Em formação

Projeto de primer degenerado para hibridização DIG in situ


Novo no molecular e aprendi a projetar primers no google / youtube, então qualquer informação ajudaria

Alguém estaria disposto a compartilhar seu protocolo para projeto de primer degenerado?

Repartição: Tentar projetar primers degenerados para amplificar / clonar genes GPCR específicos de um genoma não sequenciado de um determinado peixe.

Estou usando o Ensembl e o Genbank para sequências de peixes intimamente relacionados, mas o gene completo foi sequenciado apenas em 2 outras espécies de peixes. Eu uso o ClustalOmega para o alinhamento. É correto usar apenas 2 outras espécies para gerar degenerados?

1) Existem outros bons bancos de dados para sequências de genes?


Se o gene deve estar bem conservado, você pode usar a sequência das espécies relacionadas.

Para genes que codificam proteínas, direcione a sonda ISH para a região de codificação que é mais provável de ser conservada.

O que você também pode fazer posteriormente é:

  • amplificar o CDS
  • faça 3 'e 5' RACE
  • Clone em um plasmídeo (faça uma extremidade cega ou clonagem de TA)
  • Sequenciar a inserção
  • Projete primers exatos

Existem outros bons bancos de dados para sequências de genes?

EMBL e DDBJ


Patologia Molecular e # x02014 Hibridização In Situ

Na patologia molecular, a ênfase está na avaliação da expressão gênica, morfologia e no uso da análise da expressão gênica para validar um grande número de alvos.

Técnicas de patologia molecular têm sido usadas no laboratório clínico para auxiliar no diagnóstico e monitoramento de regimes de tratamento de muitas doenças infecciosas, como HIV, hepatite B e tuberculose (Netterwald 2006). Esses testes são geralmente realizados em fluidos sorológicos ou outros fluidos corporais, como expectoração e fluido seminal. Atualmente, o teste molecular mais conhecido e mais anunciado é o do papilomavírus humano (HPV).

Os laboratórios clínicos e especialmente de pesquisa podem usar técnicas adicionais de patologia molecular, como métodos de blotting que são usados ​​para estudar o ácido ribonucléico (RNA) e o ácido desoxirribonucléico (DNA) extraídos. Os métodos de transferência consistem em extrair DNA e / ou RNA de tecidos homogeneizados e, em seguida, analisar esses ácidos nucleicos usando métodos de hibridização com filtro de mancha, Southern e Northern (Sambrook et al 1989). Técnicas de blotting como essas são ferramentas poderosas para a análise qualitativa de ácido nucleico extraído de células frescas ou congeladas e tecidos congelados.

A reação em cadeia da polimerase (PCR) está incluída nos métodos de patologia molecular. PCR é um método comum de criação de cópias de fragmentos específicos de DNA. O PCR amplifica rapidamente uma única molécula de DNA em muitos bilhões de moléculas. Em uma aplicação da tecnologia, pequenas amostras de DNA, como as encontradas em um fio de cabelo na cena do crime, podem produzir cópias suficientes para a realização de testes forenses. A PCR também pode ser usada além da hibridização in situ (ISH) para estudar um genoma específico de um tecido (Innis et al 1990).

Tudo isso leva ao papel que o laboratório de histologia desempenha na patologia molecular. No laboratório de histologia, o principal método utilizado em patologia molecular é a hibridização in situ. John et al (1969) e Gall e Pardue (1969) descreveram a técnica de hibridização in situ quase simultaneamente.

A hibridização in situ é um método de localização e detecção de sequências de mRNA específicas em seções de tecido preservadas ou preparações de células por meio da hibridização da fita complementar de uma sonda de nucleotídeo com a sequência de interesse.

A hibridização in situ consiste em desnaturar (separar) as fitas de DNA / RNA usando calor. Uma sonda (uma fita simples complementar marcada) é incorporada às fitas de DNA / RNA de interesse. As fitas irão recozer (nucleotídeos se ligando novamente) com seus parceiros homólogos quando resfriadas (Fig. 26.1). Alguns irão recozer com as fitas complementares originais, mas alguns também irão recozer ou hibridizar com a sonda. Conforme as sondas aumentam de comprimento, elas se tornam mais específicas. As chances de uma sonda encontrar uma sequência homóloga diferente da sequência alvo diminui à medida que o número de nucleotídeos na sonda aumenta. O tamanho ideal da sonda para hibridização in situ é pequenos fragmentos de cerca de 200 & # x02013300 nucleotídeos. No entanto, as sondas podem ser tão pequenas quanto 20 & # x0201340 pares de bases (bp) ou tão grandes quanto 1000 bp.

A informação genética para os humanos é codificada em bilhões de nucleotídeos, os blocos de construção do código do DNA, dispostos em uma molécula de dupla hélice. Os nucleotídeos consistem em uma base, um açúcar (S) e um fosfato (P). O código do DNA é escrito em um alfabeto que usa quatro letras para representar cada uma das bases. (A) = adenina, (T) = timina, (C) = citosina, (G) = guanina. Essas bases formarão pares. (A) só irá emparelhar com (T). (G) só irá emparelhar com (C). Portanto, o DNA de fita dupla consiste em duas fitas de nucleotídeos homólogos. o Código genético no DNA está em trigêmeos, como ATG. A sequência de base desse tripleto na fita parceira é, portanto, TAC.

A detecção de sequências de ácido nucleico específicas & # x02014RNA, DNA viral ou DNA cromossômico & # x02014 em células, tecidos ou organismos inteiros por hibridização in situ tem inúmeras aplicações em biologia, patologia clínica e anatômica e pesquisa.

Os métodos ISH podem empregar sondas radiomarcadas que são visualizadas em um filme fotográfico ou emulsão fotográfica. No entanto, a maioria dessas sondas não funciona bem em tecidos processados ​​e fixados rotineiramente, requerem o uso de cortes congelados e levam cerca de 20 & # x0201350 dias de exposição antes de ver os resultados. O desenvolvimento de sondas não radiomarcadas com bom desempenho em espécimes cirúrgicos e de autópsia de rotina ampliou o campo da patologia anatômica.

A detecção de mRNA é particularmente útil se o produto proteico for rapidamente degradado ou transportado para fora da célula alvo.

Na detecção de ISH, métodos semelhantes a imuno-histoquímica (IHC) podem ser incorporados para detectar a sonda marcada (biotina, digoxigenina (DIG)). Então surge a pergunta: por que não apenas fazer IHC? É bem estabelecido, confiável e menos demorado do que o ISH. O IHC tem sido empregado nas arenas clínica e de pesquisa por várias décadas e se tornou um procedimento de rotina no laboratório de histologia. A IHC forneceu procedimentos diagnósticos e uma análise detalhada das proteínas dentro e nas membranas celulares. Então, por que ISH? As vantagens do ISH sobre o IHC são:

alto grau de especificidade.

O DNA e o mRNA não são tão sensíveis aos fixadores de formalina.

O híbrido sonda & # x02013alvo é mais forte do que o complexo anticorpo & # x02013antígeno.

fornece um meio alternativo de detecção quando anticorpos confiáveis ​​não estão disponíveis.

fornece um diagnóstico a nível molecular.

É importante entender o & # x02018como e por que & # x02019 dos diferentes estágios do processo ISH para que o teste resulte em um resultado funcional. Este capítulo enfoca & # x02018como e por que & # x02019 de ISH e procedimentos gerais em seções de tecido.


INTRODUÇÃO

A organização dos órgãos olfativos varia consideravelmente entre as espécies de vertebrados. Os peixes geralmente possuem um único órgão olfativo (Hamdani e Døving, 2007). Os sistemas olfatórios principal e vomeronasal claramente segregados anatomicamente apareceram pela primeira vez em anfíbios (Taniguchi et al., 2011) e persistiram na maioria dos vertebrados terrestres divergentes posteriores, incluindo roedores (Liberles, 2014). Em roedores, os sistemas principal e vomeronasal são separados anatomicamente, morfologicamente e molecularmente. Seu epitélio olfatório principal (MOE) contém neurônios receptores olfatórios ciliados (ORNs) que geralmente expressam receptores olfatórios do tipo OR dotados da via de transdução mediada por cAMP canônico (Liberles, 2014). Seu órgão vomeronasal (VNO) contém duas subpopulações de neurônios receptores microvilosos, ambos expressando receptores vomeronasais tipo 1 (V1Rs) e Gαeu, ou receptores vomeronasais tipo 2 (V2Rs) e Gαo. Recentemente, uma subpopulação adicional de neurônios sensoriais que expressam receptores de peptídeo formil foi identificada (para uma revisão, ver Liberles, 2014). Os neurônios sensoriais que expressam V1R e V2R dependem de uma via de transdução mediada por fosfolipase C e diacilglicerol que leva à ativação do canal 2 do potencial receptor transiente canônico (TRPC2), um canal catiônico crucial para a transdução de sinal no VNO de roedor. Além disso, algumas vias de sinalização independentes de TRPC2 também estão presentes no VNO do roedor (para uma revisão detalhada, consulte Liberles, 2014 e referências nele). Esses genes específicos de VNO foram identificados pela primeira vez em roedores, mas depois também foram encontrados no sistema olfativo de peixes teleósteos (para uma revisão, ver Hamdani e Døving, 2007). Receptores olfativos do tipo VR e TRPC2 também estão presentes em peixes divergentes anteriores, como tubarões e lampreias (Grus e Zhang, 2009), indicando que os componentes moleculares do VNO do roedor já existiam no ancestral comum de todos os vertebrados vivos. Os anfíbios são os primeiros tetrápodes divergentes em comparação com os roedores, representam um estágio de transição na evolução do sistema vomeronasal e, portanto, podem ser cruciais para a compreensão da evolução do sistema vomeronasal e seus componentes genéticos. Por um lado, eles têm um sistema vomeronasal segregado anatomicamente, por outro lado, pelo menos na maioria aquática. Xenopus, a expressão dos receptores vomeronasais não se limita ao VNO. V1rs (Gliem et al., 2013) e mais "antigo", divergente anterior, v2rs (Syed et al., 2013) são expressos exclusivamente no MOE. Além disso, a composição celular do Xenopus MOE é muito semelhante ao do epitélio sensorial único de peixes teleósteos (Hamdani e Døving, 2007), pois contém ORNs ciliados e também microvilosos (Gliem et al., 2013). No entanto, o Xenopus O VNO já é muito semelhante ao dos roedores, no sentido de que é constituído apenas por neurônios receptores microvilosos, e que suas células expressam v2rs, Gαeu e / ou Gαo (Gliem et al., 2013). Na salamandra terrestre Plethodon Shermani, um anfíbio posterior divergente em comparação com Xenopus, todos os V2Rs e TRPC2 já estão confinados ao VNO (Kiemnec-Tyburczy et al., 2012).

Aqui nós identificamos o trpc2 gene de Xenopus laevis (Daudin 1802), e descobriu que é expresso em células de MOE larval e VNO. Esta é a primeira descrição de uma ampla trpc2 expressão no MOE de um vertebrado que também possui um VNO. Além disso, mostramos que o padrão de expressão de trpc2 no Xenopus MOE é virtualmente indistinguível daquele de uma expressão ampla v2r gene, v2r-C, sugerindo uma co-expressão no mesmo subconjunto de células.


Materiais e métodos

Animais.

Adultos e jovens de R. compacta foram dissecados de colônias encontradas presas ao lado côncavo de berbigão desarticulado Glycymeris glycymeris conchas, coletadas de 21 a 24 m de profundidade ao largo de Stoke Point, Reino Unido (50 ° 17 ′ N, 4 ° 01′W). As amostras para hibridização in situ de montagem inteira foram fixadas e armazenadas conforme descrito na ref. 31

Clonagem e hibridização in situ de montagem completa.

o hh gene foi isolado por nested degenerate PCR usando os iniciadores H1 (YTGGCIATHTCIGTVATGAA) e H2 (CGIGTBCAIGARGGCTGGGA), seguido por H3 (CGIGTBCAIGARGGCTGGGA) e H4 (GAITCRTARTASACCCAGT). A sequência clonada foi estendida usando 5 'e 3' RACE PCR com um molde de cDNA. Espécimes fixos foram reidratados, tratados com 20 μg / mL de proteinase K a 37 ° C por 15 min, tratados com 0,0025 vol / vol de anidrido acético em 0,1 M de trietanolamina e pré-hibridizados com 50% formamida, 5 × SSC, 1% SDS, 1 × Solução de Denhardt, 500 μm / mL de heparina, 500 μm / mL de tRNA de levedura por 2–3 dias. As amostras foram hibridizadas por 4-7 dias a 60 ° C, com ribossonda de 1 μg / mL usando o 1.078-bp completo hh gene de R. compacta como um modelo. A lavagem após a hibridização foi baseada na ref. 31 com pequenas modificações: 5 × SSC, 50% formamida, 1% SDS durante a noite a 60 ° C, 2 × SSC, 50% formamida, 1% SDS por & gt2 h a 60 ° C, seguido por tratamento com RNaseA (20 μg / mL ) por 40 min a 37 ° C. Após lavagem adicional, epítopos DIG foram detectados por um fragmento Fab anti-DIG-AP (Roche) e nitroblue tetrazolium / 5-bromo-4-cloro-3-indolyl phosphate (NBT / BCIP). Os espécimes corados foram examinados e fotografados usando um Axioskop 2 plus (Zeiss).

Construtos de expressão ectópica e moscas transgênicas.

Comprimento total Drosophila hh O cDNA (19) foi amplificado, purificado, ligado a pUC18 e submetido a mutagênese in vitro dirigida ao local usando PCR (QuikChange Stratagene). Usamos primers complementares de CCCACGTGCACGGCGCTTTCACGCCGGAGAGC para ala-hh, CCCACGTGCACAGCTGCTTCACGCCGGAGAGC para Sac-hh e CCCACGTGCACACGGGCTGCTTCACGCCGGAGAGC para ptero-hh (substituições de nucleotídeos são mostradas em negrito). Depois de verificar a sequência de DNA de cada modificação, as construções foram clonadas no vetor de transformação pUAST no local EcoRI e amplificadas e purificadas antes da injeção. Construtos foram injetados em C 1118 Drosófila embriões usando métodos padrão e múltiplas linhagens transgênicas estabelecidas. Os locais de integração foram mapeados por análise de segregação cromossômica e os transformantes criados para homozigose ou estabilizados usando cromossomos balanceadores. Drosófila foram mantidos em meio de ágar sacarose de farinha de milho padrão. ptcGAL4/CyO e P30A foram fornecidos pelo Bloomington Drosophila Stock Center.

Análise de Western Immunoblot.

Os embriões foram gerados cruzando linhas mutantes UAS-hh com ptcGAL4 voa e é criado até que a expressão de eGFP seja prontamente detectada por microscopia de fluorescência em embriões gerados por um cruzamento paralelo de ptcGAL4 com UAS-eGFP. Os embriões de controle negativo eram da ptcEstoque homozigoto GAL4. Os lisados ​​de proteína embrionária foram preparados fervendo embriões em tampão de amostra de proteína (10 embriões por μL) (Laemmli 2 × Sigma) a 95 ° C por 5 min e executados em 12% de SDS / géis de poliacrilamida (carregados com 10 μL por pista) (32) . As proteínas foram detectadas usando anticorpo tubulina (anti-α-tubulina Sigma) seguido por anticorpo secundário conjugado com peroxidase de rábano (Sigma) anti-rato para confirmar a quantidade de proteína em cada pista e, em seguida, anticorpo Hh-N (primário Drosófila Hedgehog dN-12 Santa Cruz Biotechnology) seguido de anticorpo secundário conjugado com peroxidase de rábano IgG anti-cabra (Santa Cruz Biotechnology).


Reconhecimentos

Agradecemos a E.-M. Strauch e P.-S. Huang por fornecer os plasmídeos ZZ / pETCON e S2 / pETCON, respectivamente, e B. Shen pela assistência no processamento de dados, modelagem e refinamento das estruturas de cristal de raios-X. Agradecemos a J. P. Sumida pela assistência com a coleta, processamento e análise de dados analíticos de ultracentrifugação. Experimentos analíticos de ultracentrifugação foram realizados no University of Washington Analytical Biopharmacy Core, que é apoiado pelo Washington State Life Sciences Discovery Fund e pelo Center for the Intracelular Delivery of Biologics. Agradecemos a S. Fleishman, O. Khersonsky e P.-S. Huang pelos comentários sobre o manuscrito. J.W.N. reconhece uma bolsa de pré-doutorado do National Human Genome Research Institute no âmbito do programa Interdisciplinary Training in Genome Sciences (T32 HG00035). Este trabalho foi financiado por concessões da DTRA e DARPA para D.B., uma concessão da Swiss National Science Foundation para K.J., e uma concessão da National Science Foundation MCB1121896 para C.G.K.


RESULTADOS

Amplificação de sondas em cadeado e sequência por hibridização para a detecção de transcritos de RNA

Semelhante aos métodos de ISS estabelecidos anteriormente, os PLPs são projetados para direcionar sequências de cDNA específicas de mRNA transcrito reverso no local (20) (Figura 1A). Um pipeline de design de cadeado interno produz várias sequências alvo exclusivas de genes com base nos parâmetros de entrada do usuário (consulte Materiais e Métodos). A estrutura personalizável dos PLPs contém duas partes: uma sequência de ID única que é emparelhada a cada gene de interesse direcionado e uma sequência "âncora" geral compartilhada por todos os PLPs. Aqui, nós projetamos PLPs para direcionar uma sequência de cDNA única de gene 30 nt dividida em dois braços de 15 nt e um backbone com uma sequência de ID de 20 nt e uma sequência de âncora de 20 nt, resultando em um PLP final de 70 nt de comprimento (Figura Suplementar S1A) . A sequência de 20 nt ID é uma sequência predeterminada única para o alvo do transcrito (por exemplo, cinco PLPs direcionados a cinco regiões de um transcrito de gene têm a mesma sequência de ID). O backbone e os braços alvo ligados dos PLPs são amplificados por meio de RCA e resulta em um produto de círculo rolante (RCP), um amplicon submícron detectável com sondas e um microscópio de epifluorescência convencional. O amplicon RCP contém múltiplos alvos de sequência de ID repetitivos, permitindo a especificidade da hibridização complementar de oligonucleotídeos de leitura denominados sondas-ponte. As sondas-ponte têm comprimento de 39 nt, ligação de 17 pares de bases (pb) complementar à sequência de ID amplificada, um ligante não complementar de 2 nt e 20 nt que consiste em uma das quatro sequências de ligação complementar a uma sonda de detecção de leitura de 20 pb conjugada a um dos quatro fluoróforos atribuídos (Figura 1B, Figura Suplementar S1B). Cada sequência de ID está associada a um esquema de codificação combinatória (código de barras, por exemplo, 43221) que é decodificado sequencialmente com uma biblioteca de ponte-sonda dependente de ciclo (Figura Suplementar S1C).

Visão geral do método HybISS, baseado em hibridização no local sequenciamento. (UMA) Visão geral do ISS, primeiro transcrições reversas de mRNA para cDNA. Os PLPs específicos do gene têm como alvo o cDNA com as extremidades justapostas uma ao lado do outro que permitem a ligação de PLP. Apenas os transcritos que são ligados são amplificados enzimaticamente por RCA. (B) Visão geral esquemática do HybISS. Cada ciclo consiste em hibridizar sondas-ponte para RCPs e lê-los com sondas de detecção de leitura conjugadas com fluoróforo. Para ciclos sequenciais, as sondas-ponte são então removidas para permitir a rehibridização da próxima rodada de sondas-ponte. (C) Imagens de exemplo de 5 ciclos de uma única célula. Ciclos sequenciais com diferentes bibliotecas de ponte-sonda permitem a decodificação de transcritos alvo dentro de uma célula. Barra de escala: 10 μm.

Visão geral do método HybISS, baseado em hibridização no local sequenciamento. (UMA) Visão geral do ISS, primeiro transcrições reversas de mRNA para cDNA. Os PLPs específicos do gene têm como alvo o cDNA com as extremidades justapostas uma ao lado do outro que permitem a ligação de PLP. Apenas os transcritos que são ligados são amplificados enzimaticamente por RCA. (B) Visão geral esquemática do HybISS. Cada ciclo consiste em hibridizar sondas-ponte para RCPs e lê-los com sondas de detecção de leitura conjugadas com fluoróforo. Para ciclos sequenciais, as sondas-ponte são então removidas para permitir a rehibridização da próxima rodada de sondas-ponte. (C) Imagens de exemplo de 5 ciclos de uma única célula. Ciclos sequenciais com diferentes bibliotecas de ponte-sonda permitem a decodificação de transcritos alvo dentro de uma célula. Barra de escala: 10 μm.

A ligação de braços de extremidade alvo de PLP de 15 nt justapostos permite alta especificidade e RCA dos transcritos direcionados na posição. Rodadas sequenciais de hibridização ponte-sonda, sondagem de detecção de leitura, imagem e separação permitem um ensaio altamente multiplexado sem a limitação de rodadas de métodos ISS anteriores baseados em SBL (Figura 1B). Atualmente, conforme apresentado aqui, o HybISS é configurado com quatro sondas de detecção de leitura por ciclo. Isso permite um painel alvo de genes (G) que pode ser medido de forma combinatória com quatro fluoróforos (F) por ciclo (c) e, portanto, G = F c , sem qualquer limitação de ciclo e atualmente mostrando excelente integridade do tecido e manutenção de RCP ao longo de dez ciclos (Figura Suplementar S1D, E), aproximadamente calculada para ser uma perda de 0,28% de RCPs por rodada. Além disso, ao contrário do método ISS baseado em SBL, que é limitado a quatro fluoróforos (um por base de código de barras: A, T, C ou G), o número de fluoróforos possíveis em HybISS é limitado apenas pela capacidade de um microscópio para distinguir fluoróforos, permitindo o aumento capacidades combinatórias com corante adequado e seleção de filtro. Além disso, a seleção de painel de sonda de ponte de subconjunto permite a flexibilidade de fazer conjuntos sucessivos de painéis na mesma amostra de tecido no caso de sondas de superlotação e não compromete o projeto experimental para seleção de sonda, já que leituras de genes individuais podem ser excluídas simplesmente removendo a ponte correspondente -probe e feito em ciclos posteriores (Figura Suplementar S1F). Isso não foi possível em métodos ISS anteriores em que cada PLP seria detectado a cada rodada e genes problemáticos, como expressores elevados, teriam que ser executados separadamente. A decodificação é realizada através do esquema de decodificação combinatória sequencial semelhante aos métodos ISS anteriores, onde cada código de barras tem uma distância de hamming de pelo menos dois, permitindo a correção e atribuição probabilística de códigos de barras com melhor precisão (Figura 1C) (20, 21). Além disso, com as sondas-ponte, isso agora também permite a possibilidade de correção de erro adicional, incluindo "zeros" no esquema de decodificação, onde as sondas-ponte são simplesmente excluídas para um subconjunto de genes em diferentes rodadas de sondagem. Todos esses novos recursos integrados ao HybISS aumentam sua flexibilidade e adaptabilidade para se adequar ao projeto de experimentos.

HybISS em comparação com ISS baseado em SBL usando painel de genes de referência para benchmarking

A fim de demonstrar algumas das melhorias da tecnologia HybISS, nós a comparamos com o ISS baseado em SBL, projetando conjuntos de PLPs para ligar sequências alvo idênticas de um painel de genes de referência do cérebro de camundongo (Actb/Gapdh/Pgk1/Polr2a) e backbones de PLP para suportar as diferentes químicas de sequenciamento de SBL e SBH, resultando nos PLPs de mesmo comprimento (Figura Suplementar S2A, Tabela Suplementar S1). Os experimentos de SBL e SBH foram executados em paralelo em seções coronais de cérebro de camundongo sequencial mostrando distribuição uniforme de genes de referência em seções de tecido (Figura 2A, B), embora SBL mostre um aumento nas intensidades gerais de fundo (Figura 2C). Para avaliar ainda mais as diferenças de intensidade, medimos a intensidade dos RCPs em três ROIs comparáveis ​​(Figura Suplementar S2B). Primeiro, as intensidades máximas de sinal foram medidas para os 300 RCPs principais por canal, mostrando um aumento significativo para HybISS baseado em SBH em canais comparativos (Figura 2D). Além disso, a intensidade foi medida em uma linha de 21 pixels centrada em RCPs aleatórios dentro das ROIs para medir a intensidade relativa ao fundo. Não apenas houve um aumento nos valores de intensidade média, o ruído de fundo também foi reduzido em alguns canais do HybISS e, de maneira importante, resultando em um SNR aumentado em todos os canais medidos (Figura 2E, F). Isso indica um método de detecção mais robusto, distinguindo RCPs com mais facilidade devido ao melhor SNR. Resultados comparáveis ​​foram encontrados em outros tecidos e ciclos (Figura Suplementar S2C-E), resultando em um aumento de SNR em vários experimentos (Figura 2G). Isso foi controlado pela hibridização de apenas âncoras para os respectivos RCPs e, como esperado, nenhuma diferença observada nos valores médios de intensidade de RCP, sugerindo nenhum efeito no projeto de PLP ou nas etapas iniciais de hibridização de PLPs para RCA entre as duas iterações de ISS (Figura Suplementar S2F, G). No entanto, após várias rodadas, começamos a ver aumentos no ruído de fundo na química SBL levando a um SNR mais alto na química baseada em SBH, muito provavelmente devido às condições de remoção mais severas e etapas enzimáticas adicionais na química baseada em SBL.

Comparação de HybISS vs. ISS baseado em SBL. (UMA) Imagens representativas sobre a distribuição de genes de referência em seções coronais de camundongos sequenciais direcionadas por químicas baseadas em SBH ou SBL. Cada canal foi escalado para a mesma intensidade para comparação. A inserção exibe DAPI nuclear. Barra de escala: 10 μm. (B) Ampliação de um único núcleo marcado por DAPI com RCPs, as intensidades foram redimensionadas para maior clareza. Barra de escala: 5 μm (C) Intensidade de pixel binned das imagens no painel (A) para cada canal. Verde = Cy3, azul = Cy5, vermelho = Atto425, amarelo = AF488. (D) Intensidade máxima dos 300 RCPs principais de três ROIs em cada canal medido, comparando produtos químicos baseados em SBL e SBH. (E) Intensidades médias de RCPs medidos em ROIs. Intensidade de pixel medida através de uma linha de 21 pixels que divide RCPs (azul = SBH, vermelho = SBL). (F) SNR calculado a partir dos valores de intensidade no painel (E), usando 2 pixels externos em cada extremidade como a medição de ruído. (azul = SBH, vermelho = SBL). (G) Razão dos valores de SNR SBH / SBL em várias réplicas nos três canais medidos. (H) Detecção de RCP com vários limites em um ROI de 2000 × 2000 px no canal Cy5 para SBH e SBL usando estrelas do mar (35) Detector de Blob, indicando mais RCPs encontrados no SBH em cada limite. (eu) Esquerda: ROI de 5000 × 5000 px de experimentos SBH e SBL com núcleos segmentados. Meio: Exemplo de imagem bruta de uma única célula com canal Cy5. Direita: Exemplo de detecção de limite (0,005) de CellProfiler e número de objetos (contorno magenta) detectados. Barra de escala: esquerda 100 μm, meio 2 μm (J) CellProfiler Object conta para uma gama de limiares em todos os canais de imagens de 5000 × 5000 px na química SBH e SBL. A barra preta indica o limite manual ideal e usado para cálculo no painel (K) (azul = SBH, vermelho = SBL). (K) Contagem de RCP por célula da imagem analisada usada em (J). Contagem SBH DAPI = 1333, contagem SBL DAPI = 1369.

Comparação de HybISS vs. ISS baseado em SBL. (UMA) Imagens representativas sobre a distribuição de genes de referência em seções coronais de camundongos sequenciais direcionadas por químicas baseadas em SBH ou SBL. Cada canal foi escalado para a mesma intensidade para comparação. A inserção exibe DAPI nuclear. Barra de escala: 10 μm. (B) Ampliação de um único núcleo marcado por DAPI com RCPs, as intensidades foram redimensionadas para maior clareza. Barra de escala: 5 μm (C) Intensidade de pixel binned das imagens no painel (A) para cada canal. Verde = Cy3, azul = Cy5, vermelho = Atto425, amarelo = AF488. (D) Intensidade máxima dos 300 RCPs principais de três ROIs em cada canal medido, comparando produtos químicos baseados em SBL e SBH. (E) Intensidades médias de RCPs medidos em ROIs. Intensidade de pixel medida através de uma linha de 21 pixels que divide RCPs (azul = SBH, vermelho = SBL). (F) SNR calculado a partir dos valores de intensidade no painel (E), usando 2 pixels externos em cada extremidade como a medição de ruído. (azul = SBH, vermelho = SBL). (G) Razão dos valores de SNR SBH / SBL em várias réplicas nos três canais medidos. (H) Detecção de RCP com vários limites em um ROI de 2000 × 2000 px no canal Cy5 para SBH e SBL usando estrelas do mar (35) Detector de Blob, indicando mais RCPs encontrados no SBH em cada limite. (eu) Esquerda: ROI de 5000 × 5000 px de experimentos SBH e SBL com núcleos segmentados. Meio: Exemplo de imagem bruta de uma única célula com canal Cy5. Direita: Exemplo de detecção de limite (0,005) de CellProfiler e número de objetos (contorno magenta) detectados. Barra de escala: esquerda 100 μm, meio 2 μm (J) CellProfiler Object conta para uma gama de limiares em todos os canais de imagens de 5000 × 5000 px na química SBH e SBL. A barra preta indica o limite manual ideal e usado para cálculo no painel (K) (azul = SBH, vermelho = SBL). (K) Contagem de RCP por célula da imagem analisada usada em (J). Contagem SBH DAPI = 1333, contagem SBL DAPI = 1369.

A localização e determinação de RCP envolvem várias etapas de processamento de imagem, mas são altamente dependentes de intensidades de pixel acima de um nível de limite definido. Se uma estratégia de decodificação, como estrelas do mar (27) é aplicado a um exemplo de imagem SBH ou SBL, é claro que em cada limiar, SBH resolve mais manchas em comparação com SBL (Figura 2H). Com uma estratégia de limiar simples para localizar objetos usando CellProfiler, fica claro que SBH pode distinguir objetos de forma mais consistente em uma faixa de limiares onde a química SBL produz uma variação muito maior (Figura 2I, J). Após a seleção manual do limite ideal para cada condição e canal, vemos um aumento na eficiência de detecção para RCPs por célula (Figura 2K). No geral, os benchmarks HybISS são mais altos do que o ISS baseado em SBL em todos os parâmetros testados, o que confirma a atualização significativa na tecnologia, resultando em sinais mais robustos e confiáveis.

HybISS realizado em toda a seção coronal do cérebro de camundongo para fins de detecção de transcrição de gene

Para demonstrar o potencial e validar o HybISS, exploramos a multiplexação em seções do cérebro de camundongos. O painel de genes de benchmarking usado foi curado pelo Consórcio SpaceTx (parte do projeto Chan Zuckerberg Initiative e Human Cell Atlas) (10, 27), dos quais 119 genes foram selecionados para o projeto HybISS PLP (Tabela Suplementar S1). Este painel de sonda foi projetado para representar a expressão de genes para distinguir vários tipos de células dentro do córtex visual primário (5), mas foi aplicado aqui a uma seção inteira coronal do cérebro de camundongo adulto (∼60 mm 2, 10 μm de espessura). Ser capaz de inferir dados sobre grandes áreas do sistema nervoso central, ou qualquer tecido, é desejado, mas os métodos espaciais atuais são limitados em suas possibilidades de processamento, visualizando apenas pequenas regiões de interesse com armazenamento de dados e tempo se tornando fatores limitantes. Aqui, fomos capazes de explorar a arquitetura do tecido em toda a seção coronal de uma maneira eficiente (cada ciclo, imagem de 40 ×, & lt5 h, dados de ∼700 GB), exigindo entrada adicional mínima para maior saída de dados. Mostramos a robustez para detectar centenas de genes alvo e mapeá-los em uma seção inteira (Figura 3A, B). HybISS foi capaz de resolver a lista de genes após a decodificação combinatória de cinco ciclos (Figura 3B, C), com muitos genes mostrando padrões discretos, incluindo estruturas laminares de tecido cortical (Figura 3D). Vários genes têm distribuição espacial muito distinta em todo o cérebro do camundongo e podem ser usados ​​para validar o método comparando-os com outros atlas de referência, como o Allen Mouse Brain Atlas (2019) (28) (Figura Suplementar S3A). Aqui, confirmamos a distribuição da expressão de genes individuais não apenas no córtex visual, mas também em regiões como o hipocampo e o tálamo. Embora o tecido de camundongo forneça um recurso valioso de dados, para entender os processos biológicos relevantes em humanos, o estudo de amostras humanas é fundamental.

HybISS na seção coronal do cérebro de camundongo. (UMA) Seção coronal inteira do camundongo usada para HybISS, ∼60 mm 2. Barra de escala: 1 mm. (B) Imagens representativas de HybISS usando PLPs para mapear 119 genes ao longo de 5 ciclos em seção. Apenas a primeira imagem inclui contracoloração para núcleos com DAPI. Barra de escala: 10 μm. (C) Saída do MATLAB da decodificação de 119 genes em toda a seção, cada cor / símbolo marcando uma única transcrição detectada. A inserção mostra uma imagem representativa ampliada do gráfico do marcador de gene mapeado na imagem DAPI. (D) Seleção de um subconjunto de genes mostrados em (C) que têm uma distribuição laminar espacial distinta dentro do neocórtex.

HybISS na seção coronal do cérebro de camundongo. (UMA) Seção coronal inteira do camundongo usada para HybISS, ∼60 mm 2. Barra de escala: 1 mm. (B) Imagens representativas de HybISS usando PLPs para mapear 119 genes ao longo de 5 ciclos em seção. Apenas a primeira imagem inclui contracoloração para núcleos com DAPI. Barra de escala: 10 μm. (C) Saída do MATLAB da decodificação de 119 genes em toda a seção, cada cor / símbolo marcando uma única transcrição detectada. A inserção mostra uma imagem representativa ampliada do gráfico do marcador de gene mapeado na imagem DAPI. (D) Seleção de um subconjunto de genes mostrados em (C) que têm uma distribuição laminar espacial distinta dentro do neocórtex.

Multiplexação com HybISS em tecido cerebral humano

Data obtained from human samples would be more relevant and insightful but is limited due to restricted availability of good quality samples and difficulty in adapting and scaling experimental methods. Human tissue regions are much larger than model organisms and thus investigating comparable regions to mice in humans today still requires significant progress in multiple fields. Well preserved human samples to be used for various single-cell methods are rare and are known to be difficult to work with compared to mouse counterparts where fresh tissue and proven protocols are more abundant and therefore being able to extract all information possible from a single tissue would provide a wealth of information, and is critical when studying damaged tissue such as the case for neurodegenerative disorders. Furthermore, determining exact anatomical positioning in human samples is more difficult due to their increased area and lack of good reference controls as compared to mouse samples.

Here, HybISS was performed on three sections of human brain tissue from the middle temporal gyrus ( 24) (whole sections, ∼29 mm 2 , 45 mm 2 , 25 mm 2 , 10 μm thick) (Figure 4A). One inherent problem with human brain samples is lipid-containing residues of lipofuscin that causes strong autofluorescence in multiple imaging channels and is found in many tissues of aging humans. Many spatial methods and imaging techniques are sensitive to this autofluorescence and overcoming this with any quenching methods does not completely solve the problem and computational clearing strategies are not perfect and require variable user input. Here, we implement HybISS together with simple autofluorescence quenching (TrueBlack Lipofuscin Autofluorescence Quencher, TLAQ) that overcomes this problem in human brain sections and does not require any additional advanced microscopic tools or computational clearing methods (Figure 4B). Testing with a human reference gene panel (ACTB/CYC1/ACTG1/NDUFB4), in almost all imaged channels without treatment where lipofuscin was present, RCPs could not be distinguished from the background of lipofuscin ( Supplementary Figure S4A, B ). This was further corroborated with investigating crosstalk between channels with and without TLAQ treatment, indicating the effect of lipofuscin on background noise and true signal determination ( Supplementary Figure S4C, D ). TLAQ allows for clear separation of signals in imaged channels from the background and it only adds five minutes to the protocol and a one-time treatment maintains well over imaging cycles.

HybISS on human middle temporal gyrus brain sections. (UMA) DAPI nuclei stain of human tissue sections from middle temporal gyrus. Dashed red line demarcates the outer pial surface of tissue section. Area approx. 29 mm 2 , 45 mm 2 , 25 mm 2 top to bottom panel. Scale bar: 1 mm. (B) Representative images of the effects of lipofuscin in human brain tissue that can be treated with TLAQ, and HybISS amplification overcomes any residual background noise. Scale bar: 10 μm. (C) Magnified field of view from section in panel (a) of several cells across 5 cycles of HybISS. First cycle includes DAPI to show nuclei location. Scale bar: 5 μm. (D) Spatial distribution of decoded HybISS transcripts of 120 gene panel across the three tissue sections. Left, 1 649 212 spots middle, 1 936 227 spots right, 602 681 spots. (E) Kernel density estimation plots for a subset of individual gene transcripts that show distinct spatial distribution, including laminar anatomy of cortical tissue.

HybISS on human middle temporal gyrus brain sections. (UMA) DAPI nuclei stain of human tissue sections from middle temporal gyrus. Dashed red line demarcates the outer pial surface of tissue section. Area approx. 29 mm 2 , 45 mm 2 , 25 mm 2 top to bottom panel. Scale bar: 1 mm. (B) Representative images of the effects of lipofuscin in human brain tissue that can be treated with TLAQ, and HybISS amplification overcomes any residual background noise. Scale bar: 10 μm. (C) Magnified field of view from section in panel (a) of several cells across 5 cycles of HybISS. First cycle includes DAPI to show nuclei location. Scale bar: 5 μm. (D) Spatial distribution of decoded HybISS transcripts of 120 gene panel across the three tissue sections. Left, 1 649 212 spots middle, 1 936 227 spots right, 602 681 spots. (E) Kernel density estimation plots for a subset of individual gene transcripts that show distinct spatial distribution, including laminar anatomy of cortical tissue.

With only this additional treatment, we applied HybISS and were able to resolve a similar SpaceTx Consortium curated gene list from human middle temporal gyrus single-nucleus RNA-sequencing data from which a subset of 120 were targeted and decoded (Figure 4C, D). We are able to show comparable results to mouse sections without any additional difficulties, indicating a robust method to be used for spatial gene-expression profiling investigations. We further examined the spatial distribution of various gene transcripts with kernel density estimation plots across the three sections, many showing distinct patterns, including laminar distribution of cortical tissue (Figure 4E). Collectively, this data shows a proof of concept that it is possible to do multiplexed no local hybridization studies in human tissue in a high throughput and robust manner.


Cloning and Characterization of Prunus serotina AGAMOUS, a Putative Flower Homeotic Gene

Members of the AGAMOUS subfamily of MADS-box transcription factors play an important role in regulating the development of reproductive organs in flowering plants. To help understand the mechanism of floral development in black cherry (Prunus serotina), PsAG (a putative flower homeotic identity gene) was isolated, and its MIKC-type structure was shown to be a homolog of the Arabidopsis thaliana AG gene. It was a single-copy gene in black cherry. A phylogenetic tree derived from the protein sequence indicated PsAG to be a C-function flower homeotic gene with a high similarity to other AG homologs, such as those from Prunus persica e Prunus mume. PsAG met the criteria for AG subfamily gene structure with a typical MIKC structure. No local hybridization showed that PsAG was expressed mainly in the floral meristem, such as stamen and carpel primordia during the early stage of floral development, and transcript of PsAG accumulated in the tissues of the ovary, stigma, style, and stamens. When the flowers matured, PsAG had enhanced expression in ovary, style, and stigma, with decreased expression in the stamen. PsAG continued to be expressed in the ovule at the late stage of flower development. The developmental patterns of expression were consistent with those of AG and homologs from other species. Both phylogenetic analysis and expression-pattern data suggest that PsAG was the black cherry homolog of Arabidopsis AG. An RNAi construct with a partial PsAG gene was constructed for black cherry transformation.

Esta é uma prévia do conteúdo da assinatura, acesso através de sua instituição.


Degenerate primer design for DIG in situ hybridization - Biology

Editors: Virginie Orgogozo and Matt Rockman



We are entering a particularly fruitful period in evolutionary genetics, as rapid technological progress transforms the investigation of genetic variation within and between species. Molecular Methods for Evolutionary Genetics is a collection of advanced molecular biology protocols and general overviews intended to represent the essential methods currently bringing evolutionary genetics to fruition. Divided into six thematic sections, this volume covers methods for characterizing genomes, diverse approaches to enrich DNA for subsets of the genome prior to sequencing, and state-of-the art protocols for sampling genetic variation for genetic mapping studies and population genetic studies (RAD sequencing, Sequenom, microarrays, etc.). The volume concludes by focusing on methods to study candidate genes, from obtaining their sequences and analyzing their transcripts to experimentally manipulating their activities in vivo. Written in the highly successful Methods in Molecular Biology series format, chapters contain introductions to their respective topics, lists of the necessary materials and reagents, step-by-step, readily reproducible laboratory protocols, and notes on troubleshooting and avoiding known pitfalls.
Authoritative and accessible, Molecular Methods for Evolutionary Genetics serves as a rich resource to biologists interested in evolution, whether they be specialists or beginners in molecular biology .


you can buy this book on amazon.com or amazon.fr or springer.com


Part I. Characterizing the Genome
1. Genome size determination using flow cytometry of propidium iodide-stained nuclei (Emily E. Hare and J. Spencer Johnston)
2. Chromosome analysis in invertebrates and vertebrates (David M. Rowell, Shu Ly Lim and Frank Grutzner)
3. Genomic libraries. I. Construction and screening of fosmid genomic libraries (Mike A. Quail, Lucy Matthews, Sarah Sims, Christine Lloyd, Helen Beasley and Simon W. Baxter)
4. Genomic Libraries. II. Subcloning, sequencing, and assembling large-insert genomic DNA clones (Mike A. Quail, Lucy Matthews, Sarah Sims, Christine Lloyd, Helen Beasley and Simon W. Baxter)

Parte II. Targeting Regions of the Genome
5. Reduced representation methods for sub-genomic enrichment and next-generation sequencing (Jeffrey M. Good) R
6. Accessing the transcriptome: how to normalize mRNA pools (Heiko Vogel and Christopher W. Wheat)
7. Transcriptome sequencing goals, assembly and assessment (Christopher W. Wheat and Heiko Vogel)
8. Rapid retrieval of DNA target sequences by Primer Extension Capture (Adrian W. Briggs)

Part III. Measuring Genetic Diversity
9. SNP discovery and genotyping for evolutionary genetics using RAD sequencing (Paul D. Etter, Susan Bassham, Paul A. Hohenlohe, Eric Johnson and William A. Cresko)
10. DNA microarray-based mutation discovery and genotyping (David Gresham)
11. Genotyping with Sequenom (Martina Bradić, João Costa and Ivo M. Chelo)
12. Isolating microsatellite loci: looking back, looking ahead (José A. Andrés and Steven M. Bogdanowicz)
13. Design of custom oligonucleotide microarrays for single species or interspecies hybrids using Array Oligo Selector (Amy A. Caudy)

Parte IV. Obtaining Candidate Gene Sequences
14. Identification of homologous gene sequences by PCR with degenerate primers (Michael Lang and Virginie Orgogozo)
15. Characterizing cDNA ends by circular RACE (Patrick T. McGrath)
16. Identification of DNA sequences that flank a known region by inverse PCR (Anastasios Pavlopoulos)

Part V. Analyzing Candidate Gene Transcripts
17. Quantification of transcript levels with quantitative RT-PCR (Karen L. Carleton)
18. Using pyrosequencing to measure allele-specific mRNA abundance and infer the effects of cis- and trans-regulatory differences (Patricia J. Wittkopp)
19. Whole mount in situ hybridization of sectioned tissues of species hybrids to detect cis-regulatory changes in gene expression pattern (Ryo Futahashi)
20. Identifying fluorescently labeled single molecules in image stacks using machine learning (Scott Rifkin)

Part VI. Testing Candidate Genes and Candidate Mutations
21. Experimental approaches to evaluate the contributions of candidate cis-regulatory mutations to phenotypic evolution (Mark Rebeiz and Thomas M. Williams) R
22. Experimental approaches to evaluate the contributions of candidate protein-coding mutations to phenotypic evolution (Jay F. Storz and Anthony J. Zera) R
23. Making reporter gene constructs to analyze cis-regulatory elements (José Bessa and José Luis Gómez-Skarmeta)
24. PCR-directed in vivo plasmid construction using homologous recombination in baker’s yeast (Erik C. Andersen)
25. Production of fosmid genomic libraries optimized for liquid culture recombineering and cross-species transgensis (Radoslaw Kamil Ejsmont, Maria Bogdanzaliewa, Kamil Andrzej Lipinski and Pavel Tomancak)
26. Recombination-mediated genetic engineering of large genomic DNA transgenes (Radoslaw Kamil Ejsmont, Peter Ahlfeld, Andrei Pozniakovsky, A. Francis Steward, Pavel Tomancak and Mihail Sarov)
27. Overlap extension PCR: an efficient method for transgene construction (Matthew Nelson and David Fitch)
28. Gene knockdown analysis by double-stranded RNA injection (Benjamin N. Philip and Yoshinori Tomoyasu)


Hybridization Conditions and Melting Temperature

Stringency is a term that many molecular technologists are all very familiar with. It is a term that describes the combination of conditions under which a target is exposed to the probe. Typically, conditions that exhibit high stringency are more demanding of probe to target complementarity and length. Low stringency conditions are much more forgiving.

  • If conditions of stringency are too HIGH → Probe doesn’t bind to the target
  • If conditions of stringency are too LOW → Probe binds to unrelated targets

Important Factors That Affect Stringency and Hybridization

  • Temperature of hybridization and salt concentration
    • Increasing the hybridization temperature or decreasing the amount of salt in the buffer increases probe specificity and decreases hybridization of the probe to sequences that are not 100% the same.
    • For example: Deionized Formamide and SDS can be used to reduce non-specific binding of the probe

    – Probe has increased number of G and C bases

    – Probe has increased number of A and T bases

    Melting Temperature (Tm) Long Probes

    • The ideal hybridization conditions are estimated from the calculation of the Tm.
    • The Tm of the probe sequence is a way to express the amount of energy required to separate the hybridized strands of a given sequence.
    • At the Tm: Half of the sequence is double stranded and half of the sequence is single stranded.
    • Tm = 81.5°C + 16.6logM + 0.41(%G+C) – 0.61(%formamide) – (600/n)

    Where M = Sodium concentration in mol/L

    n = number of base pairs in smallest duplex

    • If we keep in mind that RNA is single stranded (ss) and DNA is double stranded (ds), then the following must be true:

    RNA : DNA Hybrids More stable

    DNA : DNA Hybrids Less stable

    Calculating the Tm for Short Probes (14 – 20 base pairs)

    • Tm = 4°C x number of G/C pairs + 2°C x number of A/T pairs
    • The hybridization temperature (annealing temp) of oligonucleotide probes is approximately 5°C below the melting temperature.

    Sequence Complexity (Cot)

    • Sequence complexity refers to the length of unique, non-repetitive nucleotide sequences.
    • Cot = Initial DNA Concentration (Co) x time required to reanneal it (t)
    • Cot1/2 = Time required for half of the double-stranded sequence to anneal under a given set of conditions.
    • Short probes can hybridize in 1 – 2 hours, where long probes require more time.

    Test Your Knowledge

    Responder
    If the number of G/C pairs = 11, and the number of A/T pairs = 9. The calculation is as follows:
    4(11) + 2(9) = X
    X = 62°C

    -LeAnne Noll, BS, MB(ASCP) CM is a molecular technologist in Wisconsin and was recognized as one of ASCP’s Top Five from the 40 Under Forty Program in 2015.

    Compartilhar isso:

    Assim:

    Relacionado


    Reconhecimentos

    The authors wish to acknowledge Wim Damen for degenerate primer sequences for the cloning of Bp-Pax-6, Ernst Wimmer for discussions and inspiring environment. and Drs. Boschetti and Ricci for sharing their observations on Brachionus embryology and culture.

    Open Access

    This article is distributed under the terms of the Creative Commons Attribution Noncommercial License which permits any noncommercial use, distribution, and reproduction in any medium, provided the original author(s) and source are credited.


    Assista o vídeo: Fluorescence In Situ Hybridization FISH (Janeiro 2022).