABCA3 TERC DKC1 TINF2 PARK2 TINF2 PART TERT TERC DKC1 PARK2 TINF2 ribossômico PAR2.1 ABCA3 TERC DKC1 TINF2 PARK2. PINK1 SNCA PSEN1 PSEN2 APP SOD1 TDP43 FUS ubiquilina 2 C9ORF72, α2β1 αvβ3 αvβ5 αvβ63 BOB / GPR15 Bonzo / STRL-33 / TYMSTR CCR2 CCR3 CCRS CCR8 CD4 CD4 CD46 CD55 CD55 CXCR4 ICR ICR-HAMeptidase-HAve B-H αVAMeptidase 1 distroglicano LDLR / α2MR / LRP PVR PRR1 / HveC, receptor de laminina, 101F6, 123F2, 53BP2, abl, ABLI, ADP, aFGF, APC, ApoAI, ApoAIV, ApoE, ATM, BAI-1, BDNF, Beta * (BLU), bFGF, BLC1, BLC6, BRCA1, BRCA2, CBFA1, CBL, C-CAM, CFTR, CNTF, COX-1, CSFIR, CTS-1, citosina desaminase, DBCCR-1, DCC, Dp, DPC-4, E1A, E2F , EBRB2, erb, ERBA, ERBB, ETS1, ETS2, ETV6, Fab, FancA, FancB, FancC, FancD1, FancD2, FancE, FancF, FancG, FancI, FancJ, FancL, FancM, FancN, FancO, FancP, FancR , FancS, FancT, FancU, FancV e FancW, FCC, FGF, FGR, FHIT, fms, FOX, FUS 1, FUS1, FYN, G-CSF, GDAIF, Gene 21, Gene 26, GM-CSF, GMF, gsp, HCR, HIC-1, HRAS, hst , IGF, IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11 IL-12, ING1, interferon α, interferon β, interferon γ, IRF-1, JUN, KRAS, LCK, LUCA-1, LUCA-2, LYN, MADH4, MADR2, MCC, mda7, MDM2, MEN-I, MEN-II, MLL , MMAC1, MYB, MYC, MYCL1, MYCN, neu, NF-1, NF-2, NGF, NOEY1, NOEY2, NRAS, NT3, NT5, OVCA1, p16, p21, p27, p53, p57, p73, p300, PGS , PIM1, PL6, PML, PTEN, raf, Rap1A, ras, Rb, RB1, RET, rks-3, ScFv, scFV ras, SEM A3, SRC, TALI, TCL3, TFPI, trombospondina, timidina quinase, TNF, TP53, trk, T-VEC, VEGF, VHL, VVT1, WT-1, YES, zac1, iduronidase, IDS, GNS, HGSNAT, SGSH, NAGLU, GUSB, GALNS, GLB1, ARSB, HYAL1, F8, F9, HBB, CYB5R3, γC, JAK3, IL7RA, RAG1, RAG2, DCLRE1C, PRKDC, LIG4, NHEJ1, CD3D, CD3E, CD3Z, CD3G, PTPRC, ZAP70, LCK, AK2, ADA, PNP, WHN, CHD7, ORAI1, STIM1, CÓRo RFXANK, RFX5, RFXAP, RMRP, DKC1, TERT, TINF2, DCLRE1B e SLC46A1.

Em modalidades particulares, um gene terapêutico inclui uma sequência de codificação para um produto de expressão terapêutica (por exemplo, proteína, RNA) e todos os elementos reguladores associados (por exemplo, promotores, etc.) para resultar na expressão do produto gênico.

Em modalidades particulares, uma sequência de ácido nucleico terapêutica (por exemplo, um gene) pode ser selecionada para incorporação em um GSH para fornecer a seleção in vivo da célula geneticamente modificada. Por exemplo, a seleção in vivo usando um interruptor de crescimento celular permite que uma pequena população de células geneticamente modificadas seja amplificada por indução. Uma estratégia para atingir a seleção in vivo tem sido empregar a seleção de drogas enquanto coexpressa um transgene que transmite quimiorresistência, como O6-metilguanina-DNA-metiltransferase (MGMT). Uma abordagem alternativa é conferir um potencial proliferativo aprimorado sobre HSC modificado por gene através da entrega do fator de transcrição homeobox HOXB4. Em modalidades particulares, um gene suicida pode ser incorporado na célula geneticamente modificada de modo que tal população de células possa ser eliminada, por exemplo, pela administração de um medicamento que ative o gene suicida. Veja, por exemplo, Cancer Gene Ther. 19 de agosto de 2012 (8): 523-9 PLoS One. 2013 8 (3): e59594. and Molecular Therapy — Oncolytics (2016) 3, 16011.

Modalidades particulares incluem o contato de uma célula sanguínea com um sistema de edição de gene capaz de inserir um modelo de doador em uma célula sanguínea alvo GSH. Em modalidades particulares, o sistema de edição de genes inclui crRNA capaz de hibridizar com uma sequência alvo dentro do GSH e um ácido nucleico que codifica uma enzima nuclease, como Cpf1 ou Cas9. Em modalidades particulares, as sequências de codificação Cas9 ou Cpf1 podem incluir SEQ ID NOs: 215-227. Em modalidades particulares, as sequências de aminoácidos Cas9 ou Cpf1 podem incluir SEQ ID NOs: 228-241.

Em uma modalidade exemplar particular, um sistema de edição de gene Cpf1 / crRNA foi projetado para direcionar a localização do porto seguro genômico (GSH) chr11: 67812349-67812375 (GSH) (FIG. 1). Os resultados de sequenciamento Sanger em K562 para este local apontaram uma mutação A & gtT em 15 bp após o local PAM (TTTG FIG. 2) que resultou em menor eficiência de corte nesta linha celular em comparação com células CD34 +. Também foi demonstrado que a eficiência de corte para o site TTTA PAM é maior do que TTTG ou TTTC. Portanto, outro local GSH foi identificado no cromossomo 11 (chr11: 67839126-67839150) com um local TTTA PAM que pode aumentar a eficiência de corte (FIG. 3). Além disso, uma tela SNP neste local não identificou nenhum SNP comum. Modelos de reparo direcionado por homologia (HT) também foram projetados. HTs sintetizados eram ssDNA de 100 pb com sítio de restrição NotI para a avaliação de HDR (FIGS. 1 e 3).

(III) Nanopartículas. Conforme indicado anteriormente, são necessários métodos de entrega de sistemas de edição de genes que não dependem de eletroporação ou vetores virais. Além de fornecer GSH e componentes de edição de genes de direcionamento associados, a divulgação atual também fornece nanopartículas projetadas que permitem a entrega dos componentes de edição de genes. As nanopartículas são projetadas para incluir todos os componentes para edição de genes direcionados, por exemplo, dentro de um GSH. Quando um uso terapêutico precisa apenas desativar um gene problemático, as nanopartículas precisam apenas ser associadas a um elemento de direcionamento e a um elemento de corte (embora outros componentes possam ser incluídos conforme necessário ou útil para uma finalidade específica). Quando um uso terapêutico adiciona ou corrige um gene, as nanopartículas são associadas a um elemento de direcionamento, um elemento de corte e um modelo de doador.

Modalidades particulares utilizam nanopartículas de metal coloidal. Um metal coloidal inclui qualquer partícula de metal insolúvel em água ou composto metálico disperso em água líquida. Um metal colóide pode ser uma suspensão de partículas de metal em solução aquosa. Qualquer metal que possa ser feito na forma coloidal pode ser usado, incluindo ouro, prata, cobre, níquel, alumínio, zinco, cálcio, platina, paládio e ferro. Em modalidades particulares, nanopartículas de ouro são usadas, por exemplo, preparadas a partir de HAuCl4. Em modalidades particulares, as nanopartículas são nanopartículas de ouro que são revestidas com ouro para fazer nanopartículas revestidas com ouro.

Métodos para fazer nanopartículas de metal coloidal, incluindo nanopartículas coloidais de ouro de HAuCl4, são conhecidos por aqueles versados ​​na técnica. Por exemplo, os métodos aqui descritos, bem como aqueles descritos em outro lugar (por exemplo, US 2001/005581 2003/0118657 e 2003/0053983) podem ser usados ​​para fazer nanopartículas.

Em modalidades exemplares particulares, AuNPs foram sintetizados em três intervalos de tamanho diferentes (15, 50, 100 nm) por um Turkevich otimizado e métodos de crescimento de semeadura (Shahbazi, et al., Nanomedicina (Lond), 2017. 12 (16): p . 1961-1973 Shahbazi, et al., Nanotechnology, 2017. 28 (2): p. 025103 Turkevich, et al. Discussions of the Faraday Society, 1951. 11 (0): p. 55-75 Perrault & amp Chan, Journal of the American Chemical Society, 2009. 131 (47): p. 17042-17043). Na primeira etapa, AuNPs de semente de 15 nm foram sintetizados trazendo 100 mL de solução 0,25 mM de cloreto de ouro (III) tri-hidratado ao ponto de ebulição e adicionando 1 mL de solução de citrato trissódico desidratado 3,33%. A síntese de nanopartículas foi realizada em altas velocidades de agitação ao longo de 10 min. As nanopartículas preparadas foram resfriadas a 4 ° C e utilizadas na etapa de crescimento seguinte.

A fim de preparar AuNPs em intervalos de tamanho de 50 nm e 100 nm, duas soluções diferentes de 100 mL de 0,25 mM de cloreto de ouro (III) tri-hidratado foram preparadas e em condições de agitação moderada 2440 μL e 304 μL de AuNPs de semente foram adicionados separadamente para sintetizar 50 nm e AuNPs de 100 nm, respectivamente. A estas soluções foi adicionado 1 mL de solução de citrato trissódico desidratado 15 mM e a mistura foi levada à velocidade de agitação mais elevada. Em seguida, foi adicionado 1 mL de solução de hidroquinona 25 mM e a síntese foi continuada durante 30 min para AuNPs de 50 nm e 5 h para AuNPs de 100 nm. Finalmente, as nanopartículas sintetizadas foram purificadas por centrifugação a 5000 × ge dispersão em água ultra-pura.

Embora AuNPs sejam particularmente descritos, as nanopartículas abrangidas na presente divulgação podem ser fornecidas em diferentes formas, por exemplo, como nanopartículas sólidas (por exemplo, metal, como prata, ouro, ferro, titânio), não metálico, sólidos à base de lipídios, polímeros, suspensões de nanopartículas ou combinações das mesmas. Nanopartículas de metal, dielétricas e semicondutoras podem ser preparadas, bem como estruturas híbridas (por exemplo, nanopartículas de núcleo-casca). Nanopartículas feitas de material semicondutor também podem ser rotuladas de pontos quânticos se forem pequenas o suficiente (normalmente abaixo de 10 nm) para que ocorra a quantização dos níveis de energia eletrônica. Essas partículas em nanoescala são usadas em aplicações biomédicas como carreadores de drogas ou agentes de imagem e podem ser adaptadas para fins semelhantes na presente divulgação.

Nanopartículas semissólidas e moles foram fabricadas e estão dentro do escopo da presente divulgação. Uma nanopartícula de natureza semissólida é o lipossoma. Vários tipos de nanopartículas de lipossomas são atualmente usados ​​clinicamente como sistemas de entrega de medicamentos e vacinas anticâncer. Nanopartículas com metade hidrofílica e a outra metade hidrofóbica são denominadas partículas de Janus e são particularmente eficazes para estabilizar emulsões. Eles podem se auto-montar em interfaces água / óleo e atuar como surfactantes sólidos.

Uma nanopartícula pode incluir qualquer material adequado, por exemplo, um material biocompatível. O material biocompatível pode ser um polímero. Polímeros de nanopartículas adequados incluem poliestireno, borracha de silicone, policarbonato, poliuretanos, polipropilenos, polimetilmetacrilato, cloreto de polivinila, poliésteres, poliéteres e polietileno.Exemplos de polímeros específicos incluem poli (caprolactona) (PCL), polímero de etileno vinil acetato (EVA), poli (ácido lático) (PLA), poli (L-ácido lático) (PLLA), poli (ácido glicólico) (PGA), poli (ácido lático-co-ácido glicólico) (PLGA), poli (L-ácido lático-ácido co-glicólico) (PLLGA), poli (D, L-lactídeo) (PDLA), poli (L-lactídeo) (PLLA ), poli (D, L-lactídeo-co-caprolactona), poli (D, L-lactídeo-co-caprolactona-co-glicolídeo), poli (D, L-lactídeo-co-PEO-co-D, L- lactídeo), poli (D, L-lactídeo-co-PPO-co-D, L-lactídeo), polialquil cianoacralato, poliuretano, poli-L-lisina (PLL), hidroxipropil metacrilato (HPMA), polietilenoglicol, poli-L- ácido glutâmico, poli (hidroxiácidos), poli anidridos, poliortoésteres, poli (ésteres amidas), poliamidas, poli (éteres éteres), policarbonatos, polialquilenos, tais como polietileno e polipropileno, polialquilenoglicóis, tais como poli (etilenoglicol) (PEG), polietilenimina (PEI), óxidos de polialquileno (PEO), tereftalatos de polialquileno, tais como poli (tereftalato de etileno), álcoois polivinílicos (PVA), éteres polivinílicos, ésteres polivinílicos, tais como poli (acetato de vinila), halogenetos de polivinila, tais como poli (cloreto de vinil) (PVC), polivinilpirrolidona, polissiloxanos, poliestireno (PS), poliuretanos, celuloses derivatizadas, tais como alquil celulose, hidroxialquil celulose, éteres de celulose, ésteres de celulose, nitro celuloses, hidroxipropilcelulose, carboximetilcelulose, polímeros de ácidos acrílicos, tais como poli (metil (met) acrilato) (PMMA), poli (etil (met) acrilato), poli (butil (met) acrilato), poli (isobutil (met) acrilato), poli (hexil (met) acrilato), poli (isodecil (met) acrilato), poli (lauril (met) acrilato), poli (fenil (met) acrilato), poli (acrilato de metila), poli ( isopropil acrilato), poli (isobutil acrilato), poli (octadecil acrilato) e copolímeros e suas misturas, polidioxanona e seus copolímeros, polihidroxialcanoatos, polipropileno fumarato, polioximetileno, poloxâmeros, poli (orto) ésteres, poli (ácido butírico) ácido), poli (lactídeo-co-caprolactona), carbonato de trimetileno e pol vinilpirrolidona.

Em modalidades particulares, a nanopartícula é uma nanopartícula de lipídeo. Uma nanopartícula de lipídio pode incluir um ou mais lipídios e um ou mais dos polímeros listados acima.

Os compostos lipidóides também são particularmente úteis na administração de componentes do sistema de edição de genes. Em modalidades particulares, compostos de aminoálcool lipidóide são combinados com componentes do sistema de edição de genes para serem entregues a uma célula ou um sujeito para formar micropartículas, nanopartículas, lipossomas ou micelas. Os componentes do sistema de edição de genes a serem administrados pelas partículas, lipossomas ou micelas podem ser um polinucleotídeo, proteína, peptídeo ou molécula pequena. Os compostos de aminoálcool lipidoides podem ser combinados com outros compostos de aminoálcoois lipidóides, polímeros (sintéticos ou naturais), surfactantes, colesterol, carboidratos, proteínas, lipídios, etc. para formar partículas.

Conforme representado na FIG. 6, o tamanho de um AuNP pode ser selecionado para afetar a biodistribuição dentro do corpo humano. Nanopartículas adequadas para uso na presente divulgação podem ter qualquer forma e podem variar em tamanho de 5 nm-1000 nm em tamanho, por exemplo, de 5 nm-10 nm, 5-50 nm, 5 nm-75 nm, 5 nm-40 nm, 10 nm-30 ou 20 nm-30 nm. As nanopartículas também podem ter um tamanho na faixa de 10 nm-15 nm, 15 nm-20 nm, 20 nm-25 nm, 25 nm-30 nm, 30 nm-35 nm, 35 nm-40 nm, 40 nm- 45 nm, ou 45 nm-50 nm, 50 nm-55 nm, 55 nm-60 nm, 60 nm-65 nm, 65 nm-70 nm, 70 nm-75 nm 75 nm-80 nm, 80 nm-85 nm , 85 nm-90 nm, 90 nm-95 nm, 95 nm-100 nm, 100 nm-105 nm, 105 nm-110 nm, 110 nm-115 nm, 115 nm-120 nm, 120 nm-125 nm, 125 nm-130 nm, 130 nm-135 nm, 135 nm-140 nm, 140 nm-145 nm, 145 nm-150 nm, 100 nm-500 nm, 100 nm-150 nm, 150 nm-200 nm, 200 nm- 250 nm, 250 nm-300 nm, 300 nm-350 nm, 350 nm-400 nm, 400 nm-450 nm ou 450 nm-500 nm. Em modalidades particulares, nanopartículas maiores que 550 nm são excluídas. Isso ocorre porque as partículas ou partículas agregadas de & gt600 nm não são passíveis de absorção celular.

Modalidades particulares também podem incluir nanopartículas associadas a moléculas de direcionamento. As moléculas de direcionamento podem ser usadas para direcionar a nanopartícula a uma célula específica, de modo que a atividade do sistema de edição de genes possa ser controlada espacial ou temporalmente. Por exemplo, a atividade e o destino do sistema de edição de genes podem ser controlados por uma molécula de direcionamento que tem afinidade de ligação para uma proteína da superfície celular ou outro componente celular localizado.

Em modalidades particulares, as moléculas de direcionamento incluem anticorpos ou seus domínios de ligação que resultam na entrega seletiva de nanopartículas para tipos de células selecionados. Em modalidades particulares, a entrega seletiva é exclusiva para uma população de células selecionada. Em modalidades particulares, pelo menos 65%, 70%, 75%, 80%, 85%, 90%, 95% ou 99% das nanopartículas administradas são entregues a uma população de células selecionada.

Em modalidades particulares, os domínios de ligação incluem ligantes de marcadores celulares, ligantes de receptor, anticorpos, peptídeos, aptâmeros de peptídeos, ácidos nucleicos, aptâmeros de ácido nucleico, spiegelmers ou combinações dos mesmos. No contexto de ligantes de direcionamento de células selecionados, os domínios de ligação incluem qualquer substância que se liga a outra substância para formar um complexo capaz de suportar a entrega seletiva.

Conforme indicado, "anticorpos" são um exemplo de domínios de ligação e incluem anticorpos inteiros ou fragmentos de ligação de um anticorpo, por exemplo, Fv, Fab, Fab ′, F (ab ′)2, Fc e fragmentos Fv de cadeia simples (scFvs) ou quaisquer fragmentos biologicamente eficazes de uma imunoglobulina que se ligam especificamente a um motivo expresso por um tipo de célula selecionado. Os anticorpos ou fragmentos de ligação ao antígeno incluem todos ou uma parte dos anticorpos policlonais, anticorpos monoclonais, anticorpos humanos, anticorpos humanizados, anticorpos sintéticos, anticorpos quiméricos, anticorpos biespecíficos, minicorpos e anticorpos lineares.

Os anticorpos de origem humana ou anticorpos humanizados diminuíram ou não têm imunogenicidade em humanos e têm um número menor de epítopos não imunogênicos em comparação com os anticorpos não humanos. Os anticorpos e seus fragmentos serão geralmente selecionados para terem um nível reduzido de antigenicidade em sujeitos humanos.

Em modalidades particulares, HSCs são direcionados para entrega seletiva de nanopartículas. Em modalidades particulares, HSCs são direcionados para entrega seletiva com domínios de ligação que se ligam seletivamente a CD34 e CD90. Em modalidades particulares, HSC pode ser direcionado para entrega seletiva com um ou mais domínios de ligação que se ligam seletivamente a antígenos conhecidos expressos na superfície de HSCs e HSPCs: CD34, CD46, CD90, CD133, Sca-1 e / ou CD117.

As células T maduras podem ser direcionadas para entrega seletiva com domínios de ligação que se ligam seletivamente a CD3. As células T ativadas podem ser direcionadas para entrega seletiva com domínios de ligação que se ligam seletivamente a 4-1BB (CD137), CD69 e / ou CD25. As células T auxiliares podem ser direcionadas para distribuição seletiva com domínios de ligação que se ligam seletivamente a CD4. As células T citotóxicas podem ser direcionadas para distribuição seletiva com domínios de ligação que se ligam seletivamente a CD8. As células T de "memória central" (ou "TCM") podem ser direcionadas para entrega seletiva com domínios de ligação que se ligam seletivamente a CD62L, CCR7, CD25, CD127, CD45RO e / ou CD95. A célula T de "memória efetora" (ou "TEM") pode ser direcionada para distribuição seletiva com domínios de ligação que se ligam seletivamente a granzima B e / ou perforina. As células T regulatórias ("TREG") podem ser direcionadas para entrega seletiva com domínios de ligação que se ligam seletivamente a CD25, CTLA-4, GITR, GARP e / ou LAP. As células T "ingênuas" podem ser direcionadas para entrega seletiva com domínios de ligação que se ligam seletivamente a CD62L, CCR7, CD28, CD127 e / ou CD45RA.

As células assassinas naturais (também conhecidas como células NK, células K e células assassinas) podem ser direcionadas para entrega seletiva com domínios de ligação que se ligam seletivamente a CD8, CD16 e / ou CD56.

Os macrófagos (e seus precursores, monócitos) podem ser direcionados para distribuição seletiva com domínios de ligação que se ligam seletivamente a CD11b, F4 / 80 CD68 CD11c IL-4Rα e / ou CD163.

Células dendríticas imaturas (ou seja, pré-ativação) podem ser direcionadas para entrega seletiva com domínios de ligação que se ligam seletivamente: CD1a, CD1b, CD1c, CD1d, CD21, CD35, CD39, CD40, CD86, CD101, CD148, CD209 e / ou DEC-205.

As células B podem ser direcionadas para entrega seletiva com domínios de ligação que se ligam seletivamente a CD5, CD19, CD20, CD21, CD22, CD35, CD40, CD52 e / ou CD80.

O antígeno 1 associado à função linfocitária (LFA-1) é expresso por todas as células T, células B e monócitos / macrófagos. Consequentemente, os ligantes de direcionamento de células selecionados podem ligar LFA-1 para alcançar a entrega seletiva de nanopartículas para células T, células B e monócitos / macrófagos.

Em modalidades particulares, uma molécula de direcionamento pode ser responsiva a, ou seja, ativada ou inativada por, um efetor na ou dentro da célula. Em modalidades particulares, outros componentes dentro de uma sequência podem incluir nucleotídeos reguladores, como um elemento promotor, um pequeno RNA de interferência ou grampo de cabelo ou um microRNA para controlar a expressão de outro gene na mesma célula, ou um código de barras de DNA para rastreamento celular.

Os aptâmeros podem ser concebidos para facilitar a entrega seletiva, incluindo a entrega através da membrana celular, para compartimentos intracelulares ou para o núcleo. Tal estrutura pode incluir, além de um ou mais aptâmero (s) ou sem tal um ou mais aptâmero (s), fração (s) de modo a tornar o guia entregável, indutível ou responsivo a (por exemplo ativável ou inativável por) um efetor selecionado, por exemplo, responde a condições fisiológicas normais ou patológicas, incluindo, sem limitação, pH, hipóxia, O2 concentração, temperatura, concentração de proteína, concentração enzimática, estrutura lipídica, exposição à luz, interrupção mecânica (por exemplo, ondas de ultrassom), campos magnéticos, campos elétricos ou radiação eletromagnética. Métodos de preparação de aptâmeros e conjugação de tais aptâmeros à superfície de uma nanopartícula são conhecidos na técnica, ver, por exemplo, Huang et al. Anal. Chem., 2008, 80 (3), pp 567-572.

Em modalidades particulares, uma sequência de aptâmero de RNA tem afinidade de ligação para um ligante de aptâmero na ou na célula. Em modalidades particulares, o ligante de aptâmero está na célula, por exemplo, de modo que esteja pelo menos parcialmente disponível na face extracelular ou no lado da membrana celular. Por exemplo, o ligante de aptâmero pode ser uma proteína da superfície celular. O ligante de aptâmero pode, portanto, ser uma parte de uma proteína de fusão, uma outra parte da proteína de fusão tendo uma âncora de membrana ou domínio que abrange a membrana. Em modalidades particulares, o ligante de aptâmero está na célula. Por exemplo, o ligante de aptâmero pode ser internalizado dentro de uma célula, isto é, dentro (além) da membrana celular, por exemplo, no citoplasma, dentro de uma organela (incluindo mitocôndrias), dentro de um endossoma ou no núcleo. Em modalidades particulares, um aptâmero pode incluir uma sequência de modelo de doador, que pode incluir um modelo de HDR e uma sequência de ácido nucleico terapêutica.

(IV) Conjugação de componentes ativos em nanopartículas. Conforme indicado, uma variedade de componentes ativos podem ser conjugados às nanopartículas aqui divulgadas para edição de genes direcionados. Por exemplo, os ácidos nucleicos que são componentes do sistema de edição de genes podem ser conjugados direta ou indiretamente, e covalentemente ou não covalentemente, à superfície da nanopartícula. Por exemplo, um ácido nucleico pode ser ligado covalentemente em uma extremidade do ácido nucleico à superfície da nanopartícula.

Os ácidos nucleicos conjugados com a nanopartícula podem ter um comprimento de 10 nucleotídeos (nt) -1000 nt, por exemplo, 1 nt-25 nt, 25 nt-50 nt, 50 nt-100 nt, 100 nt-250 nt, 250 nt- 500 nt, 500 nt-1000 nt ou superior a 1000 nt. Em modalidades particulares, os ácidos nucleicos modificados por conjugação a um ligante não excedem 50 nt ou 40 nt de comprimento.

Quando conjugado indiretamente através, por exemplo, de um ligante intermediário, qualquer tipo de molécula pode ser usado como um ligante. Por exemplo, um ligante pode ser uma cadeia alifática incluindo pelo menos dois átomos de carbono (por exemplo, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 ou mais átomos de carbono), e pode ser substituído por um ou mais grupos funcionais, incluindo uma cetona, éter, éster, amida, álcool, amina, ureia, tioureia, sulfóxido, sulfona, sulfonamida e / ou dissulfeto.

Em modalidades particulares, o ligante inclui um dissulfeto na extremidade livre (por exemplo, a extremidade não conjugada ao RNA guia) que acopla a superfície da nanopartícula. Em modalidades particulares, o dissulfeto é um C2-C10 dissulfeto, isto é, pode ser uma cadeia alifática que termina em um dissulfeto que inclui 2, 3, 4, 5, 6, 7, 8, 9 ou 10 átomos de carbono, embora seja previsto que cadeias alifáticas mais longas possam ser usadas. Em modalidades particulares, o dissulfeto é um dissulfeto de 3 carbonos (C3 S — S). Os ligantes podem ter grupos sulfidrila (SH) ou grupos dissulfeto (S — S) ou um número diferente de átomos de enxofre. Em modalidades particulares, uma modificação de tiol pode ser introduzida sem o uso de um ligante. Em modalidades particulares, uma enzima de nuclease é entregue como uma proteína pré-conjugada com seu RNA guia (um complexo de ribonucleoproteína (RNP)). Nesta formulação, a molécula de RNA guia está ligada à nanopartícula e a enzima nuclease, por padrão, também pode ser ligada (ver, por exemplo, FIGS. 7B e 7D).

Um avanço aqui divulgado é a capacidade de modificar componentes CRISPR para ligação a uma nanopartícula. Isso ocorre porque a maioria das modificações nos componentes CRISPR pode comprometer a eficiência de corte. Por exemplo, Li et al. (Engenharia CRISPR-Cpf1 crRNAs e mRNAs para maximizar a eficiência de edição do genoma. 2017. 1: p. 0066) indicou que a extremidade 5 'do Cpf1 crRNA não é segura para qualquer modificação porque tais modificações resultam na revogação da ligação do crRNA ao Cpf1 nuclease. É divulgada aqui uma modificação na extremidade 3 'do crRNA que não compromete a eficiência de corte. Em modalidades particulares, na primeira etapa de conjugação a uma nanopartícula, a extremidade 3 ′ do crRNA é modificada com um espaçador hexa-etilenoglicol de 18 átomos (espaçador de 18) e dissulfeto de 3 carbono (C3 S-S) para anexar o crRNA a a superfície de AuNPs.

Com base no exposto, em modalidades particulares, por exemplo, quando a nanopartícula inclui ouro, um ligante pode ser qualquer molécula contendo tiol. A reação de um grupo tiol com Au resulta em uma ligação sulfeto covalente (—S—). AuNPs têm alta afinidade para grupos tiol (-SH) e ditiol (S-S) e ligações semicovalentes ocorrem entre a superfície de AuNP e grupos de enxofre (Hakkinen, Nat Chem, 2012. 4 (6): p. 443-455 ) Em modalidades particulares, grupos tiol podem ser adicionados a ácidos nucleicos para facilitar a ligação à superfície de AuNPs. Esta abordagem pode melhorar a absorção e estabilidade do ácido nucleico (ver, por exemplo, Mirkin, et al., A Nature, 1996. 382 (6592): p. 607-609).

Usando um método otimizado de duas etapas de crescimento de semeadura, AuNPs altamente monodispersos foram sintetizados em 3 intervalos de tamanho diferentes (15 nm, 50 nm, 100 nm) e conjugados com Cpf1 crRNA e endonuclease (FIGS. 7B, 7D, 100). Por causa da forte repulsão eletrostática entre a superfície carregada negativamente e o crRNA carregado negativamente, é difícil anexar o crRNA à superfície dos AuNPs sem, por exemplo, a modificação do tiol. Em modalidades particulares, na segunda etapa, após a purificação dos AuNPs conjugados com crRNA, a endonuclease Cpf1 é adicionada e incubada com AuNPs conjugados com crRNA para facilitar sua ligação ao identificador 5 ′ do crRNA (Dong, et al., Nature, 2016. 532 (7600): p. 522-526). A estrutura compacta da nanoformulação projetada contendo crRNA e endonuclease Cpf1 resulta em uma conformação que aumenta a estabilidade contra agentes degradantes e facilita a absorção da nanoformulação AuNP / CRISPR pelas células devido a uma carga neutra geral (isto é, potencial zeta). Embora tenha sido dada relevância especial à otimização da nanoformulação divulgada para CRISPR / Cpf1, o mesmo conceito pode ser aplicado a outras classes CRISPR. Além disso, juntamente com o crRNA e a endonuclease Cpf1, o DNA de fita simples modificado com tiol 18 espaçador (ssDNA) pode ser anexado à superfície de AuNPs para obter uma nova nanoformulação com o objetivo de ser usado em reparo dirigido por homologia (HDR).

Em modalidades particulares, um ligante espaçador-tiol pode ser adicionado às próprias proteínas Cpf1 ou Cas9 ou variantes manipuladas das anteriores (por exemplo, conforme descrito abaixo), por adição de um resíduo de cisteína no terminal N ou C . A proteína nuclease pode então ser adicionada como uma primeira camada na superfície da nanopartícula de ouro. Este ligante espaçador-tiol pode aumentar a estabilidade da proteína e aumentar a eficiência de corte. Em modalidades particulares, um complexo de RNA é formado entre crRNA e nuclease e, em seguida, ligado à superfície de nanopartículas de ouro por meio de um ligante espaçador-tiol.

Conforme indicado anteriormente, adicionar componentes de edição de genes de origem bacteriana como uma primeira etapa de carregamento pode fornecer proteção benéfica desses componentes após a administração a um sujeito com imunidade pré-existente ao componente. A blindagem pode ser devido a outros componentes de edição de genes (por exemplo, modelos de doadores) e não precisa depender de um invólucro de polímero protetor. Em modalidades particulares, um invólucro de polímero é excluído. Em modalidades particulares, a blindagem pode permitir a administração in vivo em série.

Em modalidades particulares, crRNAs podem ser adicionados a AuNPs em diferentes razões AuNP / crRNA p / p (0,25, 0,5, 1, 1,5, 2, 3, 4, 5, 6) e misturados. O tampão citrato com pH 3 pode ser adicionado à mistura na concentração de 10 mM para rastrear a repulsão negativa entre crRNA carregado negativamente e AuNP. Após agitação por 5 min, as nanopartículas podem ser centrifugadas e o crRNA não ligado pode ser visualizado por eletroforese em gel de agarose. Depois de determinar a concentração de conjugação ideal, 1 μL de 63 μM de nuclease Cpf1 pode ser adicionado à solução AuNP / crRNA e incubado por 20 min.

É importante ressaltar que o uso de um tampão de citrato oferece vantagens significativas na fabricação. Métodos anteriores basearam-se no uso de NaCl para rastrear a superfície das nanopartículas com carga negativa e reduzir a repulsão de DNA com carga negativa semelhante. No entanto, o NaCl pode causar agregação irreversível de nanopartículas de ouro, por isso deve ser adicionado gradualmente ao longo do tempo com mudanças incrementais na concentração. Geralmente, o NaCl deve ser adicionado ao longo de um período de 48 horas para evitar a agregação. Quando o tampão citrato é usado com pH 3, essa ligação pode acontecer com maior eficiência em menos de 3 minutos. Zhang, et al. (2012). Journal of the American Chemical Society 134 (17): 7266-7269 reduzindo o custo dos produtos e o tempo nas instalações de fabricação de GMP.

O tamanho e a morfologia das nanoformulações AuNP / CRISPR preparadas podem ser caracterizados por imagem em microscópio eletrônico de transmissão (TEM). AuNPs (4 μL) podem ser adicionados a grades de cobre e secar durante a noite. A imagem é realizada a 120 kV.

O revestimento CRISPR pode ser visualizado por microscopia eletrônica de coloração negativa.Nanoformulação AuNP / CRISPR pode ser corada com 0,7% de formato de uranila e 2% de acetato de uranila, respectivamente. A amostra corada (4 μL) pode ser adicionada à grade de cobre revestida com carbono e incubada por 1 min e manchada com um pedaço de papel de filtro. Após três ciclos de lavagem com 20 μl de solução de corante, 4 μl de solução de corante podem ser adicionados às grades e secar ao ar.

Além disso, nanoformulações AuNP / CRISPR podem ser caracterizadas por espectrofotômetro Nanodrop UV-visível, analisando os desvios no pico de ressonância plasmônica de superfície localizada (LSPR) dos AuNPs antes e após a conjugação com componentes CRISPR.

Em modalidades particulares, uma nanopartícula é em camadas, tal como durante a síntese para incluir PEI ou outro polímero carregado positivamente para aumentar a área de superfície e conjugar ssDNA maiores ou outras moléculas, tais como moléculas de direcionamento e / ou modelos de doadores grandes (ver, por exemplo, a FIG . 7C). Esta nanoformulação pode ser preparada em uma forma de camada por camada e polímeros carregados positivamente (como PEI em diferentes formas e pesos moleculares) podem ser usados ​​para revestir a superfície carregada negativamente de nanopartículas de ouro ou nanopartículas de ouro revestidas com CRISPR para anexar qualquer componente de edição de gene e outros componentes (tais como domínios de ligação de anticorpos). A estratificação aumenta essencialmente a área de superfície da nanopartícula disponível para moléculas de conjugação, como grandes oligonucleotídeos com ou sem outras proteínas.

Em modalidades particulares, PEI pode ser adicionado como uma segunda camada e ssDNA pode ser adicionado como uma terceira camada. Alternativamente, as etapas de conjugação podem ser alteradas adicionando ssDNA como uma segunda camada e PEI como uma terceira camada. Em modalidades particulares, PEI, polímeros e ssDNA não estão incluídos como uma primeira camada, uma vez que esta camada pode ser reservada para complexos RNP acoplados a ligantes.

Em modalidades particulares, uma nanoformulação de múltiplas camadas da divulgação tem um tamanho médio de 25-30 nm e é altamente monodispersa. Imagens de microscópio eletrônico de transmissão (TEM) e deslocamentos de ressonância plasmônica de superfície localizada (LSPR) de nanopartículas de ouro (AuNPs) mostraram um revestimento de superfície uniforme sem qualquer agregação (FIGS. 9A, 9B). Dada a natureza sintética de todo o sistema de distribuição, todos os componentes podem ser montados em poucas horas, ao contrário das abordagens anteriores que exigiam vários dias devido, por exemplo, ao uso de NaCl como tela de carga.

Conforme mostrado nas FIGS. 7D e 9A, as nanopartículas sintetizadas eram altamente monodispersas e o revestimento bem sucedido de 4 nm sem qualquer agregação foi alcançado, o que aumentou o tamanho das nanopartículas para 54 nm após o revestimento para AuNPs de 50 nm. Além disso, a diminuição na intensidade e deslocamento para o vermelho do plasmon de superfície localizada (LSPR) de AuNPs mostrou a conjugação bem-sucedida com componentes CRISPR sem qualquer agregação (FIG. 9A). Além disso, os estudos de carregamento de oligonucleotídeo com o espaçador modelo 18 C3 S-S ssDNA modificado em diferentes razões AuNP / ssDNA p / p mostraram que a razão de 6 é ideal para realizar a conjugação (FIG. 9C). Usando esta taxa de carregamento ideal, o crRNA foi carregado na superfície de AuNPs na concentração de 30 μg / mL (FIG. 9D). Esses dados ajudam a calcular a dosagem exata de aplicação para estudos de edição de genes.

As abordagens descritas resultaram em uma nanoformulação CRISPR altamente potente, carregada, capaz de distribuir ribonucleoproteínas CRISPR Cpf1 ou CRISPR Cas9 sintéticas, não quimicamente modificadas, juntamente com um modelo de homologia de ssDNA para inserção de novo DNA, sem a necessidade de eletroporação (FIG. 7D ) Em modalidades particulares, o tamanho hidrodinâmico de um AuNP totalmente carregado é 150-190 nm, 160-185 nm, 170-180 nm ou 176 nm.

(V) Eficiência de edição de genes. As concentrações ideais de crRNA, hAsCpf1 RNA e ssODN para eletroporação foram determinadas em células K562. A concentração ideal exibe a maior viabilidade e expressão de GFP. As células K562 foram cultivadas em placas de 24 poços em 1 x 10 5 células / concentração de poço. O meio de Dulbecco modificado da Iscove (IMDM) com 10% de FBS e 1% de PenStrep foi usado para a cultura das células. As células CD34 + foram cultivadas em placas de 24 poços em 5 x 10 5 células / concentração de poço. As condições de cultura para células CD34 + foram as mesmas que as células K562 com fatores de crescimento necessários. Nanoformulações AuNP / CRISPR foram adicionadas aos poços em concentração de 25 nM e a eficiência de edição foi avaliada após 48 h de incubação. A eletroporação das células foi realizada com um Harvard Apparatus ECM 830 Square Wave Electroporation System usando BTX Express Solution (EUA). em cubetas de 1 mm com duração de pulso de 250 V e 5 ms. Foram utilizadas cuvetes BTX de 1 mm com uma largura de lacuna de 2 mm para eletroporar 1-3 milhões de células K562 a 250 V durante 5 milissegundos. As células foram ressuspensas em meio de cultura e analisadas após eletroporação.

Nanoformulações AuNP / CRISPR visando o local chr11: 67812349-67812375 foram capazes de cortar com sucesso o local alvo em concentrações muito baixas de crRNA e endonuclease Cpf1 (25 nM) em comparação com o método de eletroporação em que uma quantidade maior de crRNA e Cpf1 foi usada (126 nM) (FIG. 12A) para atingir a mesma eficiência de corte. A eficiência de corte para este local foi baixa devido à mutação A & gtT 15 bp após o local PAM (FIG. 2). No teste seguinte, o mesmo local foi direcionado em células CD34 + primárias e foi mostrado que nanoformulações AuNP / CRISPR foram capazes de direcionar o local em concentrações muito baixas de crRNA e endonuclease Cpf1 com eficiência de corte muito boa sem aumentar quaisquer efeitos tóxicos (FIGS . 12B, 12C e 14) Infelizmente, a eletroporação das células CD34 + primárias afetou adversamente a viabilidade das células e nenhum corte foi visto para as células eletroporadas. A concentração calculada para nanoformulação AuNP / CRISPR foi 5 vezes menor do que a concentração necessária para o método de eletroporação (FIG. 12D). Conforme mencionado anteriormente por Kim et al. (Nat Biotechnol, 2016. 34 (8): p. 863-8), a taxa de deleções para inserções foi maior com o sistema de edição de gene CRISPR Cpf1 (FIG. 14).

Como mostrado na FIG. 16, a entrega de gene mediada por AuNP melhora o desempenho de Cas9, no entanto, Cpf1 é melhor para HDR. As células tratadas com AuNP demonstraram maior viabilidade em comparação com as células eletroporadas. Para Cas9, a entrega mediada por AuNP melhorou a edição total e HDR, em relação à eletroporação. Para Cpf1 entregue sem um modelo de reparo direcionado por homologia (HDT), a eletroporação resultou em maior edição de gene total (indels). Isso sugere que a própria eletroporação pode impactar a via de reparo usada ou a frequência de corte Cpf1 no local de destino. A adição de HDT à formulação Cpf1 melhorou a edição total e resultou nas taxas de HDR mais altas. Juntos, esses dados sugerem que a formulação totalmente carregada de AuNP + Cpf1 / crRNA + HDT resulta nas taxas mais altas de HDR com formação mínima de indel. Isso é ideal para uma série de loci alvo para edição de genes.

A microscopia confocal demonstrou que as nanoformulações divulgadas evitaram o aprisionamento lisossomal e foram localizadas com sucesso no núcleo de células hematopoéticas primárias CD34 + de doadores saudáveis. Frequências de knock-in de até 10% foram demonstradas usando um modelo de enzima de restrição NotI com comprimentos de braço de homologia de ± 40 nucleotídeos para um locus CCR5 sem citotoxicidade. Projetar o molde para a fita de DNA não alvo rendeu uma maior eficiência de reparo dirigido por homologia (HDR) (FIG. 13), com bandas de corte claras de 447 pb e 316 pb após digestão com as enzimas NotI e T7E1 (FIG. 20B). A comparação direta da atividade de nuclease Cpf1 e Cas9 no mesmo local alvo CCR5 demonstrou um viés Cpf1 para HDR e knock-in de modelo sobre Cas9, que gerou indels preferencialmente. O xenotransplante de células CD34 + humanas tratadas com nanoformulação CRISPR Cpf1 em camundongos imunodeficientes demonstrou uma tendência de aumento precoce no enxerto em comparação com células não tratadas, sugerindo um benefício desconhecido das HSPCs tratadas com nanoformulação. A frequência de enxerto de células geneticamente modificadas de CCR5 foi a mesma observada em cultura, com 10% das células humanas exibindo adição de modelo NotI in vivo.

(VI) Composições de nanopartículas e formulações celulares. As nanopartículas aqui divulgadas podem ser formuladas em composições para administração a sujeitos.

Em modalidades particulares, as células sanguíneas podem ser obtidas de um sujeito ou doador e geneticamente modificadas (por exemplo, dentro de um GSH) antes da administração ao sujeito para tratar uma condição. Fontes comuns de células sanguíneas apropriadas incluem amostras de sangue periférico mobilizado, amostras de medula óssea e / ou sangue do cordão umbilical.

Transportadores exemplares para composições de nanopartículas e / ou formulações de células incluem soro fisiológico, soro fisiológico tamponado, soro fisiológico, água, solução de Hanks, solução de Ringer, Nonnosol-R (Abbott Labs), Plasma-Lyte A® (Baxter Laboratories, Inc., Morton Grove , III.), Glicerol, etanol e suas combinações. Em modalidades particulares, composições de nanopartículas e / ou formulações de células são administradas a sujeitos assim que razoavelmente possível após sua formulação inicial.

Em modalidades particulares, os transportadores podem ser suplementados com albumina de soro humano (HSA) ou outros componentes de soro humano ou soro bovino fetal ou componentes de soro de outras espécies. Em modalidades particulares, um transportador para infusão inclui solução salina tamponada com 5% de HSA ou dextrose. Agentes isotônicos adicionais incluem álcoois de açúcar poli-hídricos incluindo álcoois de açúcar tri-hídricos ou superiores, tais como glicerina, eritritol, arabitol, xilitol, sorbitol ou manitol.

Os transportadores podem incluir agentes tamponantes, tais como tampões de citrato, tampões de succinato, tampões de tartarato, tampões de fumarato, tampões de gluconato, tampões de oxalato, tampões de lactato, tampões de acetato, tampões de fosfato, tampões de histidina e / ou sais de trimetilamina.

Estabilizadores referem-se a uma ampla categoria de excipientes que podem variar em função de um agente de volume a um aditivo que ajuda a prevenir a aderência do componente às paredes do recipiente. Estabilizantes típicos podem incluir aminoácidos de álcoois de açúcar poli-hídricos, como arginina, lisina, glicina, glutamina, asparagina, histidina, alanina, ornitina, L-leucina, 2-fenilalanina, ácido glutâmico e açúcares orgânicos de treonina ou álcoois de açúcar, como lactose , trealose, estaquiose, manitol, sorbitol, xilitol, ribitol, mioinisitol, galactitol, glicerol e ciclitóis, tais como polímeros de aminoácido inositol PEG agentes redutores contendo enxofre, tais como ureia, glutationa, ácido tiocerol, tioglicolato de sódio, tioglicolato de sódio, tioglicolato -monotioglicerol e polipeptídeos de baixo peso molecular de tiossulfato de sódio (isto é, & lt10 resíduos), proteínas como HSA, albumina de soro bovino, gelatina ou imunoglobulinas, polímeros hidrofílicos, como monossacarídeos de polivinilpirrolidona, como xilose, manose, maltose e dissacarídeos de glicose trissacarídeos de sacarose, como rafinose, e polissacarídeos, como dextrano.

Quando necessário ou benéfico, as composições de nanopartículas e / ou formulações de células podem incluir um anestésico local, como a lidocaína para aliviar a dor no local da injeção.

Quantidades terapeuticamente eficazes de nanopartículas dentro de uma composição podem incluir pelo menos 0,1% p / v ou p / p partículas pelo menos 1% p / v ou p / p partículas pelo menos 10% p / v ou p / p partículas pelo menos 20% w / v ou w / w partículas pelo menos 30% w / v ou w / w partículas pelo menos 40% w / v ou w / w partículas pelo menos 50% w / v ou w / w partículas pelo menos 60% w / v ou w / w partículas pelo menos 70% w / v ou w / w partículas pelo menos 80% w / v ou w / w partículas pelo menos 90% w / v ou w / w partículas pelo menos 95% w / v ou w / w partículas ou pelo menos 99% w / v ou w / w partículas.

Quantidades terapeuticamente eficazes de células dentro de formulações baseadas em células podem ser maiores do que 10 2 células, maiores do que 10 3 células, maiores do que 10 4 células, maiores do que 10 5 células, maiores do que 10 6 células, maiores do que 10 7 células, maiores do que 10 8 células, mais de 10 9 células, mais de 10 10 células ou mais de 10 11 células.

As composições de nanopartículas e / ou formulações de células aqui divulgadas podem ser preparadas para administração por, por exemplo, injeção, infusão, perfusão ou lavagem.

Em modalidades particulares, pode ser necessário ou benéfico liofilizar uma composição de nanopartículas e / ou criopreservar uma formulação à base de células. Tais técnicas são bem conhecidas dos versados ​​na técnica.

(VII) Métodos de uso exemplares. As células-tronco hematopoéticas (HSC) são células-tronco que podem dar origem a todos os tipos de células sanguíneas, como os glóbulos brancos do sistema imunológico (por exemplo, células T que combatem vírus e células B produtoras de anticorpos) e glóbulos vermelhos. A administração terapêutica de HSC pode ser usada para tratar uma variedade de condições adversas, incluindo doenças de imunodeficiência, distúrbios do sangue, cânceres malignos, infecções e exposição à radiação (por exemplo, tratamento de câncer, acidental ou baseado em ataque). Como exemplos, mais de 80 doenças de imunodeficiência primária são reconhecidas pela Organização Mundial da Saúde. Essas doenças são caracterizadas por um defeito intrínseco do sistema imunológico no qual, em alguns casos, o corpo é incapaz de produzir anticorpos suficientes contra a infecção. Em outros casos, as defesas celulares para combater infecções não funcionam adequadamente. Normalmente, as deficiências imunológicas primárias são doenças hereditárias.

Exemplos de doenças que podem ser tratadas usando as composições de nanopartículas ou formulações de células da divulgação incluem um distúrbio monogenético do sangue, hemofilia, doença de Grave, artrite reumatóide, anemia perniciosa, esclerose múltipla (MS), doença inflamatória intestinal, lúpus eritematoso sistêmico (SLE) , Síndrome de Wiskott-Aldrich (WAS), doença granulomatosa crônica (CGD), doença de Battens, adrenoleucodistrofia (ALD) ou leucodistrofia metacromática (MLD), distrofia muscular, proteinose aveolar pulmonar (PAP), deficiência de piruvato quinase, anemia de Shwachmann-Diamond-Blackfan , disqueratose congênita, fibrose cística, doença de Parkinson, doença de Alzheimer, esclerose lateral amiotrófica (doença de Lou Gehrig), leucemia linfoblástica aguda (LLA), leucemia mielóide aguda (LMA), metaplasia mielóide agnogênica, amegacariocitose / teletrombocitopenia, atopenia talassemia maior, CLL, leucemia mielóide crônica (CML), leucemia mielomonocítica crônica, variação comum deficiência imunológica ble (CVID), distúrbios do complemento, agamaglobulinemia congênita (ligada ao X), linfo-histiocitose eritrofagocítica familiar, linfoma de Hodgkin, síndrome de Hurler, hiper IgM, deficiência de subclasse de IgG, leucemia mielomonocítica juvenil, linfoma mielomonocítico juvenil, linfoma muco-polissacaridose, linfoma mielossacaridose múltiplo , hemoglobinúria paroxística noturna (HPN), doenças de imunodeficiência primária com deficiência de anticorpos, aplasia eritrocitária pura, anemia refratária, deficiência seletiva de IgA, anemia aplástica grave, DF e / ou deficiência de anticorpos específicos.

Modalidades particulares incluem o tratamento de infecções bacterianas e / ou parasitárias. Um parasita exemplar inclui o causador da malária Plasmodium.

As composições e formulações divulgadas neste documento podem ser usadas para tratar sujeitos (humanos, animais veterinários (cães, gatos, répteis, pássaros, etc.), gado (cavalos, gado, cabras, porcos, galinhas, etc.) e animais de pesquisa ( macacos, ratos, camundongos, peixes, etc.). Em modalidades particulares, os sujeitos são pacientes humanos. As nanopartículas aqui descritas podem ser personalizadas para qualquer alvo, enquanto os locais de GSH são específicos para humanos e primatas não humanos.

O tratamento de indivíduos inclui a distribuição de quantidades terapeuticamente eficazes. Quantidades terapeuticamente eficazes incluem aquelas que fornecem quantidades eficazes, tratamentos profiláticos e / ou tratamentos terapêuticos.

Uma "quantidade eficaz" é a quantidade de uma formulação necessária para resultar em uma mudança fisiológica desejada em um sujeito. Quantidades efetivas são freqüentemente administradas para fins de pesquisa.

Ensaio para a funcionalidade HSPC. O ensaio mais robusto para a funcionalidade HSPC é a capacidade de reconstituir a hematopoiese em um receptor condicionado. Em modalidades particulares, HSPC humanos são xenotransplantados após eletroporação de um par CRISPR / Cpf1 ideal e combinação de ssODN em camundongos nulos neonatais NOD / SCID (NSG) irradiados de forma subletal. A hematologia, o enxerto e a persistência das células GFP + são então monitorados por citometria de fluxo em linhagens de células sanguíneas e tempo de 20 semanas após o transplante. O DNA genômico (gDNA) também é isolado do sangue, BM e baço de animais transplantados no momento da necropsia para sequenciamento de código de barras de DNA para determinar o número de clones que contribuem para a hematopoiese de células GFP + observada in vivo. Os animais que recebem HSPC modificado com CRISPR / Cpf1 e ssODN são monitorados para células GFP + por citometria de fluxo em linhagens de células sanguíneas e tempo. O DNA genômico (gDNA) é isolado do sangue, BM e baço de animais transplantados no momento da necropsia para sequenciamento de código de barras de DNA para determinar o número de clones que contribuem para a hematopoiese de células GFP + observada in vivo, além de uma avaliação mais completa da formação de indel e persistência.

Um "tratamento profilático" inclui um tratamento administrado a um sujeito que não apresenta sinais ou sintomas de uma condição a ser tratada ou exibe apenas os primeiros sinais ou sintomas da condição a ser tratada, de modo que o tratamento seja administrado com o objetivo de diminuir, prevenir , ou diminuindo o risco de desenvolver a doença. Assim, um tratamento profilático funciona como um tratamento preventivo contra uma condição.

Um "tratamento terapêutico" inclui um tratamento administrado a um sujeito que exibe sintomas ou sinais de uma condição e é administrado ao sujeito com a finalidade de reduzir a gravidade ou progressão da condição.

A dose real e a quantidade de uma composição ou formulação terapêutica administrada a um determinado sujeito podem ser determinadas por um médico, veterinário ou pesquisador levando em consideração parâmetros como fatores físicos e fisiológicos, incluindo peso corporal alvo, tipo de condição, gravidade da condição, próximos eventos relevantes , quando conhecidas intervenções terapêuticas anteriores ou simultâneas, idiopatia do sujeito e via de administração, por exemplo. Além disso, os ensaios in vitro e in vivo podem ser opcionalmente empregados para ajudar a identificar os intervalos de dosagem ideais.

Quantidades terapeuticamente eficazes podem ser administradas através de qualquer via de administração apropriada, tal como por injeção, infusão, perfusão ou lavagem.

Em modalidades particulares, os métodos da presente divulgação podem restaurar a função BM em um sujeito em necessidade. Em modalidades particulares, restaurar a função BM pode incluir melhorar o repovoamento BM com células corrigidas de genes em comparação com um sujeito em necessidade não administrado uma terapia aqui descrita. Melhorar o repovoamento de BM com células corrigidas por genes pode incluir o aumento da porcentagem de células corrigidas por genes. Em modalidades particulares, as células são selecionadas a partir de glóbulos brancos e células derivadas de BM.Em modalidades particulares, a porcentagem de células que são corrigidas por genes pode ser medida usando um ensaio selecionado de PCR quantitativo em tempo real e citometria de fluxo.

Em modalidades particulares, os métodos da presente divulgação podem normalizar as respostas dos anticorpos primários e secundários à imunização em um sujeito em necessidade. A normalização das respostas de anticorpos primários e secundários à imunização pode incluir a restauração de programas de sinalização de citocinas de células B e / ou T, funcionando em troca de classe e resposta de memória a um antígeno. A normalização das respostas de anticorpos primários e secundários à imunização pode ser medida por um ensaio de imunização de bacteriófago. Em modalidades particulares, a restauração de programas de sinalização de citocinas de células B e / ou T pode ser testada após a imunização com o bacteriófago neoantígeno dependente de células T φX174. Em modalidades particulares, a normalização das respostas de anticorpos primários e secundários à imunização pode incluir o aumento do nível de IgA, IgM e / ou IgG em um sujeito em necessidade para um nível comparável a um nível de referência derivado de uma população de controle. Em modalidades particulares, a normalização das respostas de anticorpos primários e secundários para imunização pode incluir aumentar o nível de IgA, IgM e / ou IgG em um sujeito em necessidade para um nível maior do que aquele de um sujeito em necessidade não administrado uma terapia genética descrita aqui em. O nível de IgA, IgM e / ou IgG pode ser medido, por exemplo, por um teste de imunoglobulina. Em modalidades particulares, o teste de imunoglobulina inclui anticorpos ligando IgG, IgA, IgM, cadeia leve kappa, cadeia leve lambda e / ou cadeia pesada. Em modalidades particulares, o teste de imunoglobulina inclui eletroforese de proteínas séricas, imunoeletroforese, imunodifusão radial, nefelometria e turbidimetria. Os kits de teste de imunoglobulina comercialmente disponíveis incluem MININEPH ™ (Binding site, Birmingham, Reino Unido) e sistemas de teste de imunoglobulina de Dako (Dinamarca) e Dade Behring (Marburg, Alemanha). Em modalidades particulares, uma amostra que pode ser usada para medir os níveis de imunoglobulina inclui uma amostra de sangue, uma amostra de plasma, uma amostra de líquido cefalorraquidiano e uma amostra de urina.

Em modalidades particulares, os métodos da presente divulgação podem melhorar a cinética e / ou a diversidade clonal da reconstituição de linfócitos em um sujeito em necessidade. Em modalidades particulares, melhorar a cinética de reconstituição de linfócitos pode incluir aumentar o número de linfócitos T circulantes para dentro de uma faixa de um nível de referência derivado de uma população de controle. Em modalidades particulares, melhorar a cinética de reconstituição de linfócitos pode incluir aumentar a contagem absoluta de linfócitos CD3 + para dentro de uma faixa de um nível de referência derivado de uma população de controle. Uma faixa de um nível de referência pode ser uma faixa de valores observados ou exibidos por indivíduos normais (isto é, não imunocomprometidos) para um determinado parâmetro. Em modalidades particulares, melhorar a cinética de reconstituição de linfócitos pode incluir reduzir o tempo necessário para atingir contagens de linfócitos normais em comparação com um sujeito em necessidade não administrado uma terapia aqui descrita. Em modalidades particulares, melhorar a cinética de reconstituição de linfócitos pode incluir aumentar a frequência de linfócitos corrigidos por genes em comparação com um sujeito em necessidade dos mesmos não administrado com uma terapia aqui descrita. Em modalidades particulares, melhorar a cinética de reconstituição de linfócitos pode incluir o aumento da diversidade do repertório clonal de linfócitos corrigidos de genes no sujeito em comparação com um sujeito em necessidade do mesmo não administrado uma terapia genética aqui descrita.

Em modalidades particulares, os métodos da presente divulgação podem restaurar respostas imunes mediadas por células T em um sujeito em necessidade. A restauração de respostas imunes mediadas por células T pode incluir a restauração da produção tímica e / ou restauração do desenvolvimento normal de linfócitos T.

Em modalidades particulares, restaurar a produção tímica pode incluir restaurar a frequência de células T CD3 + que expressam CD45RA em PB a um nível comparável ao de um nível de referência derivado de uma população de controle. Em modalidades particulares, restaurar a produção tímica pode incluir restaurar o número de círculos de excisão do receptor de células T (TRECs) por 10 6 células T em maturação a um nível comparável ao de um nível de referência derivado de uma população de controle. O número de TRECs por 10 6 células T em maturação pode ser determinado conforme descrito em Kennedy DR et al. (2011) Vet Immunol Immunopathol 142: 36-48.

Em modalidades particulares, restaurar o desenvolvimento de linfócitos T normais inclui restaurar a razão de células CD4 +: células CD8 + para 2. Em modalidades particulares, restaurar o desenvolvimento de linfócitos T normais inclui a detecção da presença de TCR αβ em linfócitos T circulantes. A presença de TCR αβ em linfócitos T circulantes pode ser detectada, por exemplo, por citometria de fluxo usando anticorpos que se ligam a uma cadeia α e / ou β de um TCR. Em modalidades particulares, restaurar o desenvolvimento normal de linfócitos T inclui detectar a presença de um repertório de TCR diverso comparável ao de um nível de referência derivado de uma população de controle. A diversidade de TCR pode ser avaliada por espectrometria de TCRVβ, que analisa o rearranjo genético da região variável do gene TCRβ. Perfis de espectros robustos e normais podem ser caracterizados por uma distribuição gaussiana de fragmentos dimensionados em 17 famílias de segmentos TCRVβ. Em modalidades particulares, restaurar o desenvolvimento normal de linfócitos T inclui restaurar vias de sinalização específicas de células T. A restauração de vias de sinalização específicas de células T pode ser avaliada pela proliferação de linfócitos após a exposição ao mitógeno de células T fitohemaglutinina (PHA). Em modalidades particulares, restaurar o desenvolvimento normal de linfócitos T inclui restaurar a contagem de leucócitos, contagem de células de neutrófilos, contagem de células de monócitos, contagem de células de linfócitos e / ou contagem de células de plaquetas a um nível comparável a um nível de referência derivado de uma população de controle.

Em modalidades particulares, um tratamento terapeuticamente eficaz induz ou aumenta a produção de hemoglobina induz ou aumenta a produção de beta-globina, ou alfa-globina e / ou aumenta a disponibilidade de oxigênio para as células no corpo.

Em modalidades particulares, um tratamento terapeuticamente eficaz aumenta a contagem de células sanguíneas, melhora a função das células sanguíneas e / ou aumenta a oxigenação das células.

Em modalidades particulares, um tratamento terapeuticamente eficaz aumenta a produção de fator de coagulação / coagulação VIII ou fator de coagulação / coagulação IX, causa a produção de versões normais de fator de coagulação VIII ou fator de coagulação IX, reduz a produção de anticorpos para fator de coagulação / coagulação VIII ou fator IX de coagulação / coagulação e / ou causa a formação adequada de coágulos sanguíneos.

Em modalidades particulares, um tratamento terapeuticamente eficaz causa a degradação de mucopolissacarídeos em lisossomas, reduz, elimina, previne ou retarda o inchaço em vários órgãos, incluindo a cabeça (exp. Macrosefalia), o fígado, baço, língua ou cordas vocais reduz fluido no cérebro reduz anormalidades da válvula cardíaca previne ou dilata estreitamento das vias aéreas, reduz ou previne condições respiratórias superiores como infecções e apnéia do sono e / ou reduz, elimina, previne ou retarda a destruição de neurônios e / ou os sintomas associados à destruição de neurônios.

Em modalidades particulares, quantidades terapeuticamente eficazes podem fornecer função para células imunológicas e outras células do sangue, reduzir ou eliminar uma condição imunomediada e / ou reduzir ou eliminar um sintoma da condição imunomediada.

Em modalidades particulares, métodos particulares de uso incluem o tratamento de condições em que as células corrigidas têm uma vantagem seletiva sobre as células não corrigidas. Por exemplo, em FA e SCID, as células corrigidas têm uma vantagem e apenas a transdução do gene terapêutico em “algumas” HSPCs é suficiente para a eficácia terapêutica.

Métodos adicionais de tratamento podem ser encontrados no Pedido de Patente Internacional PCT / US2016 / 014378, depositado em 21 de janeiro de 2016 e nos Pedidos Provisórios US 62 / 351.761, depositado em 17 de junho de 2016 e 62 / 428.994, depositado em 1 de janeiro de 2016 , cada um dos quais é especificamente incorporado aqui em sua totalidade.

(VIII) Níveis de referência derivados de populações de controle. Os valores obtidos para parâmetros associados a uma terapia aqui descrita podem ser comparados a um nível de referência derivado de uma população de controle e esta comparação pode indicar se uma terapia aqui descrita é eficaz para um sujeito em necessidade. Os níveis de referência podem ser obtidos a partir de um ou mais conjuntos de dados relevantes de uma população de controle. Um "conjunto de dados", conforme usado neste documento, é um conjunto de valores numéricos resultantes da avaliação de uma amostra (ou população de amostras) sob uma condição desejada. Os valores do conjunto de dados podem ser obtidos, por exemplo, obtendo experimentalmente medidas de uma amostra e construindo um conjunto de dados a partir dessas medições. Como é entendido por alguém versado na técnica, o nível de referência pode ser baseado em, por exemplo, qualquer fórmula matemática ou estatística útil e conhecida na técnica para chegar a um nível de referência agregado significativo a partir de uma coleção de pontos de dados individuais, por exemplo, média , mediana, mediana da média, etc. Alternativamente, um nível de referência ou conjunto de dados para criar um nível de referência pode ser obtido de um provedor de serviços, como um laboratório, ou de um banco de dados ou servidor no qual o conjunto de dados foi armazenado.

Um nível de referência de um conjunto de dados pode ser derivado de medidas anteriores derivadas de uma população de controle. Uma “população de controle” é qualquer agrupamento de sujeitos ou amostras de características especificadas semelhantes. O agrupamento pode ser de acordo com, por exemplo, parâmetros clínicos, avaliações clínicas, regimes terapêuticos, estado da doença, gravidade da condição, etc. Em modalidades particulares, o agrupamento é baseado na faixa etária (por exemplo, 0-2 anos) e não estado imunocomprometido. Em modalidades particulares, uma população de controle normal inclui indivíduos que são pareados por idade a um sujeito de teste e não imunologicamente comprometidos. Em modalidades particulares, a correspondência por idade inclui, por exemplo, 0-6 meses de 0-1 anos de 0-2 anos de 0-3 anos de 10-15 anos de idade, como é clinicamente relevante nas circunstâncias. Em modalidades particulares, uma população de controle pode incluir aqueles que têm uma deficiência imunológica e não foram administrados com uma quantidade terapeuticamente eficaz

Em modalidades particulares, o nível de referência relevante para os valores de um parâmetro particular associado a uma terapia aqui descrita é obtido com base no valor de um parâmetro correspondente particular associado a uma terapia em uma população de controle para determinar se uma terapia divulgada neste documento foi terapeuticamente eficaz para um assunto em necessidade.

Em modalidades particulares, as conclusões são tiradas com base em se um valor de amostra é estatisticamente significativamente diferente ou não estatisticamente significativamente diferente de um nível de referência. Uma medida não é estatisticamente significativamente diferente se a diferença estiver dentro de um nível que seria esperado que ocorresse com base apenas no acaso. Em contraste, uma diferença ou aumento estatisticamente significativo é maior do que o que seria esperado que ocorresse apenas por acaso. A significância estatística ou a falta dela pode ser determinada por qualquer um dos vários métodos bem conhecidos na técnica. Um exemplo de medida comumente usada de significância estatística é o valor p. O valor p representa a probabilidade de se obter um determinado resultado equivalente a um determinado ponto de dados, em que o ponto de dados é o resultado apenas do acaso aleatório. Um resultado é frequentemente considerado significativo (não chance aleatória) em um valor de p menor ou igual a 0,05. Em modalidades particulares, um valor de amostra é "comparável a" um nível de referência derivado de uma população de controle normal se o valor de amostra e o nível de referência não forem estatisticamente significativamente diferentes.

(IX) Kits. A divulgação também fornece kits contendo qualquer um ou mais dos elementos divulgados nos métodos e composições aqui. Em modalidades particulares, um kit pode incluir RNA guia e uma nuclease capaz de cortar uma sequência alvo em um GSH de células sanguíneas e um modelo de HDR. Os elementos podem ser fornecidos individualmente ou em combinações e podem ser fornecidos em qualquer recipiente adequado, como um frasco, uma garrafa, um saco ou um tubo. Em algumas modalidades, o kit inclui instruções em um ou mais idiomas, por exemplo, em mais de um idioma.

Em modalidades particulares, um kit inclui um ou mais reagentes para uso em um processo que utiliza um ou mais dos elementos aqui descritos. Os reagentes podem ser fornecidos em qualquer recipiente adequado. Por exemplo, um kit pode fornecer um ou mais buffers de reação ou armazenamento. Os reagentes podem ser fornecidos em uma forma que seja utilizável em um ensaio particular, ou em uma forma que requeira a adição de um ou mais outros componentes antes do uso (por exemplo, na forma concentrada ou liofilizada). Um tampão pode ser qualquer tampão, incluindo, mas não se limitando a um tampão de carbonato de sódio, um tampão de bicarbonato de sódio, um tampão de borato, um tampão Tris, um tampão MOPS, um tampão HEPES e suas combinações. Em algumas modalidades, o tampão é alcalino. Em algumas modalidades, o tampão tem um pH de 7 a 10. Em algumas modalidades, o kit inclui um polinucleotídeo modelo de recombinação homóloga.

  • 1. Método para modificar geneticamente uma célula em uma sequência alvo dentro do cromossomo 11, incluindo SEQ ID NOs. 1-194, 197-208, 210, 213, 242, 245, 251 ou 254 incluindo: contatar a célula com um elemento de direcionamento, um elemento de corte e um modelo de reparo direcionado por homologia em que o contato resulta em (i) corte dentro da sequência alvo e (ii) reparo dirigido por homologia (HDR).
  • 2. O método da modalidade 1, em que o elemento de direcionamento, o elemento de corte e o modelo de reparo direcionado por homologia são parte de um sistema de edição de gene CRISPR, um sistema de edição de gene de meganuclease, um sistema de edição de gene de nuclease de dedo de zinco (ZFN), ou um sistema de edição de genes de nuclease baseada em ativador semelhante a ativador de transcrição (TALEN).
  • 3. O método da modalidade 1 ou 2, em que o elemento de direcionamento é crRNA que hibridiza com uma das SEQ ID NOs. 1-194, 197-208, 210, 213, 242, 245, 251 ou 254.
  • 4. O método de qualquer uma das modalidades 1-3, em que o elemento de corte é Cpf1 ou Cas 9.
  • 5. O método da modalidade 4, em que o Cpf1 ou Cas9 inclui uma sequência selecionada de SEQ ID NOs: 215-241.
  • 6. O método da modalidade 4, em que o Cpf1 é uma variante de um Cpf1 selecionado a partir de SEQ ID NOs: 216-227 ou 229-241.
  • 7. O método de qualquer uma das modalidades 1-6, em que o modelo de reparo direcionado por homologia inclui braços de homologia para a sequência alvo, e em que o modelo de reparo direcionado por homologia é parte de um modelo de doador incluindo ainda um gene terapêutico que resulta na expressão de um produto gênico terapêutico.
  • 8. O método da modalidade 7, em que o gene terapêutico ou produto de gene terapêutico é selecionado a partir de proteína esquelética 4.1, glicoforina, p55, o alelo Duffy, genes da família da globina WAS phox distrofina piruvato quinase CLN3 ABCD1 arilsulfatase A SFTPB SFTPC NLX2.1 ABCA3 GATA1 genes de proteína ribossomal TERT TERC DKC1 TINF2 CFTR LRRK2 PARK2 PARK7 PINK1 SNCA PSEN1 PSEN2 APP SOD1 TDP43 FUS ubiquilin 2 C9ORF72, α2β1 aVp3 avp5 αvβ63 BOB / GPR15 Bonzo / LRFC-33 / TYMSTR CCR2 CCR3 CCRS CCR8 CD4 CD46 CD55 CXCR4 aminopeptidase-N HHV 7 ICAM ICAM-1 PRR2 / HveB HveA α-distroglicana LDLR / α2MR / LRP PVR PRR1 / HveC, receptor de laminina, 101F6, 123F2, 53BP2, abl, ABLI, ADP, aFGF, APC, ApoAI, ApoAIV, ApoE, ATM, -1, BDNF, Beta * (BLU), bFGF, BLC1, BLC6, BRCA1, BRCA2, CBFA1, CBL, C-CAM, CFTR, CNTF, COX-1, CSFIR, CTS-1, citosina desaminase, DBCCR-1, DCC, Dp, DPC-4, E1A, E2F, EBRB2, erb, ERBA, ERBB, ETS1, ETS2, ETV6, Fab, FancA, FancB, FancC, FancD1, FancD2, FancE, FancF, FancG, FancI, FancJ, FancL, FancM, FancN, FancO, Fan cP, FancQ, FancR, FancS, FancT, FancU, FancV e FancW, FCC, FGF, FGR, FHIT, fms, FOX, FUS 1, FUS1, FYN, G-CSF, GDAIF, Gene 21, Gene 26, GM- CSF, GMF, gsp, HCR, HIC-1, HRAS, hst, IGF, IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11 IL-12, ING1, interferon α, interferon β, interferon γ, IRF-1, JUN, KRAS, LCK, LUCA-1, LUCA-2, LYN, MADH4, MADR2, MCC, mda7, MDM2, MEN-I, MEN-II, MLL, MMAC1, MYB, MYC, MYCL1, MYCN, neu, NF-1, NF-2, NGF, NOEY1, NOEY2, NRAS, NT3, NT5, OVCA1, p16, p21, p27, p53, p57, p73, p300, PGS, PIM1, PL6, PML, PTEN, raf, Rap1A, ras, Rb, RB1, RET, rks-3, ScFv, scFV ras, SEM A3, SRC, TALI, TCL3, TFPI, trombospondina, timidina quinase, TNF, TP53, trk, T-VEC, VEGF, VHL, WT1, WT-1, YES, zac1, iduronidase, IDS, GNS, HGSNAT, SGSH, NAGLU, GUSB, GALNS , GLB1, ARSB, HYAL1, F8, F9, HBB, CYB5R3, γC, JAK3, IL7RA, RAG1, RAG2, DCLRE1C, PRKDC, LIG4, NHEJ1, CD3D, CD3E, CD3Z, CD3G, PTPRC, ZAP70, LCK, ADPRC, ZAP70, LCK, , PNP, WHN, CHD7, ORAI1, STIM1, CORO1A, CIITA, RFXANK, RFX5, RFXAP , RMRP, DKC1, TERT, TINF2, DCLRE1B e SLC46A1.
  • 9. O método da modalidade 7 ou 8, em que os braços de homologia têm 40 nucleotídeos (nt) -1000 nt.
  • 10. O método de qualquer uma das modalidades 1-9, em que o elemento de direcionamento e o elemento de corte são moléculas separadas ou são parte de uma única molécula de duplo propósito.
  • 11. Método, de acordo com qualquer uma das modalidades 1-10, em que o elemento de direcionamento e o elemento de corte são acoplados a uma nanopartícula.
  • 12. O método da modalidade 11, em que a nanopartícula inclui uma nanopartícula de ouro.
  • 13. O método de qualquer uma das modalidades 1-12, em que o elemento de direcionamento e / ou o elemento de corte são conjugados a um espaçador.
  • 14. O método da modalidade 13, em que o espaçador inclui uma modificação de tiol.
  • 15. Método, de acordo com a modalidade 14, em que a modificação de tiol está covalentemente ligada à superfície da nanopartícula.
  • 16. O método de qualquer uma das modalidades 13-15, em que o elemento de direcionamento inclui uma extremidade 3 'e uma extremidade 5', e em que a extremidade 3 'é conjugada ao espaçador.
  • 17. O método de qualquer uma das modalidades 11-16, em que a nanopartícula está associada a pelo menos duas camadas em que a primeira camada inclui o elemento de direcionamento e a segunda camada inclui um modelo de doador incluindo um gene terapêutico e modelos de reparo direcionado por homologia e em que em pelo menos uma porção da segunda camada está mais longe da superfície da nanopartícula do que a primeira camada.
  • 18. Método, de acordo com qualquer uma das modalidades 11-17, em que a nanopartícula é acoplada a uma molécula de direcionamento.
  • 19. O método da modalidade 18, em que a molécula de direcionamento inclui um domínio de ligação a CD34 ou um domínio de ligação a CD90.
  • 20Método, de acordo com qualquer uma das modalidades 1-19, em que a célula inclui uma célula-tronco hematopoiética (HSC), uma célula progenitora hematopoiética (HPC), uma célula-tronco hematopoiética e progenitora (HSPC), uma célula T, um assassino natural (NK) célula, uma célula B, um macrófago, um monócito, uma célula-tronco mesenquimal (MSC), um glóbulo branco (WBC), uma célula mononuclear (MNC), uma célula endotelial (EC), uma célula estromal e / ou um fibroblasto da medula óssea.
  • 21. O método da modalidade 20, em que a célula sanguínea inclui um CD34 + CD45RA - CD90 + HSC.
  • 22. Método, de acordo com a modalidade 20 ou 21, em que a célula do sangue é uma célula do sangue humano.
  • 23. Método, de acordo com qualquer uma das modalidades 1-22, em que o corte resulta em uma quebra de fita dupla de DNA escalonada com saliências de 5 '2-4-nt.
  • 24. O método de qualquer uma das modalidades 1-23, utilizando pelo menos um dos seguintes pares de crRNA de sequência alvo: (i) alvo: SEQ ID NO: 132 / crRNA: SEQ ID NO: 195 (ii) alvo: SEQ ID NO: 108 / crRNA: SEQ ID NO: 196 (iii) alvo: SEQ ID NO: 203 / crRNA: SEQ ID NO: 209 (iv) alvo: SEQ ID NO: 210 / crRNA: SEQ ID NO: 211 (v) alvo: SEQ ID NO: 242 / crRNA: SEQ ID NO: 244 e (vi) alvo: SEQ ID NO: 251 / crRNA: SEQ ID NO: 253.
  • 25. Nanopartícula associada a pelo menos duas camadas ativas, em que a primeira camada inclui um elemento de direcionamento de DNA e um elemento de corte e em que a segunda camada inclui um modelo de doador incluindo um gene terapêutico e modelos de reparo dirigido por homologia e em que pelo menos porções do a segunda camada está mais distante da superfície da nanopartícula do que a primeira camada.
  • 26. A nanopartícula da modalidade 24, em que o elemento de direcionamento hibridiza com uma das SEQ ID NOs. 1-194, 197-208, 210, 212, 213, 242, 245, 251, 254, 258 ou 263.
  • 27. Nanopartícula, de acordo com a modalidade 25 ou 26, em que o elemento de direcionamento de DNA é crRNA com uma extremidade 3 'e uma extremidade 5', em que a extremidade 3 'é conjugada a um espaçador.
  • 28. A nanopartícula de qualquer uma das modalidades 25-27, em que o elemento de direcionamento de DNA é crRNA com uma extremidade 3 ′ e uma extremidade 5 ′, em que a extremidade 5 ′ é conjugada ao elemento de corte.
  • 29. Nanopartícula, de acordo com a modalidade 27 ou 28, em que o espaçador inclui uma modificação de tiol que está covalentemente ligada à superfície da nanopartícula.
  • 30. A nanopartícula de qualquer uma das modalidades 25-29, em que o elemento de corte é Cpf1 ou Cas 9.
  • 31. Nanopartícula, de acordo com qualquer uma das modalidades 27-30, em que o crRNA inclui SEQ ID NOs: 195, 196, 209, 211, 244, 253, 260 ou 264.
  • 32. A nanopartícula das modalidades 30 ou 31, em que Cpf1 ou Cas9 inclui uma sequência selecionada de SEQ ID NOs: 215-241.
  • 33. A nanopartícula de qualquer uma das modalidades 30-32, em que o Cpf1 inclui uma variante de um Cpf1 selecionado a partir de SEQ ID NOs: 216-227 ou 229-241.
  • 34. Nanopartícula, de acordo com qualquer uma das modalidades 25-33, em que a nanopartícula é uma nanopartícula de ouro.
  • 35. Nanopartícula, de acordo com qualquer uma das modalidades 25-34, em que a nanopartícula é acoplada a uma molécula de direcionamento.
  • 36. Nanopartícula da modalidade 35, em que a molécula de direcionamento inclui um domínio de ligação a CD34 ou um domínio de ligação a CD90.
  • 37. Uma formulação terapêutica incluindo uma nanopartícula de qualquer uma das modalidades 24-35.
  • 38. Uma célula geneticamente modificada por um método de qualquer uma das modalidades 1-24 ou uma nanopartícula de qualquer uma das modalidades 25-36.
  • 39. Célula, de acordo com a modalidade 38, em que a célula é uma célula-tronco hematopoiética (HSC), uma célula progenitora hematopoiética (HPC), uma célula-tronco hematopoiética e progenitora (HSPC), uma célula T, uma célula assassina natural (NK), uma célula B, um macrófago, um monócito, uma célula-tronco mesenquimal (MSC), um glóbulo branco (WBC), uma célula mononuclear (MNC), uma célula endotelial (EC), uma célula estromal e / ou uma medula óssea fibroblasto.
  • 40. A célula da modalidade 38 ou 39, em que a célula é um CD34 + CD45RA - CD90 + HSC.
  • 41. A célula de qualquer uma das modalidades 38-40, em que a célula é uma célula do sangue humano.
  • 42. Uma formulação terapêutica incluindo uma célula de qualquer uma das modalidades 38-41.
  • 43. Um método para fornecer uma sequência de ácido nucleico terapêutica a um paciente em necessidade, incluindo a administração de uma formulação terapêutica da modalidade 37 e / ou 42, ao paciente, fornecendo assim uma sequência de ácido nucleico terapêutica ao paciente.

Variantes de proteínas e / ou sequências de ácido nucleico aqui divulgadas também podem ser utilizadas. As variantes incluem sequências com pelo menos 70% de identidade de sequência, 80% de identidade de sequência, 85% de sequência, 90% de identidade de sequência, 95% de identidade de sequência, 96% de identidade de sequência, 97% de identidade de sequência, 98% de identidade de sequência ou 99% de identidade de sequência às sequências de proteína e ácido nucleico descritas ou divulgadas aqui, em que a variante exibe função biológica substancialmente semelhante ou melhorada.

“% De identidade de sequência” refere-se a uma relação entre duas ou mais sequências, conforme determinado pela comparação das sequências. Na técnica, "identidade" também significa o grau de parentesco de sequência entre as sequências de proteínas e de ácido nucleico, conforme determinado pela correspondência entre as sequências de tais sequências. "Identidade" (muitas vezes referida como "similaridade") pode ser facilmente calculada por métodos conhecidos, incluindo aqueles descritos em: Biologia Molecular Computacional (Lesk, AM, ed.) Oxford University Press, NY (1988) Biocomputing: Informatics and Genome Projects (Smith, DW, ed.) Academic Press, NY (1994) Computer Analysis of Sequence Data, Parte I (Griffin, AM e Griffin, HG, eds.) Humana Press, NJ (1994) Sequence Analysis in Molecular Biology (Von Heijne, G., ed.) Academic Press (1987) e Sequence Analysis Primer (Gribskov, M. e Devereux, J., eds.) Oxford University Press, NY (1992). Os métodos preferidos para determinar a identidade são projetados para fornecer a melhor correspondência entre as sequências testadas. Métodos para determinar a identidade e semelhança são codificados em programas de computador publicamente disponíveis. Alinhamentos de sequência e cálculos de porcentagem de identidade podem ser realizados usando o programa Megalign do pacote de computação de bioinformática LASERGENE (DNASTAR, Inc., Madison, Wisc.). O alinhamento múltiplo das sequências também pode ser realizado usando o método de alinhamento Clustal (Higgins e Sharp CABIOS, 5, 151-153 (1989) com parâmetros padrão (GAP PENALTY = 10, GAP LENGTH PENALTY = 10). Programas relevantes também incluem o Conjunto de programas GCG (Wisconsin Package Versão 9.0, Genetics Computer Group (GCG), Madison, Wis.) BLASTP, BLASTN, BLASTX (Altschul, et al., J. Mol. Biol. 215: 403-410 (1990) DNASTAR ( DNASTAR, Inc., Madison, Wis.) E o programa FASTA incorporando o algoritmo Smith-Waterman (Pearson, Comput. Methods Genome Res., [Proc. Int. Symp.] (1994), Meeting Date 1992, 111-20. Editor (es): Suhai, Sandor. Editor: Plenum, New York, NY Dentro do contexto desta divulgação, será entendido que onde o software de análise de sequência é usado para análise, os resultados da análise são baseados nos "valores padrão" do programa referido. "Valores padrão" significará qualquer conjunto de valores ou parâmetros, que carregam originalmente com o software na primeira vez ized.

Em modalidades particulares, proteínas variantes incluem substituições conservativas de aminoácidos. Em modalidades particulares, uma substituição conservadora de aminoácidos pode não alterar substancialmente as características estruturais da sequência de referência (por exemplo, um aminoácido de substituição não deve tender a quebrar uma hélice que ocorre na sequência de referência, ou interromper outros tipos de estrutura secundária que caracteriza a sequência de referência). Exemplos de estruturas polipeptídicas secundárias e terciárias reconhecidas na técnica são descritos em Proteins, Structures and Molecular Principles (Creighton, Ed., WH Freeman and Company, Nova York (1984)) Introduction to Protein Structure (C. Branden & amp J. Tooze, eds. ., Garland Publishing, New York, NY (1991)) e Thornton et al., Nature, 354: 105 (1991).

Em modalidades particulares, uma "substituição conservativa" envolve uma substituição encontrada em um dos seguintes grupos de substituições conservativas: Grupo 1: Alanina (Ala), Glicina (Gly), Serina (Ser), Treonina (Thr) Grupo 2: Ácido aspártico ( Asp), ácido glutâmico (Glu) Grupo 3: Asparagina (Asn), Glutamina (Gin) Grupo 4: Arginina (Arg), Lisina (Lys), Histidina (His) Grupo 5: Isoleucina (Ile), Leucina (Leu), Metionina (Met), Valina (Val) e Grupo 6: Fenilalanina (Phe), Tirosina (Tyr), Triptofano (Trp).

Além disso, os aminoácidos podem ser agrupados em grupos de substituição conservativa por função semelhante ou estrutura química ou composição (por exemplo, ácido, básico, alifático, aromático, contendo enxofre). Por exemplo, um agrupamento alifático pode incluir, para fins de substituição, Gly, Ala, Val, Leu e Ile. Outros grupos contendo aminoácidos que são considerados substituições conservativas entre si incluem: contendo enxofre: Met e cisteína (Cys) ácidos: Asp, Glu, Asn e Gln pequenos resíduos alifáticos, não polares ou ligeiramente polares: Ala, Ser, Thr, Pro e Gly polares, resíduos carregados negativamente e suas amidas: Asp, Asn, Glu e Gln polares, resíduos carregados positivamente: His, Arg e Lys alifáticos grandes, resíduos não polares: Met, Leu, Ile, Val e Cys e grandes resíduos aromáticos: Phe, Tyr e Trp. Informações adicionais podem ser encontradas em Creighton (1984) Proteins, W.H. Freeman and Company.

Conforme indicado anteriormente, em modalidades particulares, as variantes incluem Cpf1s projetados. Por exemplo, US 2018/0030425 descreve nucleases Cpf1 projetadas de Bactéria lachnospiraceae ND2006 e Acidaminococo sp. BV3L6 com especificidade de alvo alterada e melhorada. Variantes particulares incluem Bactéria Lachnospiraceae ND2006 da SEQ ID NO: 232, por exemplo, pelo menos incluindo os aminoácidos 19-1246 da SEQ ID NO: 232, com mutações (ou seja, substituição do aminoácido nativo por um aminoácido diferente, por exemplo, alanina, glicina ou serina ), em uma ou mais das seguintes posições: S203, N274, N278, K290, K367, K532, K609, K915, Q962, K963, K966, K1002 e / ou S1003 de SEQ ID NO: 232 (ou em posições análogas para isso, por exemplo, S185, N256, N260, K272, K349, K514, K591, K897, Q944, K945, K948, K984 e / ou S985 de SEQ ID NO: 233). SEQ ID NO: 233 é idêntica à SEQ ID NO: 232, mas não possui os primeiros 18 aminoácidos. Variantes particulares de Cpf1 também podem incluir Acidaminococo sp. BV3L6 Cpf1 (AsCpf1) da SEQ ID NO: 230, por exemplo, pelo menos compreendendo os aminoácidos 1-1307 da SEQ ID NO: 230, com mutações (ou seja, substituição do aminoácido nativo por um aminoácido diferente, por exemplo, alanina, glicina ou serina (exceto onde o aminoácido nativo é serina)), em uma ou mais das seguintes posições: N178, S186, N278, N282, R301, T315, S376, N515, K523, K524, K603, K965, Q1013 , Q1014 e / ou K1054 da SEQ ID NO: 230. Em modalidades particulares, variantes de Cpf1 projetadas incluem eCfp1.

Outras variantes Cpf1 incluem homólogos Cpf1 e ortólogos dos polipeptídeos Cpf1 divulgados em Zetsche et al. (2015) Cell 163: 759-771, bem como os polipeptídeos Cpf1 divulgados em U.S. 2016/0208243. Exemplos de sequências Cpf1 incluem SEQ ID NOs: 216-227 e 229-241 aqui divulgados.

Outras variantes de Cpf1 projetadas são conhecidas por aqueles versados ​​na técnica e incluídas no escopo da divulgação atual (ver, por exemplo, WO / 2017/184768).

Modalidade de Fabricação Exemplar.

Exemplo 1. Sintetizando Núcleos de Nanopartículas de Ouro. Nanopartículas de ouro (AuNPs) de intervalo de tamanho de 15 nm foram sintetizadas pelo método de Turkevich com ligeira modificação. Turkevich, et al., (1951). Discussions of the Faraday Society 11 (0): 55-75.). A solução de ácido cloroáurico 0,25 mM foi levada ao ponto de ebulição e reduzida pela adição de solução de citrato de sódio 3,33% e agitada vigorosamente sob sistema de refluxo durante 10 min. Nanopartículas sintetizadas foram lavadas três vezes e redispersas em água altamente pura.

Estruturas de RNA Guia Cpf1 e Cas9. O RNA guia Cpf1 único foi pedido de uma fonte comercial, Integrated DNA Technologies IDT), com duas modificações personalizadas na extremidade 3 '. A primeira modificação incluiu um espaçador de oligoetilenoglicol (OEG) de 18 átomos (iSp18) e a segunda modificação incluiu uma modificação de tiol. O espaçador OEG (por exemplo, polietilenoglicol (PEG) ou hexaetilenoglicol (HEG), etc.), estava em uma razão de 1 por oligonucleotídeo e serviu para prevenir a repulsão eletrostática entre os oligonucleotídeos. Embora um espaçador de 18 átomos tenha sido usado, outros comprimentos também são apropriados. A modificação de tiol também foi adicionada na proporção de 1 por oligonucleotídeo e serviu como base para interações covalentes para ligar o oligonucleotídeo à superfície da nanopartícula de ouro.

Preparando a Nanoformulação AuNP / CRISPR. crRNAs com 18 espaçadores-tiol modificações foram usados. AuNPs na concentração de 10 μg / mL foram adicionados à solução de crRNA na relação AuNP / crRNA p / p de 0,5. Em seguida, foi adicionado tampão citrato com pH 3 na concentração de 10 mM e misturado durante 5 min. Nanoconjugados de AuNP / crRNA preparados foram centrifugados e redispersos em PBS. Em seguida, a nuclease Cpf1 foi adicionada na razão AuNP / Cpf1 p / p de 0,6. Polietilenimina (PEI) de 2000 MW foi adicionada na concentração de 0,005% e bem misturada. Na etapa final, o modelo de ssDNA foi adicionado na proporção AuNP / ssDNA w / w de 1.

Exemplo profético 1. A relevância translacional do macaco pigtail (M. nemestrina) modelo em termos de reatividade cruzada de reagentes humanos e escala foi previamente estabelecido. Este modelo serviu como uma etapa importante na tradução clínica da terapia gênica HSPC. Por exemplo, este modelo foi usado para avaliar criticamente o potencial hematológico e a segurança do HSPC modificado do gene LV e editado pelo CCR5, e para rastrear o destino e a persistência dessas células in vivo ao longo dos anos. Os pares de crRNA ideais identificados como acima são emparelhados com uma estratégia de entrega de nanopartículas ideal identificada como acima para modificar o gene HSPC autólogo de três primatas não humanos para transplante autólogo após irradiação mieloablativa do corpo total. A segurança e a viabilidade são avaliadas medindo a adequação do produto in vitro e in vivo.

Em mais detalhes, o transplante autólogo é realizado para CD34 + CD90 + CD45RA - HSPC após edição de CRISPR / Cpf1 GSH mediada por nanopartículas e inserção do transgene repórter. Três macacos pigtail juvenis são preparados com fator estimulador de colônia de granulócitos humanos recombinantes (GCS-F 100 mcg / kg / dia × 4 dias) e fator de células-tronco (SCF 50 mcg / kg / dia × 4 dias) como injeções subcutâneas. A medula óssea é colhida em heparina no 4º dia do priming. Os leucócitos são isolados por lise de cloreto de amônio e são marcados com anticorpo monoclonal IgM 12-8 (CD34 +) a 4 ° C por 30 minutos, lavados e incubados com microesferas de IgM monoclonais de rato anti-camundongo por 30 minutos a 4 ° C ., lavado e, em seguida, imunosselecionado. Todos os procedimentos de seleção adicionais serão realizados conforme descrito acima. A formulação de nanopartículas ideal e o protocolo de tratamento identificado como acima são usados ​​para realizar a edição do gene GSH e a inserção do transgene GFP direcionado. Durante a manipulação de HSPC ex vivo, os macacos recebem irradiação mieloablativa do corpo total (1020cGy) como quatro doses fracionadas ao longo de 2 dias de um acelerador linear. Os HSPC modificados pelo gene são formulados em PlasmaLyte e soro autólogo para reinfusão intravenosa 24 horas após a administração da última dose de irradiação. Os animais recebem cuidados de suporte conforme necessário (transfusões, fluidos intravenosos, etc.).

Produtos de HSPC modificados por genes serão testados quanto à viabilidade, capacidade de formação de colônias in vitro (CFC), esterilidade, micoplasma, endotoxina, fenótipo celular, formação de indel e expressão de transgene. Todos os protocolos de teste a serem aplicados são aprovados para uso em ensaios clínicos de fase I de terapia com células autólogas. A segurança é determinada pela capacidade de gerar células autólogas tratadas com nanopartículas que são consideradas adequadas para infusão (isto é, estéreis, livres de micoplasma, baixa endotoxina e & gt70% viáveis). A viabilidade é determinada pelo rendimento de células viáveis ​​ao longo do processo e o sucesso da edição de GSH e inserção do transgene repórter em escala. A dose de células alvo na infusão é ≥125.000 células CD34 + CD90 + CD45RA - por quilograma de peso corporal com base em nossos dados preliminares.

A segurança in vivo é medida pela cinética de recuperação hematológica e pelas necessidades de cuidados de suporte após o transplante, bem como a clonalidade de células editadas por genes enxertados. O sangue periférico é coletado diariamente de cada animal transplantado e analisado por um analisador hematológico automatizado até que a recuperação hematológica seja observada. A recuperação é definida como uma contagem absoluta de neutrófilos & gt500 / mcL e plaquetas & gt50.000 / mcL para 3 medições consecutivas com uma tendência crescente observada em ambos os parâmetros. Após a recuperação hematológica, o sangue periférico é coletado pelo menos duas vezes por mês. A citometria de fluxo é realizada regularmente para monitorar os níveis de enxerto de células tratadas com nanopartículas que expressam o transgene repórter (GFP), bem como marcadores de linhagem para determinar a extensão da reconstituição multi-linhagem. O DNA genômico (gDNA) é extraído dessas amostras e submetido à análise por Surveyor e código de barras de DNA e sequenciamento do locus GSH, conforme descrito acima. Para sequenciamento de código de barras de DNA, uma única rodada de amplificação por PCR é realizada e as reações resultantes são enviadas para sequenciamento usando a plataforma Illumina MiSeq. As leituras de sequência são submetidas ao processamento de bioinformática para identificar eventos de código de barras exclusivos e contribuições clonais relativas como uma medida da abundância do clone. Os clones são mapeados em função do tempo e da contribuição. Para sequenciação do locus GSH, os iniciadores correspondentes ao par de crRNA ideal identificado acima são usados ​​para sequenciar o locus GSH. A frequência de células enxertadas contendo indels versus cassetes de transgene repórter é determinada.

Este estudo estabelece o protocolo em escala para edição de GSH mediada por nanopartículas e inserção de gene repórter direcionado. Este protocolo serve como base para avaliar a entrega de transgene clinicamente terapêutico em muitos alvos de doenças. Os resultados deste estudo fornecem a base para a avaliação de estratégias para melhorar o enxerto e a diferenciação de HSPC editados por genes neste modelo de grande animal clinicamente relevante e translacional.

Exemplo profético 2. Validar locus GSH ótimo para edição de genes em células CD34 + CD45RA - CD90 +. Aspirados de medula óssea (BM) de doador saudável são obtidos de um fornecedor comercial ou sob um protocolo IRB. Os produtos de sangue periférico mobilizados (mAPH) são obtidos de dadores saudáveis ​​após a administração do fator estimulador de colônias de granulócitos (G-CSF) e coleta de leucaferese. Para BM, os glóbulos vermelhos são esgotados pela sedimentação de hetamido, e as células CD34 + são imuno-selecionadas. Para mAPH, é realizada uma imunosseleção padrão de células CD34 +. Os produtos enriquecidos com CD34 resultantes de ambas as fontes de HSPC são corados com anticorpos específicos para CD90 e CD45RA e a população de HSPC alvo (CD90 + CD45RA -) é coletada por classificação de células ativadas por fluorescência como descrito anteriormente [Radtke et al., Sci. Tradução Med. 2017 9 (414).].

As células CD34 + CD45RA-CD90 + são direcionadas com múltiplas nucleases CRISPR / Cpf1 projetadas para um candidato GSH identificado. A especificidade e a função são avaliadas in vitro e in vivo para identificar o locus GSH ideal. O mRNA quimicamente modificado é usado para aumentar a estabilidade intracelular, enquanto os braços de homologia e a modificação do fosforotioato são incorporados ao ssODN para melhorar a eficiência do HDR.

As células são suspensas em meio StemSpan contendo fator de célula-tronco de fatores de crescimento humano recombinante (SCF), trombopoietina (TPO) e ligante de tirosina quinase 3 semelhante a fms (flt3-L) e incubadas a 30 ° C por 24 horas. A mídia é trocada no dia seguinte e as culturas serão preparadas para análise e infusão subsequentes. A viabilidade é monitorada por citometria de fluxo e / ou coloração com azul de tripano.

Pelo menos três métodos podem ser aplicados para determinar a eficiência e especificidade da adição de genes. Em primeiro lugar, a citometria de fluxo pode ser usada para avaliar GFP e / ou expressão gênica terapêutica. Isso mostra a frequência de células com incorporação de cassete e GFP / expressão / função de gene terapêutico. Em segundo lugar, o ensaio Surveyor (Ran et al. Cell. 2013 154 (6): 1380-1389) é usado para determinar a frequência de indels versus inserção do transgene no locus alvo. Resumidamente, as células são sedimentadas e o DNA extraído e purificado. O DNA resultante é quantificado e submetido a PCR usando iniciadores projetados para o locus direcionado pelo par de nuclease CRISPR / Cpf1 específico. Os controles apropriados contendo incompatibilidade são amplificados por PCR. Após a PCR, os produtos são desnaturados e recozidos para formar heteroduplexes, que são subsequentemente tratados com a enzima Surveyor e analisados ​​por eletroforese em gel. A imagem e a densitometria são então usadas para calcular uma eficiência de edição para cada locus. Finalmente, o BLISS é aplicado para identificar DSBs fora do alvo (Yan et al. Nat Commun 2017 8: 15058). As células são primeiro transferidas para lâminas de vidro por cytospinning, seguido por permeabilização e fixação. DSBs in situ são polidos e ligados a oligonucleotídeos sintéticos contendo um código de barras de amostra exclusivo e identificador multiplex, seguido por um adaptador de sequenciamento RA5 Illumina e promotor T7. O DNA é então purificado e submetido a sonicação seguida por transcrição in vitro e preparado como uma biblioteca para sequenciamento baseado em Illumina. Isso permite a identificação de localizações genômicas de DSBs fora do alvo e quantificação da frequência de DSB como o número de leituras correspondentes a uma localização genômica específica para um determinado número de células imobilizadas na lâmina original. Após essas análises, o par CRISPR / Cpf1 ideal e a combinação ssODN são identificados para análise posterior in vivo, por exemplo, conforme descrito abaixo. A combinação ideal demonstra a maior eficiência da inserção do transgene com código de barras no locus desejado com toxicidade mínima in vitro e a menor frequência de formação de DSB fora do alvo entre doadores e fontes de HSPC (BM e mAPH).

Como será entendido por aqueles versados ​​na técnica, cada modalidade divulgada neste documento pode compreender, consistir essencialmente em ou consistir em seu elemento, etapa, ingrediente ou componente específico declarado. Assim, os termos "incluem" ou "incluindo" devem ser interpretados como recitando: "compreendem, consistem em ou consistem essencialmente em." O termo de transição "compreende" ou "compreende" significa inclui, mas não está limitado a, e permite a inclusão de elementos, etapas, ingredientes ou componentes não especificados, mesmo em grandes quantidades. A frase de transição "consistindo em" exclui qualquer elemento, etapa, ingrediente ou componente não especificado. A frase de transição "consistindo essencialmente em" limita o escopo da modalidade aos elementos, etapas, ingredientes ou componentes especificados e àqueles que não afetam materialmente a modalidade. Um efeito material causaria uma redução estatisticamente significativa na edição de genes em um local GSH alvo.

Salvo indicação em contrário, todos os números que expressam quantidades de ingredientes, propriedades como peso molecular, condições de reação e assim por diante usados ​​no relatório descritivo e nas reivindicações devem ser entendidos como sendo modificados em todos os casos pelo termo "cerca de". Consequentemente, a menos que indicado em contrário, os parâmetros numéricos estabelecidos no relatório descritivo e nas reivindicações anexas são aproximações que podem variar dependendo das propriedades desejadas a serem obtidas pela presente invenção. No mínimo, e não como uma tentativa de limitar a aplicação da doutrina dos equivalentes ao escopo das reivindicações, cada parâmetro numérico deve ser interpretado pelo menos à luz do número de dígitos significativos relatados e aplicando técnicas de arredondamento comuns. Quando mais clareza é necessária, o termo "cerca de" tem o significado razoavelmente atribuído a ele por um versado na técnica quando usado em conjunto com um valor ou intervalo numérico declarado, ou seja, denotando um pouco mais ou um pouco menos do que o valor ou intervalo declarado , dentro de uma faixa de ± 20% do valor declarado ± 19% do valor declarado ± 18% do valor declarado ± 17% do valor declarado ± 16% do valor declarado ± 15% do valor declarado ± 14 % do valor declarado ± 13% do valor declarado ± 12% do valor declarado ± 11% do valor declarado ± 10% do valor declarado ± 9% do valor declarado ± 8% do valor declarado ± 7% do valor declarado ± 6% do valor declarado ± 5% do valor declarado ± 4% do valor declarado ± 3% do valor declarado ± 2% do valor declarado ou ± 1% do valor declarado.

Apesar de as faixas numéricas e parâmetros que estabelecem o amplo escopo da invenção serem aproximações, os valores numéricos apresentados nos exemplos específicos são relatados com a maior precisão possível. Qualquer valor numérico, entretanto, contém inerentemente certos erros necessariamente resultantes do desvio padrão encontrado em suas respectivas medições de teste.

Os termos "um", "uma", "o" e referentes semelhantes usados ​​no contexto da descrição da invenção (especialmente no contexto das reivindicações a seguir) devem ser interpretados para cobrir tanto o singular quanto o plural, salvo indicação em contrário aqui ou claramente contradito pelo contexto. A recitação de intervalos de valores neste documento se destina meramente a servir como um método abreviado de se referir individualmente a cada valor separado dentro do intervalo. A menos que indicado de outra forma aqui, cada valor individual é incorporado no relatório descritivo como se fosse individualmente citado neste documento. Todos os métodos descritos neste documento podem ser realizados em qualquer ordem adequada, a menos que indicado de outra forma aqui ou de outra forma claramente contradito pelo contexto. O uso de todo e qualquer exemplo ou linguagem exemplar (por exemplo, "tal como") fornecido neste documento se destina meramente a iluminar melhor a invenção e não representa uma limitação no escopo da invenção reivindicada de outra forma. Nenhuma linguagem na especificação deve ser interpretada como indicando qualquer elemento não reivindicado essencial para a prática da invenção.

Os agrupamentos de elementos alternativos ou modalidades da invenção divulgados neste documento não devem ser interpretados como limitações. Cada membro do grupo pode ser referido e reivindicado individualmente ou em qualquer combinação com outros membros do grupo ou outros elementos aqui encontrados. Prevê-se que um ou mais membros de um grupo podem ser incluídos ou excluídos de um grupo por razões de conveniência e / ou patenteabilidade. Quando tal inclusão ou exclusão ocorre, a especificação é considerada como contendo o grupo modificado, cumprindo assim a descrição escrita de todos os grupos Markush usados ​​nas reivindicações anexas.

Modalidades particulares desta invenção são descritas neste documento, incluindo o melhor modo conhecido pelos inventores para realizar a invenção. Obviamente, variações nessas modalidades descritas se tornarão aparentes para aqueles versados ​​na técnica após a leitura da descrição anterior. O inventor espera que os versados ​​na técnica empreguem tais variações conforme apropriado, e os inventores pretendem que a invenção seja praticada de outra forma que não especificamente aqui descrita. Consequentemente, esta invenção inclui todas as modificações e equivalentes do assunto recitado nas reivindicações anexas, conforme permitido pela lei aplicável. Além disso, qualquer combinação dos elementos acima descritos em todas as variações possíveis dos mesmos é abrangida pela invenção, a menos que indicado de outra forma aqui ou de outra forma claramente contradita pelo contexto.

Além disso, numerosas referências foram feitas a patentes, publicações impressas, artigos de periódicos e outros textos escritos ao longo desta especificação (materiais referenciados neste documento). Cada um dos materiais referenciados são individualmente incorporados neste documento por referência em sua totalidade para seus ensinamentos referenciados.

Para encerrar, deve ser entendido que as modalidades da invenção divulgadas neste documento são ilustrativas dos princípios da presente invenção. Outras modificações que podem ser empregadas estão dentro do escopo da invenção. Assim, a título de exemplo, mas não de limitação, configurações alternativas da presente invenção podem ser utilizadas de acordo com os ensinamentos deste documento. Consequentemente, a presente invenção não se limita precisamente ao que é mostrado e descrito.

Os particulares mostrados aqui são a título de exemplo e para fins de discussão ilustrativa das modalidades preferidas da presente invenção apenas e são apresentados na causa de fornecer o que se acredita ser a descrição mais útil e facilmente compreendida dos princípios e aspectos conceituais de várias modalidades da invenção. A este respeito, nenhuma tentativa é feita para mostrar detalhes estruturais da invenção em mais detalhes do que o necessário para a compreensão fundamental da invenção, a descrição feita com os desenhos e / ou exemplos tornando aparente para aqueles versados ​​na técnica como os vários as formas da invenção podem ser concretizadas na prática.

As definições e explicações usadas na presente divulgação se destinam e se destinam a controlar em qualquer construção futura, a menos que seja modificada de forma clara e inequívoca nos exemplos a seguir ou quando a aplicação do significado torna qualquer construção sem sentido ou essencialmente sem sentido. Nos casos em que a construção do termo o tornaria sem sentido ou essencialmente sem sentido, a definição deve ser tirada do Dicionário Webster, 3ª Edição ou de um dicionário conhecido por aqueles de habilidade comum na arte, como o Dicionário Oxford de Bioquímica e Biologia Molecular (Eds. Attwood T et al., Oxford University Press, Oxford, 2006).


Assista o vídeo: Wykład 3. Lekarski 2021-2022 (Dezembro 2021).