Em formação

Criando modelo de expressão a partir de PCR: qual temperatura de anelamento usar?


Estou criando um modelo de transcrição para expressão no PURExpress e estava confuso sobre a temperatura de recozimento a ser usada.

Eu tenho dois primers com o promotor T7 e um RBS no primer direto e uma sequência de terminação no primer reverso. A temperatura de fusão desses primers é de 84,4 e 83,8 graus C. A temperatura de fusão das regiões que são complementares ao gene de interesse que desejo amplificar por PCR são ambas cerca de 65 graus C.

Que temperatura de recozimento devo usar a h? Desde o início da reação de PCR terei principalmente modelos que terão as sequências complementares dos primers ligados ao GOI e não às extensões 5 'e 3'.


Parece que a resposta, que pode ser específica do contexto, é usar uma temperatura de recozimento cerca de 5 graus abaixo de toda a temperatura de fusão do oligo. Não obtive nenhuma banda em temperaturas mais baixas.


Determinar as temperaturas de recozimento para a reação em cadeia da polimerase.

A análise do DNA pela reação em cadeia da polimerase (PCR) é uma técnica extremamente simples que permite a amplificação de pequenas quantidades de DNA. A disponibilidade comercial de kits tornou os laboratórios que utilizam PCR mais comuns nas aulas de ciências do ensino médio e de graduação. Os alunos usam PCR para determinar a tipagem de DNA e impressões digitais (Baker et al., 2002), para identificar contaminantes bacterianos (Baker et al., 1999) e para clonar um determinado gene de interesse (Dong et al., 2008). Os parâmetros para esses experimentos costumam ser padrão e predefinidos. Os alunos executam as reações sem ter uma verdadeira apreciação dos detalhes experimentais críticos necessários para amplificar um segmento específico de DNA.

O ciclo de PCR envolve três etapas: desnaturação, anelamento do primer e extensão do primer. Cada uma dessas etapas requer a incubação da mistura de reação em diferentes temperaturas. Na primeira etapa, desnaturação, o DNA é incubado a 93-95 [degrees] C por 30 segundos a 2 minutos. Isso quebra as ligações de hidrogênio entre os pares de bases de nucleotídeos (bp) e separa as duas fitas de DNA. Na segunda etapa, o anelamento do primer, a reação é incubada a 45-65 [degrees] C por 45 segundos a 1 minuto, a presença de primers em excesso permite que os primers complementares hibridizem com o DNA alvo. A terceira etapa, a extensão do primer, é conduzida a 72 [graus] C de 15 segundos a 1 minuto e envolve a síntese de DNA, na qual os primers são usados ​​para sintetizar duas novas fitas filhas complementares às fitas mãe originais. Os ciclos de PCR subsequentes replicarão cada produto de PCR na mistura de reação, resultando na amplificação exponencial da sequência de DNA alvo.

Os primeiros inovadores do PCR precisaram otimizar esse procedimento. Inicialmente, foi necessário adicionar DNA polimerase fresco após cada etapa de desnaturação. Eventualmente, uma forma termicamente estável foi descoberta na bactéria de fontes termais Thermus aquaticus (Taq), daí o termo Taq DNA polimerase. Cada período de incubação exigia a transferência manual de tubos de ensaio de uma temperatura para outra até o advento do termociclador, que regula as temperaturas de ciclo automaticamente.

Mesmo no "mundo real" da pesquisa científica, kits de PCR disponíveis comercialmente são usados, mas dois componentes críticos de PCR são geralmente fornecidos pelo cientista. Os pesquisadores fornecem seus próprios primers, que são projetados para se anular a uma sequência de DNA específica, e o molde de DNA a ser amplificado. Um PCR ideal será específico, gerando um e apenas um produto de amplificação, será eficiente, rendendo o aumento teórico de duas vezes do produto a cada ciclo de PCR, e terá fidelidade, reproduzindo a seqüência exata do template. Cada um desses parâmetros é afetado por variáveis ​​dentro da mistura de reação de PCR, como componentes do tampão, número de ciclos, temperatura e duração de cada etapa de ciclo, composição do primer e molde de DNA. Neste exercício de laboratório, os alunos usam dois conjuntos de primers para determinar a temperatura ideal de anelamento na formação do produto PCR para otimizar a eficiência da amplificação. Usamos este exercício em um curso de laboratório de fisiologia celular para alunos de graduação da divisão superior. Também é apropriado para cursos de Biologia AP, onde o financiamento para exercícios de laboratório mais avançados pode estar disponível.

Este conjunto de experimentos se concentra na amplificação de dois produtos de PCR: um para claudina-2 e um para claudina-12. As claudinas são componentes de junções estreitas encontradas entre as células intestinais e estão envolvidas na criação de uma barreira de permeabilidade para que as substâncias não possam passar do lúmen do intestino para o sangue. Nestes experimentos, os alunos

1. estudar os parâmetros gerais que influenciam o PCR,

2. calcular e estimar a temperatura de anelamento ideal para os iniciadores de sequências de DNA de claudina-2 e claudina-12,

3. execute o PCR usando uma gama de temperaturas de recozimento que os alunos determinam,

4. visualizar os produtos de PCR em uma eletroforese em gel de agarose horizontal,

5. determinar a quantidade e o tamanho do produto de PCR para cada conjunto de primers, e

6. compare a temperatura de recozimento observada com a temperatura de recozimento calculada.

** Parâmetros que influenciam o PCR

Especificidade, eficiência e fidelidade: a otimização desses três parâmetros requer o conhecimento do propósito de sua reação de PCR (Cha & amp Thilly, 1993). Um PCR ideal possui alta especificidade (um e apenas um produto), eficiência (bom rendimento exponencial) e fidelidade (um produto preciso). Esses parâmetros são influenciados por uma série de variáveis, incluindo condições de buffer, como concentração de [Mg.sup. ++], tempo de ciclo, temperatura de recozimento e duração de tempo. Ajustar essas variáveis ​​irá maximizar um parâmetro sobre o outro e, portanto, há um compromisso dependendo do seu propósito. A fidelidade é de fundamental importância quando o objetivo é sequenciar um determinado DNA. Na PCR quantitativa, utilizada para avaliação da expressão gênica, a especificidade e a eficiência também são importantes.

** Temperatura de recozimento ideal e design de primer de amp

O comprimento e a sequência do primer são críticos na amplificação de produtos de PCR com especificidade e eficiência (Dieffenbach et al., 1993). A estabilidade do duplex iniciador-molde de DNA é medida por sua temperatura de fusão ([T.sub.m]), a temperatura na qual metade do duplex iniciador-DNA se dissocia para se tornar DNA de fita simples. O comprimento do iniciador e o conteúdo de G e C do duplex de molde de DNA-iniciador desempenham papéis críticos na determinação de [T.sub.m], que é calculado pela fórmula 4 (G + C) + 2 (A + T) , e esta é a regra para calcular a temperatura de recozimento. A temperatura de anelamento observada é geralmente alguns graus abaixo da temperatura de anelamento calculada e é influenciada por outras variáveis ​​do PCR, como concentração [Mg.sup. ++] e concentração [K.sup. +]. O comprimento do primer é tipicamente entre 18 e 22 nucleotídeos.

A Tabela 1 mostra os primers usados ​​neste exercício para amplificar o cDNA intestinal para claudina-2 e claudina-12. Os alunos podem calcular a temperatura ideal de recozimento com base nas composições de primer e projetar um experimento para testar diferentes faixas de temperatura a fim de determinar a temperatura ideal de recozimento. O protocolo experimental para testar a temperatura real de recozimento é descrito abaixo, e variações são sugeridas para que os instrutores possam orientar os alunos a criar suas próprias hipóteses e adaptar o experimento para testar outras variáveis ​​que os alunos podem manipular. Os alunos podem ser agrupados para testar diferentes hipóteses, ou pode-se chegar a um consenso em que uma hipótese será testada por todos os grupos.

O laboratório está dividido em três módulos. No primeiro módulo, a aula usa RNA para sintetizar cDNA pela enzima transcriptase reversa (RT). No segundo módulo, o cDNA é usado em PCR para amplificar o cDNA para claudina-2 e claudina-12 em temperaturas de anelamento variáveis. No terceiro módulo, os produtos de PCR são analisados ​​por separação em géis de agarose. A turma é dividida em grupos de dois ou três alunos, dependendo do tamanho da turma. Todo o exercício de laboratório leva de 3 a 4 semanas, assumindo um laboratório de 3 horas por semana, mas cada módulo pode ser realizado separadamente, de modo que o tempo possa decorrer entre os módulos. Um diagrama esquemático do exercício é representado na Figura 1.

Módulo 1: Preparação da primeira fita de cDNA usando transcriptase reversa (RT)

Preparamos nosso próprio RNA a partir de tecido intestinal de camundongo, usando isotiocianato de guanidínio (Chomczynski & amp Sacchi, 2006). Alternativamente, o RNA intestinal de camundongo pode ser adquirido de fornecedores (Amsbio, catálogo no. M1334226 ou Zyagen, catálogo no. MR-307). Um kit da Invitrogen (catálogo no. 18080-051) que fornece todos os reagentes necessários para 50 reações é usado para fazer cDNA. RNA (2 [micro] g) é adicionado a 1 [micro] L oligo dT e 1 [micro] L dNTP mix e trazido até 10 [micro] L com água tratada com DEPC. A água DEPC contém dietilpirocarbonato, que degrada qualquer vestígio de RNases. A mistura inteira é então aquecida a 65 [degrees] C por 5 minutos, seguido por 4 [degrees] C por 7 minutos. Isto permite que o oligo dT se emparelhe com o mRNA e sirva como o iniciador a partir do qual a primeira cadeia de cDNA é sintetizada. Na segunda etapa, uma mistura de síntese de cDNA (10 [micro] L) é adicionada à amostra de RNA e a amostra é aquecida a 50 [degrees] C por 50 minutos, seguido por 85 [degrees] C por 5 minutos. Isso resulta na extensão do primer por transcriptase reversa (RT) e na síntese da primeira fita de cDNA usando mRNA como molde (Figura 1A). O cDNA é armazenado a 4 [degrees] C para uso imediato ou a -20 [degrees] C para uso futuro. Alternativamente, o instrutor pode optar por pular o módulo 1 e comprar cDNA de camundongo (dDNA de ceco de camundongo Zymogen, nº de catálogo MD-310 ou cDNA de cólon de camundongo, nº de catálogo MD-311) e usar a uma concentração de 10 ng por mistura de PCR.

Módulo 2: Preparação de cDNA de segunda fita e amplificação de cDNA específico de gene usando PCR

O cDNA gerado a partir do RNA é usado em PCR padrão com Taq polimerase e iniciadores específicos de gene para claudina-2 e claudina-12. As sequências de primer para claudina-2 e claudina-12 são mostradas na Tabela 1, com detalhes relativos à composição e temperaturas de recozimento. Os alunos podem receber a composição dos primers e calcular% GC e [T.sub.m]. Com base nas discussões de classe, eles podem definir a faixa de temperaturas de recozimento a serem testadas para determinar a temperatura de recozimento real de cada conjunto de primers. PrimerBank (http://pga.mgh.harvard.edu/primerbank/index.html) é uma fonte pública de primers para & gt300.000 genes humanos e de camundongo e uma ferramenta muito útil para pesquisar diferentes conjuntos de primers para genes específicos de interesse (Spandidos et al., 2010). O banco de dados pode ser usado para fornecer aos alunos uma lista de primers para calcular as temperaturas de recozimento, e também pode ser usado para escolher diferentes conjuntos de primers a serem testados por diferentes grupos de alunos.

Síntese da segunda fita de cDNA e amplificação de cDNA específico de genes (Figura 1B) foram realizadas adicionando 2 [micro] L do RT-cDNA, 1 [micro] L primer direto, 1 [micro] L primer reverso (50 pmoles cada) e 12,5 [micro] L Taq polimerase (Premix Taq Polymerase TaKaRa catálogo nº RR003) em um tubo de PCR de 0,2 mL e água tratada com DEPC suficiente para levar a reação a 25 [micro] L. Em nosso exercício, testamos 12 temperaturas de recozimento diferentes, então preparamos uma mistura de reação 12X em um tubo de microcentrífuga de 1,5 mL e dispensamos alíquotas de 25- [micro] L em 12 tubos de PCR. O cDNA foi amplificado usando um ciclador térmico de PCR de gradiente Eppendorf usando os seguintes parâmetros: desnaturação inicial do DNA a 95 [graus] C por 5 minutos, seguido por 35 ciclos de desnaturação 95 [graus] C por 1 minuto, temperaturas de anelamento variando de 51 [graus] C a 71 [graus] C por 1 minuto, alongamento a 72 [graus] C por 1 minuto e alongamento final de 72 [graus] C por 7 minutos, seguido de resfriamento a 4 [graus] C. Os produtos de PCR podem ser armazenados a 4 [graus] C até análise futura. Os alunos podem ajustar o número de temperaturas de recozimento escolhidas, dependendo dos primers usados. Se um ciclador gradiente não estiver disponível, a reação pode ser executada várias vezes em um ciclador PCR regular, alterando a temperatura de anelamento para cada corrida. Depois de estudar os fundamentos da síntese de DNA e PCR, há muitas variações no exercício que os instrutores podem desafiar os alunos a examinar. Além da temperatura de recozimento, variáveis ​​como comprimento do primer, concentração de primers e cDNA e número de ciclo também podem ser testadas.

Módulo 3: Eletroforese em gel de agarose de produtos de PCR

Um gel de agarose a 1% (Figura 1C) é preparado pela adição de 1 g de agarose (catálogo BioRad nº 161-3104) a 100 mL de tampão TAE 1X (Tris 40 mM, EDTA 1 mM, pH 7,6) (catálogo BioRad nº 161- 0743) e fervendo para dissolver a agarose. A solução é resfriada a cerca de 60 [degrees] C e despejada no suporte de gel com pente para formar poços. As amostras de PCR a serem executadas no gel são preparadas pela adição de 5 [micro] L de corante de carga de DNA 6X (0,25% de azul de bromofenol, 0,25% de xileno cianol, 30% de glicerol em água) às reações de PCR de 25 [micro] L e vórtice. Depois que o gel de agarose solidificou, ele é colocado na câmara tampão preenchida com tampão TAE 1X para que o gel seja submerso e o pente seja removido com cuidado. A escada de DNA (5 [micro] L Phenix Research Products 100-bp DNA ladder) é carregada no primeiro poço nos poços subsequentes, 20 [micro] L do PCR e as misturas de corantes de carregamento são carregados. A tampa é colocada na câmara, os eletrodos apropriadamente conectados (positivo-vermelho, negativo-preto), e o gel é executado a 90 V por 90 minutos ou até que o corante azul esteja três quartos do caminho em direção ao final do gel. Nós coramos o gel usando papel de brometo de etídio InstaStain (Edvotek) porque isso reduz a exposição potencial ao brometo de etídio e é mais seguro para o uso do aluno. O gel de agarose é colocado em camadas sobre uma folha de brometo de etídio, uma segunda folha é colocada sobre o gel e um peso leve é ​​colocado sobre o gel. Após 10-15 minutos, as folhas são removidas e o gel é visualizado sob luz ultravioleta.

Separando os produtos de PCR através de um gel de agarose e coloração com brometo de etídio (Figura 2) mostra uma banda clara no comprimento esperado para cada conjunto de iniciadores: 692 pb para claudina-2 e 604 pb para claudina-12. Cada conjunto de primers mostra um produto de PCR aprimorado logo abaixo da temperatura de anelamento calculada (60 [degrees] C para claudina-2 e 67 [degrees] C para claudina-12). À medida que a temperatura se desviou da temperatura de recozimento ideal observada, diminuindo ou aumentando, a quantidade de produto diminuiu proporcionalmente. Os primers claudin-12 foram capazes de produzir o produto de PCR esperado em uma faixa mais ampla de temperaturas de anelamento do que os primers claudin-2 porque os primers claudin-12 têm um [T.sub.m] maior, o que permitiu um primer mais estável -DNA duplex do que os primers claudin-2, apoiando assim o alongamento do primer em temperaturas mais altas.

** Avaliação da compreensão do aluno

Para avaliar o aprendizado do aluno, o primeiro laboratório começa com um pré-teste que consiste em 20 questões de múltipla escolha elaboradas para testar o conhecimento do aluno sobre DNA e PCR. Segue-se uma discussão aprofundada para ensinar aos alunos os conceitos básicos da síntese de DNA e como sequências de genes específicos de DNA podem ser amplificadas usando PCR. Os detalhes de cada módulo de laboratório são descritos e as variáveis ​​que afetam a PCR são listadas por classe. Isso permite aos alunos compreender a importância da otimização em protocolos experimentais. Os alunos frequentemente realizam exercícios de laboratório sem pensar no trabalho meticuloso envolvido no desenvolvimento do protocolo e sem compreender e analisar totalmente os resultados de seus experimentos (Phillips et al., 2008). O instrutor e os alunos devem explorar quais variáveis ​​cada grupo testará e a base de suas hipóteses. Um pós-teste com as mesmas questões é fornecido no início do módulo 1 para avaliar a compreensão dos conceitos e a preparação para o exercício de laboratório. As questões incluem cálculos numéricos para a razão CG e temperatura de recozimento. Além disso, no final do módulo 3, cada grupo de laboratório deve enviar um relatório de laboratório escrito em formato científico que inclui dados calculados sobre os primers usados ​​e imagens dos géis de agarose.

Este conjunto de exercícios de laboratório apresenta aos alunos a amplificação de DNA usando PCR de uma forma que demonstra os princípios básicos da PCR com ênfase nos parâmetros que a influenciam. Os alunos aprendem como o projeto do primer influencia a temperatura de recozimento e como este é apenas um dos muitos parâmetros que podem alterar significativamente o resultado do experimento. Destacar essas variáveis ​​incentiva os alunos a pensar fora do protocolo do "livro de receitas" padrão para PCR e, assim, promove as habilidades de pensamento crítico necessárias para o sucesso e a aprendizagem ao longo da vida.

Este trabalho foi apoiado pelo National Institutes of Health AREA grant no.R15DK088052 para A.R.P.

Baker J.C., Crumley, R.E. & amp Eckdahl, T.T. (2002). PCR de DNA polipersrfico amplificado aleatoriamente no laboratório de ensino de microbiologia: identificação de bactérias desconhecidas. Educação em Bioquímica e Biologia Molecular. 30. 394-397.

Baker, W.P., Jarman M., Ronstadt-Moore, C. & amp Rhodess, S. (1999). Apresentando alunos de graduação ao diagnóstico de virologia usando PCR. Journal of College Science Teaching, 28, 423-426.

Cha, R.S. & amp Thilly, W. G. (1993). Especificidade, eficiência e fidelidade

de PCR. Genome Re2earch, 3, S18-S29.

Chomczynski, P. & amp Sacchi, N. (2006). O método de uma única etapa de isolamento de RNA por tiocianato de guanidínio ácido - fenol - extração com clorofórmio: vinte e poucos anos depois. Nature Protocols, 1, 581-585.

Dieffenbach, C.W., Lowe, T.M.J. & amp Dvekskler, G.S. (1993). Conceitos gerais para o design de primers de PCR. Genome Research, 3, S30-S37.

Dong, Y., Guerrero, S. & amp Moran, M.A. (2008). Usando a tecnologia de DNA para explorar a diversidade bacteriana marinha em um pântano salgado costeiro da Geórgia. American Biology Teacher, 70), 278-283.

Phillips, A.R., Robertson, A.L., Batzli J., Harris, M. & amp Miller, S. (2008). Alinhando objetivos, avaliações e atividades: uma abordagem para ensinar PCR e eletroforese em gel. CBE Life Sciences Education, 7,96-106.

Spandidos, A., Wang, X., Wang, H. & amp Wang, H. Seed, B. (2010). PrimerBank: um recurso de pares de primers de PCR humano e de camundongo para a detecção e quantificação da expressão gênica Nucleic Acids Research, 38, D792-D799.


Criando modelo de expressão a partir de PCR: qual temperatura de anelamento usar? - Biologia

Você solicitou uma tradução automática de um conteúdo selecionado de nossos bancos de dados. Esta funcionalidade é fornecida exclusivamente para sua conveniência e não tem a intenção de substituir a tradução humana. Nem a BioOne nem os proprietários e editores do conteúdo fazem, e se isentam explicitamente, de quaisquer representações ou garantias expressas ou implícitas de qualquer tipo, incluindo, sem limitação, representações e garantias quanto à funcionalidade do recurso de tradução ou a precisão ou integridade de as traduções.

As traduções não são retidas em nosso sistema. O uso deste recurso e as traduções estão sujeitos a todas as restrições de uso contidas nos Termos e Condições de Uso do site da BioOne.

Determinando as temperaturas de recozimento para a reação em cadeia da polimerase

Angela R. Porta, * Edward Enners *


* Angela R. Porta é uma distinta professora do Departamento de Ciências Biológicas e Edward Enners é um estudante de pós-graduação no Programa de Mestrado em Biotecnologia do Centro de Ciência, Tecnologia e Educação Matemática de New Jersey na Kean University, 1000 Morris Avenue, Union, New Jersey 07083. E-mail: [email protected] e [email protected]

Inclui PDF e HTML, quando disponível

Este artigo está disponível apenas para assinantes.
Não está disponível para venda individual.

A reação em cadeia da polimerase (PCR) é uma técnica comum usada no ensino de ciências do ensino médio e de graduação. Os alunos muitas vezes não compreendem totalmente os princípios básicos da técnica e como a otimização do protocolo afeta o resultado e a análise. Neste laboratório de biologia molecular, os alunos aprendem as etapas do PCR com ênfase na composição do primer e na temperatura de anelamento, que eles manipulam para testar o efeito na amplificação bem-sucedida do DNA. Os alunos elaboram experimentos para testar suas hipóteses, promovendo uma abordagem baseada em descobertas para o ensino de laboratório e o desenvolvimento de raciocínio crítico e habilidades de raciocínio.


Guia de solução de problemas de PCR

Os problemas comuns na PCR estão principalmente associados às condições de reação, precisão da sequência e rendimento e especificidade da amplificação. Nesta página, aprenda sobre suas possíveis causas e nossas recomendações sobre como resolver esses problemas.

Nesta página:

  • Minimize o cisalhamento e o corte do DNA durante o isolamento. Avalie a integridade do DNA modelo por eletroforese em gel, se necessário.
  • Armazene o DNA em água de grau molecular ou tampão TE (pH 8,0) para evitar a degradação por nucleases.
  • Siga rigorosamente as recomendações do fabricante ao usar kits de purificação para isolar DNA modelo. Consulte o manual do usuário e os guias de solução de problemas para atenuar a baixa qualidade do DNA.
  • Certifique-se de que não há inibidores residuais de PCR, como fenol, EDTA e proteinase K, se seguir os protocolos de purificação de DNA químico ou enzimático.
  • Purificar novamente ou precipitar e lavar o DNA com etanol a 70% para remover os sais ou íons residuais (por exemplo, K +, Na +, etc.) que podem inibir as polimerases de DNA.
  • Escolha DNA polimerases com alta processabilidade, que apresentam alta tolerância a inibidores de PCR comuns transportados do solo, sangue, tecidos vegetais, etc.
  • Examine a quantidade de DNA de entrada e aumente a quantidade, se necessário.
  • Escolha DNA polimerases com alta sensibilidade para amplificação.
  • Se apropriado, aumente o número de ciclos de PCR.
  • Escolha DNA polimerases com alta processabilidade, que apresentam alta afinidade para modelos de DNA e são mais adequadas para amplificar alvos difíceis.
  • Use um aditivo ou co-solvente de PCR para ajudar a desnaturar o DNA rico em GC e as sequências com estruturas secundárias.
  • Aumente o tempo de desnaturação e / ou temperatura para separar com eficiência os modelos de DNA de fita dupla.
  • Verifique a capacidade de comprimento de amplificação das DNA polimerases selecionadas. Use DNA polimerases especialmente projetadas para PCR longo.
  • Escolha DNA polimerases com alta processabilidade, que podem amplificar alvos longos em um tempo mais curto.
  • Reduza as temperaturas de recozimento e extensão para ajudar na ligação do primer e termoestabilidade da enzima.
  • Prolongue o tempo de extensão de acordo com os comprimentos do amplicon.
  • Revise o projeto do primer. Use ferramentas de design de primer online quando apropriado.
  • Certifique-se de que os primers são específicos para o alvo de interesse.
  • Verifique se os primers são complementares às fitas corretas do DNA alvo.
  • Alíquotas de primers após a ressuspensão e armazenadas adequadamente.
  • Reconstitua alíquotas de primer frescas ou obtenha novos primers, se necessário.
  • Otimize as concentrações de primer (geralmente na faixa de 0,1–1 μM).
  • Para PCR longa e PCR com primers degenerados, comece com uma concentração mínima de 0,5 μM.
  • Use DNA polimerases de inicialização a quente para evitar a degradação de primers pela atividade de exonuclease 3 ’→ 5’ de revisão de DNA polimerases. As polimerases de DNA hot-start também aumentam os rendimentos dos produtos de PCR desejados, eliminando a amplificação não específica.
  • Como alternativa, configure o PCR em gelo ou adicione a DNA polimerase por último à mistura de reação.
  • Escolha DNA polimerases com alta sensibilidade para amplificação.
  • Revise as recomendações sobre a quantidade de DNA polimerase a ser usada na PCR e otimize conforme necessário.
  • Aumente a quantidade de DNA polimerase se a mistura de reação contiver uma alta concentração de um aditivo (por exemplo, DMSO, formamida) ou inibidores das fontes de amostra.
  • Otimize a concentração de Mg 2+ para rendimentos máximos de PCR. A presença de EDTA, outros quelantes de metal ou concentrações atipicamente altas de dNTPs podem exigir uma concentração mais alta de Mg 2+.
  • Verifique a preferência da DNA polimerase por soluções de sal de magnésio. Por exemplo, Pfu DNA polimerase funciona melhor com MgSO4 do que com MgCl2.
  • Revise as concentrações recomendadas de aditivos ou co-solventes de PCR. Use a concentração mais baixa possível quando apropriado.
  • Ajuste as temperaturas de recozimento, pois altas concentrações de aditivos de PCR ou co-solventes enfraquecem a ligação do primer ao alvo.
  • Aumente a quantidade de DNA polimerase ou use DNA polimerases com alta processabilidade.
  • Considere o uso de um aditivo ou co-solvente formulado especificamente para uma dada DNA polimerase (por exemplo, GC Enhancer fornecido com Invitrogen Platinum DNA polimerases).
  • Certifique-se de que as DNA polimerases selecionadas são capazes de incorporar os nucleotídeos modificados.
  • Otimize a proporção do nucleotídeo modificado para dNTP para aumentar a eficiência de PCR.
  • Misture os estoques de reagentes e as reações preparadas completamente para eliminar gradientes de densidade que podem ter se formado durante o armazenamento e configuração.
  • Otimize o tempo e a temperatura de desnaturação do DNA. Tempos de desnaturação curtos e baixas temperaturas podem não separar bem os modelos de DNA de fita dupla. Por outro lado, longos tempos de desnaturação e altas temperaturas podem reduzir a atividade enzimática.
  • Otimize a temperatura de recozimento em incrementos de 1–2 ° C, usando um ciclador de gradiente, quando disponível. A temperatura ideal de recozimento é geralmente 3-5 ° C abaixo do primer T mais baixom.
  • Ajuste a temperatura de recozimento quando um aditivo de PCR ou co-solvente é usado.
  • Use a temperatura de recozimento recomendada para uma polimerase de DNA específica em seu buffer ideal. As regras de temperatura de recozimento para conjuntos de primers podem variar entre as diferentes DNA polimerases.
  • Selecione um tempo de extensão adequado para o comprimento do amplicon.
  • Reduza a temperatura de extensão (por exemplo, para 68 ° C) para manter a enzima ativa durante a amplificação de alvos longos (por exemplo, & gt10 kb).
  • Use DNA polimerases com alta processabilidade para amplificação robusta, mesmo com tempos de extensão curtos.
  • Ajuste o número de ciclos (geralmente para 25–35 ciclos) para produzir um rendimento adequado de produtos de PCR. Estenda o número de ciclos para 40 se a entrada de DNA for inferior a 10 cópias.
  • Reveja as quantidades ideais de entrada de DNA. Diminua a quantidade para reduzir a geração de produtos de PCR não específicos.
  • O DNA degradado pode aparecer como manchas ou levar a alto background na eletroforese em gel. Minimize o cisalhamento e o corte do DNA durante o isolamento.
  • Avalie a integridade do DNA molde antes da PCR por eletroforese em gel, se necessário. Armazene o DNA em água de grau molecular ou tampão TE (pH 8,0) para evitar a degradação por nucleases.
  • Escolha DNA polimerases com alta processabilidade, que apresentam alta afinidade para modelos de DNA e são mais adequadas para amplificar alvos difíceis.
  • Use um aditivo ou co-solvente de PCR para ajudar a desnaturar o DNA rico em GC e as sequências com estruturas secundárias. Aumente o tempo de desnaturação e / ou a temperatura para separar com eficiência os modelos de DNA de fita dupla.
  • Verifique a capacidade de comprimento de amplificação das DNA polimerases selecionadas. Use DNA polimerases especialmente projetadas para PCR longo.
  • Escolha DNA polimerases com alta processabilidade, que podem amplificar alvos longos em um tempo mais curto.
  • Reduza as temperaturas de recozimento e extensão para ajudar na ligação do primer e termoestabilidade da enzima. Prolongue o tempo de extensão de acordo com os comprimentos do amplicon.
  • Revise o projeto do primer. Use ferramentas de design de primer online quando apropriado. Verifique se os primers são específicos para o alvo, com homologia mínima com outras regiões do modelo.
  • Certifique-se de que os iniciadores não contêm sequências complementares ou nucleotídeos G ou C consecutivos nas extremidades 3 ', para evitar a formação de dímero de iniciador.
  • Evite repetições diretas nos primers para prevenir o desalinhamento na ligação com o alvo. Considere primers mais longos para aumentar a especificidade.
  • Considere PCR aninhado para melhorar a especificidade.
  • Otimize as concentrações de primer (geralmente na faixa de 0,1–1 μM). Altas concentrações de primer promovem a formação de primer-dímero.
  • Revise as recomendações sobre a quantidade de DNA polimerase a ser usada na PCR e diminua conforme necessário.
  • Use DNA polimerases de inicialização a quente que não têm atividade em temperatura ambiente, mas são funcionais apenas após uma etapa de ativação de alta temperatura, para aumentar a especificidade. Com polimerases de DNA não-hot-start, configure PCR em gelo para manter a atividade enzimática baixa.
  • Revise as concentrações de Mg 2+ e reduza conforme apropriado para evitar produtos de PCR não específicos. Otimize as concentrações de Mg 2+ para cada conjunto de primers e DNA alvo.
  • Aumente o tempo de desnaturação e / ou temperatura para separar DNA de forma eficiente ao trabalhar com modelos ricos em GC e sequências com estruturas secundárias.
  • Use a temperatura de recozimento recomendada para uma DNA polimerase específica em seu tampão ideal. As regras de temperatura de recozimento para conjuntos de primers podem variar entre as diferentes polimerases de DNA.
  • Aumente a temperatura de recozimento para melhorar a especificidade. A temperatura ideal de recozimento geralmente não é inferior a 3-5 ° C abaixo do primer mais baixo Tm.
  • Otimize a temperatura de recozimento em incrementos de 1–2 ° C, usando um ciclador de gradiente, quando disponível.
  • Considere a PCR touchdown para aumentar a especificidade.
  • Encurte o tempo de recozimento para minimizar a ligação do iniciador a sequências não específicas.
  • Reduza a temperatura de extensão em 3–4 ° C para ajudar na termoestabilidade da DNA polimerase, especialmente para PCR longa.
  • Prolongue o tempo de extensão ao amplificar alvos de DNA longos.
  • Inclua uma etapa final de extensão com tempo suficiente (5–15 minutos) para estender todo o alvo.
  • Reduza o número de ciclos, sem diminuir drasticamente o rendimento dos produtos de PCR desejados, para evitar o acúmulo de amplicons não específicos.
  • Use DNA polimerases com fidelidade excepcionalmente alta para gerar fragmentos de PCR para aplicações downstream, como clonagem, sequenciamento e mutagênese dirigida ao local.
  • Revise as concentrações de Mg 2+ e reduza conforme necessário. Concentrações excessivas favorecem a incorporação incorreta de nucleotídeos por DNA polimerases.
  • Assegure as concentrações equimolares de dATP, dCTP, dGTP e dTTP na reação. As concentrações desequilibradas de nucleotídeos aumentam a taxa de erro de PCR.
  • Reduza o número de ciclos sem diminuir drasticamente o rendimento dos produtos de PCR desejados. Números elevados de ciclos aumentam a incorporação de nucleotídeos incompatíveis.
  • Aumente a quantidade de DNA de entrada quando apropriado para evitar a execução de um número excessivo de ciclos.
  • Use uma caixa de luz UV de longo comprimento de onda (360 nm) para visualizar fragmentos em géis e limite o tempo de iluminação tanto quanto possível.
  • Se estiver usando uma caixa de luz de comprimento de onda curto (254–312 nm), limite a iluminação UV a alguns segundos e mantenha o gel em uma placa de vidro ou plástico.
  • Como alternativa, use corantes com excitação de comprimento de onda mais longo (menos prejudicial) para visualizar o DNA.
  • Sequenciar ambas as fitas de DNA para verificar a confiabilidade dos resultados do sequenciamento. Use amostras duplicadas quando apropriado.
  • Evite repetições diretas dentro das sequências de primer, pois várias repetições podem aparecer devido ao desalinhamento da sequência nas extremidades dos produtos de PCR.
  • Solicite primers de PCR com purificação para remover oligos de DNA não completos, que são truncados em suas extremidades 5 ′.
  • Use reagentes de grau molecular, sem nuclease, na configuração de PCR. Configure reações no gelo para manter baixa a atividade de possíveis exonucleases contaminantes.
  • Use uma caixa de luz UV de longo comprimento de onda (360 nm) para visualizar fragmentos em géis e limite o tempo de iluminação tanto quanto possível.
  • Se estiver usando uma caixa de luz de comprimento de onda curto (254–312 nm), limite a iluminação UV a alguns segundos e mantenha o gel em uma placa de vidro ou plástico.
  • Como alternativa, use corantes com excitação de comprimento de onda mais longo (menos prejudicial) para visualizar o DNA.
  • Sequenciar ambas as fitas de DNA para verificar a confiabilidade dos resultados do sequenciamento. Use amostras duplicadas quando apropriado.
  • Evite primers contendo sequências complementares e autocomplementares, que favorecem a formação de primer-dímero e auto-oligomerização e sua subseqüente amplificação.
  • Evite a contaminação do DNA no ambiente de trabalho, seguindo as recomendações gerais para a configuração do PCR.
  • Use pipette tips with aerosol barriers. Dedicate a separate work area and decontaminate the area after each use.
  • Follow PCR carryover control techniques such as dUTP incorporation with UDG treatment.

For more troubleshooting assistance, please visit our End-Point PCR and PCR Primers Support Center or contact our technical support team.


PrimerDigital

  • Primer Tm and annealing temperatures (Ta) values should be determined using PrimerDigital’s Tools
  • Non-specific product formation can often be avoided by optimizing the annealing temperature or by switching to a hot start enzyme
  • Ta can be optimized by doing a temperature gradient PCR, starting at 5°C below the lowest Tm of the primer pair
  • Ideally, primer Tm values should be near to the extension temperature. If Tm values are calculated to be greater than the extension temperature, a two-step PCR program (combining annealing and extension into one step) can be employed
  • The most important values for estimating the Ta is Tm and the length of PCR fragment (L)
  • Primers with high Tm's (> 60°C) can be used in PCRs with a wide Ta range compared to primers with low Tm's ( min ):
    Onde eu is length of PCR fragment.

Extension

  • Extension temperature recommendations range from 65°–75°C and are specific to each PCR polymerase
  • Extension rates are specific to each PCR polymerase. In general, extension rates range from 10–60 seconds per kb
  • Longer than recommended extension times can result in higher error rates, spurious banding patterns and/or reduction of amplicon yields

Protocols

Direito autoral

You are authorized to view the materials at this website only for your internal information purposes provided that you:
(i) retain all notices contained in the original materials
(ii) only use images with surrounding text relating to the images and
(iii) include the following copyright notice.


3 basic steps of PCR process

The polymerase chain reaction is a three step cycling process consisting of defined sets of times and temperatures.

3 basic PCR steps include:

Each of these polymerase chain reaction steps is repeated 30–40 times (cycles).

In the course of each cycle, the PCR reaction mixture is transferred between three temperatures.

Profile of 3 basic PCR steps

During successive cycles of basic PCR steps (denaturation, annealing, and extension) all the new strands will act as DNA templates causing an exponential increase in the amount of DNA produced.

Each cycle doubles the number of DNA molecules (amplicons) amplified from the DNA template.

First polymerase chain reaction step – DNA denaturation

The first of 3 PCR steps is a denaturation step.

During the denaturation step, the hydrogen bonds that hold together the two strands of the double-stranded nucleic acids are broken and the strands unwind from each other.

This process releases single-stranded DNA to act as templates in the final PCR extension step.

The denaturation temperature is above 90°C (usually 94°C) and the time is up to one minute (usually 30 seconds).

Polymerase chain reaction steps

Second polymerase chain reaction step – DNA Primer annealing

At the annealing step, DNA primers line up on exposed nucleotide sequences at the DNA target according to base-pairing rules. This is a typical temperature-dependent DNA : DNA hybridization reaction and has to be optimized.

This is the only temperature in a PCR cycle steps that can be widely varied.

The temperature depends on the exact sequence and length of the primers.

Usually, the PCR reaction mixture is cooled down to 40–60°C. However, annealing temperatures for DNA templates with a high GC content can be as high as 72°C (the normal temperature of the extension step).

The temperature for this PCR step is chosen for the optimum binding of the DNA primers to the correct DNA template and depends on primer’s melting temperature. The wrong annealing temperature can result in false products, or in no detectable products at all.

Since the primers are relatively short, and at high molar concentrations, duration of the annealing step is around 30 seconds.

At this step, the annealed oligonucleotides provide a free 3’ hydroxyl group for Taq polymerase and act as primers for synthesis of nucleic acids.

Final polymerase chain reaction step – DNA synthesis

The last of 3 basic PCR steps is called extension or elongation step.

It is the DNA synthesis step and carried out by a thermostable DNA polymerase (usually Taq polymerase).

The temperature of the elongation step is usually set at 72°C. It is slightly below the optimum for Taq polymerase.

The Taq polymerase produces complementary DNA strands starting from the primers.

The synthesis proceeds at approximately 1000 bases per minute.

Therefore, to amplify a DNA template that is 500 bases in length, under normal conditions a time of the PCR extension step should be at least 30 seconds.

Usually, PCR extension time is 30 seconds for every 500 bp (base pair) of product.


PCR: The Polymerase Chain Reaction

The polymerase chain reaction, or PCR, is a technique used to amplify DNA through thermocycling – cyles of temperature changes at fixed time intervals. Using a thermostable DNA polymerase, PCR can create numerous copies of DNA from DNA building blocks called dNTPs. There are three steps in PCR: denaturation, annealing, and elongation. Denaturation is the first step in the cycle and causes the DNA to melt by disrupting hydrogen bonds between the bases resulting in single-stranded DNA. Annealing lowers the temperature enough to allow the binding of oligonucleotide primers to the DNA template. During the elongation step DNA polymerase will synthesize new double-stranded DNA.

This video provides an introduction to the PCR procedure. The basic principles of PCR are described as well as a step-by-step procedure for setting up a generalized PCR reaction. The video shows the necessary components for a PCR reaction, includes instruction for primer design, and provides helpful hints for ensuring successful PCR reactions.

Procedimento

The polymerase chain reaction or PCR is a widely used method for amplifying DNA fragments. PCR uses thermocycling, which is the repeated heating and cooling of the reaction via three distinct temperatures called denaturation, annealing and extension or elongation.

The thermocycling reaction begins once the PCR reagents are put into a thermocycler a machine, which is programmed to precisely heat and cool the reaction.

The PCR cycle begins with denaturation, which occurs for 20 to 30 seconds at 95 °C, well above the melting temperature of DNA. The melting temperature is a state where half of the DNA is a double stranded helix and the other is a single stranded random coil. The denaturation temperature is well above the melting temperature, in order to ensure that all the hydrogen bonds between complementary base pairs are broken yielding only single stranded DNAs. Paired single strands are termed the sense and antisense strands. The sequence of the sense, or coding strand, is identical to the sequence of mRNA, which will ultimately code for protein. Therefore, it makes sense. When read from left to right it begins with the 5’ phosphate and ends with the 3’ hydroxyl. The antisense strand is also called the complementary strand and begins with 3’ hydroxyl and ends with the 5’ phosphate when read from left to right.

In the second step, annealing, short pieces of DNA called primers, which are specific to the sense or antisense strands bind via hydrogen bonds. The primer that binds to the antisense strand and has the same sequence as the sense strand is the forward or sense primer. The primer that binds to the sense strand and has a sequence that is reverse and complementary to the sense strand is your reverse or antisense primer. Depending on the length of primers used the annealing temperature for this step is usually 3 to 5 °C below the lower melting temperature of your two primers. Annealing tends to occur between 50 and 65 °C and lasts for 20 to 40 seconds.

Once the primers bind to DNA they prime the reaction by creating a 3’ hydroxyl group end to which a polymerase, an enzyme that replicates DNA, will bind.

The next step called elongation or extension occurs at 72 °C, which is optimal for polymerase activity. Once bound the polymerase begins to add free nucleotide triphosphates, or dNTPs, to the ends of the primer one at a time in the 5’ to 3’ direction to make double stranded DNA.

Once elongation completes the next cycle begins. In the next cycle primers will bind to single stranded DNA formed via previous extension. The short fragment you are trying to amplify, the amplicon, will ultimately form when the polymerase extends from the forward primer on a strand that was generated by amplification from the reverse primer or vice versa. Once generated, the amount of amplicon will increase exponentially in subsequent cycles. Depending on the goal of your reaction, 20 to 40 cycles will be needed.

For long amplicons, a final elongation step is typically run at 72 °C for 5 to 15 minutes in order to ensure all DNA is double stranded. Usually, a final hold step at 4 °C is programmed into the thermocycler as a precautionary step to ensure that the DNA remains stable until taken out of the thermocycler.

The PCR reaction requires several key reagents. First is the DNA template, which is the DNA sample from which your fragment will be amplified. Then there are your primers, which are the short pieces of DNA or oligonucleotides that prime the polymerase reaction.

There are several important considerations that need to be taken when choosing your primers. First, they must be complementary to the 5’ and 3’ regions of your DNA template that flank the sequence you want to amplify. Second, they should be between 15 and 30 base pairs long and be comprised of about 50% guanines and cytosines. Third, the melting temperatures of both primers should be above 50 °C and within one to two degrees of each other so they can efficiently bind at the same annealing temperature. Fourth, they can’t be complementary to each other and form primer dimers. And fifth, they should not contain secondary structure, which is form by self-annealing within one of the primers.

In addition to the primers and DNA template, DNA polymerase is essential for the PCR reaction. The enzyme most commonly used in PCR is Taq polymerase, which is a thermostable enzyme isolated from the bacterium Thermus aquaticus that makes its home in hot springs. Taq polymerase can withstand temperatures greater than 90 °C.

dNTPs, which will comprise the base pairs in the growing strands, must also be added to the reaction. A reaction buffer, which maintains pH and contains important ions like manganese, magnesium and potassium, is also a necessary reaction component that stabilizes the reaction and provides important cofactors to the polymerase enzyme. Like all reactions, PCR needs a solvent, and so PCR grade water, which is free of ions that can inhibit the reaction, is used.

Before beginning the PCR make sure the working environment is clean to avoid contamination. Gloves must always be worn.

To help with keeping track of the various reaction components that you will need. Make a table of reagent volumes and concentrations for each of your samples including controls. In terms of volumes a typical reaction should contain 5μL of 10X reaction buffer, 4μL of 25 mM MgCl2, 1μL of dNTPs at 10 mM, 2μL of forward and reverse primers at 50 ng/μL, and 0.3μL of Taq polymerase at 5 U/μL. You want to add enough template so that 100 ng is present in the reaction. Finally, most PCR reactions are conducted in a total volume of 50μL. So a volume of PCR grade water must be used to ensure the total volume is indeed, 50μL.

Once your reaction is planned on paper assemble your reagents on ice.

Next, add your reagents to the PCR tube. First add water, then your template, your primers, buffer, magnesium chloride, and dNTPs, add Taq polymerase last and mix thoroughly.

After your reaction is setup place your sample in a thermocycler and start your PCR program. Briefly, parts of the machine consist of a thermoblock, where the PCR tube or plate is inserted and subject to precise temperature changes. A heated lid, which prevents condensation so no sample is lost and an interface with a display for programming PCR temperatures and cycle durations. Always setup your program before assembling the reaction.

Once the thermocycler has done its job. Take out your reaction and verify the PCR product with gel electrophoresis. If the PCR is successful, you should see the amplicon at the correct base pair size.

And now for some helpful hints when working with PCR. When you are trying to amplify the same PCR product from a number of different templates and therefore have a lot of different reactions to setup. It is useful to scale up the reaction to create a master mix. The PCR master mix is a large volume mixture of all the reagents shared among your samples, which is later distributed into multiple reaction tubes.

Most PCR reactions begin with an initial denaturation step, which occurs at 95°C for 1 to 9 minutes. This step ensures that all of the template is single stranded for the first amplification cycle.

Often it is desirable to use a PCR cabinet when the risk of contaminating your sample is high. To check for any contamination in your reaction it is beneficial to setup a negative control, which has no DNA template and shouldn’t produce a product in your DNA gel.

Often PCR must be optimized by adjusting temperatures, magnesium chloride concentration, or trying new primers. Once you have your PCR working. It’s a good idea to always run a positive control template, which you know will produce a product.

Many variations and applications of PCR exist for a variety of purposes.

One variation of PCR, hot start PCR, involves withholding the polymerase from the reaction until after the first denaturation step, which prevents nonspecific amplification that might occur before cycling.

PCR can also be modified to simultaneously amplify multiple DNA sequences by employing multiple primers in a single PCR reaction called multiplex PCR.

In combination with fluorescent oligonucleotide probes, PCR can actually become a technique that can measure relative or absolute levels of gene expression or how much mRNA is produced for a given gene or group of genes. This method is referred to as qPCR.

PCR can also be used to determine the presence of a particular DNA sequence in an organism. This procedure is referred to as genotyping. For example, genotyping can be used to determine the authenticity of fish samples by figuring out if a species specific sequence is present in the sample. Genotyping is also used in forensic analysis to determine if DNA found at the scene of a crime matches a suspect.

You’ve just watched JoVE’s introduction to PCR. In this video we reviewed what PCR is and how it works, the many components of the PCR reaction, the mechanism by which PCR can amplify DNA and the many variations and applications of this highly useful technique. Thanks for watching!


Creating expression template from PCR: What annealing temperature to use? - Biologia

The polymerase chain reaction (PCR) 1 is a trick for producing relatively large amounts of a specific DNA or RNA sequence from only a few molecules of template. (Keep in mind that "relatively large amounts" typically means µg of the DNA or RNA.) Thus, PCR is said to "amplify" a particular sequence. PCR has a enormous number of practical applications. For example, PCR can be used for cloning specific genes, for sequencing genes, for studying gene expression, for mapping mutations, and for making mutations. Because of its broad impact on biology, Kary Mullis recieved a Nobel Prize in 1993 for his insight in developing this technique.

PCR amplification of DNA occurs by repeated cycles of three temperature dependent steps: (1) the double-stranded DNA (dsDNA) template is denatured (2) oligonucleotide primers are annealed to the single-stranded DNA (ssDNA) template (one primer is designed to anneal to a specific region on the left side of one of the strands of DNA and the other primer is designed to anneal to a specific region on the right side of the complementary strand of DNA) and (3) DNA polymerase extends each primer in the 5' to 3' direction, duplicating the DNA fragment between the primers. With each cycle of denaturing, annealing, and synthesis the specific DNA fragment is amplified exponentially. The basic idea is shown in the following figure.

DNA synthesized during the first cycle has the 5' end of the primers and a variable 3' end. When these strands are denatured, the parental strand will rehybridize to the primer, so the product with a variable 3' end will continue to be synthesized during subsequent cycles of PCR. (Only one copy of each of the products with a variable 3' end will accumulate with each cycle.) The second cycle of denaturation, annealing, and primer extension produces discrete products with the 5' end of one primer and the 3' end of the other primer. Each strand of this discrete product is complementary to one of the two primers and thus acts as a template in subsequent cycles. Therefore, these products with defined 5' and 3' ends accumulate exponentially with each round of DNA amplification -- that is, for every n cycles of PCR there will be 2 n -fold amplification of the specific DNA fragment.

PCR reactions.

The purity and yield of the PCR products depend on each of the reaction conditions: the temperature during each step of the cycle the purity and sequence of the DNA template the length and sequence of the oligonucleotide primers the DNA polymerase used the concentration of Mg ++ , the buffer, and other chemicals added to the reaction and the number of cycles of PCR.

    Denature. The first step requires a high temperature to denature the dsDNA. This is typically done by briefly heating the sample to 92-94 o C.

1 The PCR process is patented by Hoffmann-La Roche Inc. Use of the PCR process requires a license. For an interesting discussion of the legal controversy over this patent, check out the article on the patent dispute from The Scientist.


Kansas State University

* Check to make sure that this isn’t already in the buffer – if it is, don’t add separately! Mg is one of the first things to change if your PCR does not work, after trying a temperature gradient. Do a gradient of 0.5mM increments.

Cycle Conditions

When you are first trying a PCR, it is often useful to do a temperature gradient. Use the following guidelines for designing your program.

Temp: 95°C. Time: 5 min on initial cycle 30 seconds to 1 min on rest

Temp: 5°C below Tm of primers no lower than 40°C. Time: 30-45 seconds. This is the step where you would use a gradient.

1 min/kb of expected product 5-10 min on last cycle.

Here is a sample PCR Program, using a wide gradient, for an expected product of about 1kb. The first step of 95 forever is just to heat the block before you add your tubes, and you would then press enter or proceed to continue to step 2. Step 8 is just to hold your PCR at a low temperature until you take it out. Do not leave in overnight!

Temperature (°C)

The temperature gradient goes from left to right, left being the low end and right being the high end. For example, in the above gradient, all of column one is 45°C, and all of column 12 is 65°C, with the columns in between being equally spaced between that.

If, after you have tried both temperature and magnesium gradients (and checked all your reagents) your PCR still does not work, you can try using one of the following additives, listed in the order you should try them:

  • Bovine serum albumin (BSA): 10-100ug/ml
  • DMSO: 1-10%
  • Formamide: 1.25-10%
  • PEG-6000: 5-15%
  • Glycerol: 5-20%

For specific instructions on how to enter your program into the thermocycler, see the manual for the thermocycler you want to use. They are kept in the drawer to right of the machines.


Primer sequences for a taste receptor gene

Here is an example based on the human TAS2R38 gene, which encodes a taste receptor protein. In Bio 6B (assuming that you're not taking the class online), you'll use PCR to amplify a segment of this gene from your own genome. The goal of that experiment will be to examine sequence differences from one person to another (see the experiment here).

Here is the complete sequence of the protein-coding region of the TAS2R38 gene from GenBank:

The target sequence (the region you will try to amplify using PCR) is highlighted in yellow.

Here is the sequence of the entire 303-bp (base pairs, or nucleotide pairs) PCR product shown above:

AACT GGCAGAATAA AGATCTCAAT TTAT TTTATT CCTTTCTCTT CTGCTATCTG TGGTCTGTGC CTCCTTTCCT ATTGTTTCTG GTTTCTTCTG GGATGCTGAC TGTCTCCCTG GGAAGGCACA TGAGGACAAT GAAGGTCTAT ACCAGAAACT CTCGTGACCC CAGCCTGGAG GCCCACATTA AAGCCCTCAA GTCTCTTGTC TCCTTTTTCT GCTTCTTTGT GATATCATCC TGTGTTGCCT TCATCTCTGT GCCCCTACTG ATTCTGTGGC GCGAC AAAAT AGGGGTGATG GTTTGTGTT

The primer binding regions are highlighted in orange. To show how the primers fit this template sequence, here is a version of the PCR product showing only the primer binding regions, with the rest of the nucleotides represented by dots:

5' AACTGGCAGAATAAAGATCTCAATTTAT. AAAATAGGGGTGATGGTTTGTGTT 3'

As usual, this nucleotide sequence shows only one of the two strands of the DNA. It's easier to visualize the primers if you see the sequence as double-stranded, like this:

5' AACTGGCAGAATAAAGATCTCAATTTAT . AAAATAGGGGTGATGGTTTGTGTT 3'
3' TTGACCGTCTTATTTCTAGAGTTAAATA. TTTTATCCCCACTACCAAACACAA 5'

The primer sequences used in this experiment, shown in red, are:

Forward Primer 5′ AACTGGCAGAATAAAGATCTCAATTTAT 3′

Reverse Primer 5′ AACACAAACCATCACCCCTATTTT 3′ .

Take a moment to study how the primers relate to the template sequence. Each primer is the reverse complement of one of the strands of DNA and identical to the other strand. This example is like the simplified one at the top of the page, but with more realistic sequences.

Keep in mind that primer sequences, like other nucleotide sequences, are normally given from 5' to 3'. The template DNA is double-stranded, but the primers are single-stranded.

Ready for a quiz?

Soon I will give you a quiz on this, and one of the questions will ask you to determine the correct primer sequences for a given target sequence. The way to answer that quiz question is simple:

  • First (left) primer: Copy the start of the target sequence. For the quiz, I'd have to tell you how many nucleotides long the primer should be. (This is sometimes referred to as the forward primer.)
  • Second (right) primer: take the reverse complement of the 3' end of the target sequence. (This is sometimes referred to as the reverse primer.)

How to figure out the reverse complement: I hope you can do this yourself, following the example shown above. It's easy to make a mistake, though if I was doing it, I'd probably use the Reverse Complement tool at Bioinformatics.org.

Keep in mind, I wouldn't be giving you such explicit instructions if I hadn't seen a lot of students get it wrong!


Referências

Visão geral

Vídeos

PCR Education from ThermoFisher. Watch the video, "Introduction to PCR."

PCR (Polymerase Chain Reaction) Tutorial - An Introduction from Applied Biological Materials. a manufacturer of PCR products. 8:50. Starts with a good basic overview, then goes into specifics of planning PCR experiments (maybe more than you want to know on Day 1).

PCR - Polymerase Chain Reaction (IQOG-CSIC) from CanalDivulgación. Visualization of PCR steps with dramatic music and no narration.

PCR Method Video from LabXchange. Walks you through the steps of performing PCR in the lab, along with the basic concepts.

Deep background

Role of MgCl2 in PCR Reaction. Genetic Education. Magnesium ions are important in PCR for several reasons, as explained in this article.


Assista o vídeo: Coloquei as alunas para atender uma PCR, veja o que aconteceu (Dezembro 2021).