Em formação

Posso eluir minha proteína marcada com GFP do anticorpo anti-GFP usando um peptídeo?


Eu gostaria de realizar um ensaio de co-imunoprecipitação modificado usando uma proteína marcada com GFP. Vamos ligar a proteína marcada ao anticorpo anti-GFP e ligá-la às contas de proteína A / G, no entanto, queremos ser capazes de eluir seletivamente a proteína marcada das contas. Eu sei que você pode eluir uma proteína marcada com FLAG do anticorpo anti-FLAG M2 adicionando FLAG em excesso, então posso usar a mesma abordagem com minha tag GFP? Em caso afirmativo, alguém conhece um anticorpo monoclonal GFP disponível comercialmente cujo epítopo foi mapeado para que eu possa usar o epítopo em excesso para eluir minha proteína? Ou possivelmente uma fonte de GFP recombinante?


Eu encontrei um artigo que descreve um método para purificar proteínas de fusão GFP usando cromatografia de afinidade: "Purificação de proteínas de fusão GFP com alta pureza e rendimento por cromatografia em coluna de afinidade acoplada a anticorpo monoclonal" (1). Infelizmente, não tenho acesso ao texto completo, então não posso verificar como exatamente eles eluem a proteína de fusão GFP da coluna. Eles descrevem um anticorpo monoclonal específico que usam, deve haver informações sobre como obtê-lo no papel.

Resumo:

A GFP tem sido frequentemente usada como um marcador de expressão gênica, localização de proteínas em tecidos vivos e fixos, bem como para direcionamento de proteínas em células e organismos intactos. O monitoramento da expressão de proteínas estranhas por meio da fusão GFP também é muito atraente para aplicações de bioprocessos. Muitas células, incluindo bactérias, fungos, plantas, insetos e células de mamíferos, podem expressar GFP recombinante (rGFP) de forma eficiente. Vários métodos e procedimentos foram desenvolvidos para purificar o rGFP ou proteínas recombinantes fundidas com a tag GFP. No entanto, a maioria dos métodos de purificação de GFP atuais são limitados por baixos rendimentos e baixa pureza. No estudo atual, desenvolvemos um método de purificação aprimorado, utilizando um anticorpo monoclonal FMU-GFP.5 (mAb) para GFP juntamente com uma coluna de cromatografia de afinidade acoplada a mAb. O método resultou em uma amostra altamente pura (mais de 97% de homogeneidade) e teve um rendimento de amostra de cerca de 90%. Além disso, o epítopo GFP permitiu o isolamento de quase todas as proteínas alvo recombinantes ativas fundidas com GFP, direta e facilmente, a partir de fontes celulares em bruto. Nossos dados sugerem que este método é mais eficiente do que qualquer método atualmente disponível para purificação da proteína GFP.

(1) Zhuang R. et al., Purificação de proteínas de fusão GFP com alta pureza e rendimento por cromatografia em coluna de afinidade acoplada a anticorpo monoclonal. Protein Expr Purif 2008, 59(1), 138-43


Linhas de células estáveis ​​marcadas com LAP induzíveis para investigação da função da proteína, localização espaço-temporal e redes de interação de proteínas

Nós descrevemos um método para geração de localização e purificação de afinidade (LAP) -tagged linha de células indutíveis indutíveis para investigar a função da proteína, localização subcelular espaço-temporal e redes de interação proteína-proteína.

Resumo

Complexos multiproteicos, em vez de proteínas isoladas atuando isoladamente, geralmente governam as vias moleculares que regulam a homeostase celular. Com base neste princípio, a purificação de proteínas críticas necessárias para o funcionamento dessas vias junto com seus parceiros nativos de interação não só permitiu o mapeamento dos constituintes proteicos dessas vias, mas também proporcionou uma compreensão mais profunda de como essas proteínas se coordenam para regular essas vias. Nesse contexto, compreender a localização espaço-temporal de uma proteína e sua rede de interação proteína-proteína pode auxiliar na definição de seu papel dentro de uma via, bem como sua má regulação pode levar à patogênese da doença. Para atender a essa necessidade, várias abordagens para purificação de proteínas, como purificação por afinidade em tandem (TAP) e localização e purificação por afinidade (LAP), foram projetadas e usadas com sucesso. No entanto, a fim de aplicar essas abordagens para análises proteômicas de escala de caminho, essas estratégias devem ser suplementadas com desenvolvimentos tecnológicos modernos em clonagem e geração de linhagem de células estáveis ​​em mamíferos. Aqui, nós descrevemos um método para gerar linhas de células estáveis ​​induzíveis humanas marcadas com LAP para investigar a localização subcelular de proteínas e redes de interação proteína-proteína. Esta abordagem foi aplicada com sucesso à dissecção de múltiplas vias celulares, incluindo a divisão celular, e é compatível com análises proteômicas de alto rendimento.

Introdução

Para investigar a função celular de uma proteína não caracterizada, é importante determinar sua na Vivo localização subcelular espaço-temporal e seus parceiros protéicos de interação. Tradicionalmente, marcadores de epítopo simples e em tandem fundidos ao terminal N ou C de uma proteína de interesse têm sido usados ​​para facilitar a localização de proteínas e estudos de interação de proteínas. Por exemplo, a tecnologia de purificação por afinidade em tandem (TAP) permitiu o isolamento de complexos de proteínas nativas, mesmo aqueles que estão em baixa abundância, em leveduras e linhas de células de mamíferos 1,2. A tecnologia de purificação de localização e afinidade (LAP), é um desenvolvimento mais recente que modifica o procedimento TAP para incluir um componente de localização através da introdução da proteína fluorescente verde (GFP) como uma das marcas de epítopo 3. Esta abordagem deu aos pesquisadores uma compreensão mais profunda da localização subcelular de uma proteína em células vivas, ao mesmo tempo que mantém a capacidade de realizar purificações complexas TAP para mapear redes de interação proteína-proteína.

No entanto, existem muitos problemas associados ao uso de tecnologias TAP / LAP que têm dificultado seu uso generalizado em células de mamíferos. Por exemplo, o período de tempo que é necessário para gerar uma linha celular estável que expressa uma proteína marcada com TAP / LAP de interesse que normalmente depende da clonagem do gene de interesse em um vetor viral e da seleção de integrantes estáveis ​​de uma única célula com o nível de expressão desejado. Além disso, muitas vias celulares são sensíveis à superexpressão de proteínas constitutivas (mesmo em níveis baixos) e podem prender células ou desencadear a morte celular ao longo do tempo, tornando impossível a geração de uma linha celular estável TAP / LAP. Estas e outras restrições impediram que as metodologias LAP / TAP se tornassem sistemas de alto rendimento para localização de proteínas e elucidação de complexos de proteínas. Portanto, tem havido um interesse considerável no desenvolvimento de um sistema de marcação LAP de alto rendimento indutível para células de mamíferos que tira proveito das inovações atuais em tecnologias de clonagem e linha celular.

Aqui, apresentamos um protocolo para gerar linhas celulares estáveis ​​com proteínas marcadas com LAP induzíveis por doxiciclina / tetraciclina (Dox / Tet) de interesse que aplica avanços nas tecnologias de clonagem e linha de células de mamíferos. Esta abordagem agiliza a aquisição de dados no que diz respeito à localização subcelular da proteína marcada com LAP, purificação do complexo de proteínas e identificação de proteínas de interação 4. Embora a proteômica de afinidade utilize uma ampla gama de técnicas para a elucidação do complexo de proteínas 5, nossa abordagem é benéfica para acelerar a identificação desses complexos e suas redes de interação nativas e é passível de marcação de proteínas de alto rendimento que é necessária para investigar vias biológicas complexas que contêm uma infinidade de constituintes proteicos. A chave para esta abordagem são os avanços nas estratégias de clonagem que permitem alta fidelidade e clonagem acelerada de genes alvo em uma série de vetores para expressão gênica em vitro, em vários organismos como bactérias e baculovírus, e em células de mamíferos 6,7. Além disso, a colaboração ORFeome clonou milhares de quadros de leitura aberta validados por sequência em vetores que incorporam esses avanços na clonagem, os quais estão disponíveis para a comunidade científica 8-11. Em nosso sistema, o vetor de marcação LAP pGLAP1 permite a clonagem simultânea de um grande número de clones, o que facilita a marcação LAP de alto rendimento. Este procedimento de clonagem acelerado é acoplado a uma abordagem simplificada para gerar linhas de células com genes marcados com LAP de interesse inseridos em um único locus genômico pré-determinado. Isso faz uso de linhas de células que contêm um único local de destino de reconhecimento de flippase (FRT) em seu genoma, que é o local de integração para genes marcados com LAP. Estas linhas celulares também expressam o repressor de tetraciclina (TetR) que se liga aos operadores Tet (TetO2) a montante dos genes marcados com LAP e silencia sua expressão na ausência de Dox / Tet. Isto permite a expressão induzível por Dox / Tet da proteína marcada com LAP em qualquer momento. Ter a capacidade de expressão de proteínas marcadas com LAP induzível é crítico, uma vez que muitas vias celulares são sensíveis aos níveis de proteínas críticas que governam a via e podem interromper o crescimento celular ou desencadear a morte celular quando essas proteínas são superexpressas constitutivamente, mesmo em níveis baixos, tornando a geração de linhas de células estáveis ​​marcadas com LAP não induzíveis é impossível 12.

Protocolo

NOTA: Uma visão geral da geração de linhas de células estáveis ​​marcadas com LAP induzíveis para qualquer proteína de interesse é ilustrada em figura 1 e a visão geral da expressão, purificação e preparação de proteínas marcadas com LAP para análises de proteômica em massa é ilustrada em Figura 3.

1. Clonando o quadro de leitura aberto (ORF) do gene de interesse no vetor LAP-tag

  1. Clonando a ORF do gene de interesse no vetor ônibus espacial.
    1. Use a reação em cadeia da polimerase (PCR) para amplificar o ORF de interesse com os locais attB1 e attB2 apropriados dentro dos primers para fusão N-terminal ou fusão C-terminal. Ver tabela 1 para sequências de primer e mesa 2 para condições de PCR.
    2. O gel purifica os produtos de PCR resolvendo-os em um gel de agarose a 1%. Retire a banda amplificada do tamanho correto do gel e extraia-a da fatia de gel usando um kit de extração de gel de DNA de acordo com as instruções do fabricante.
    3. Incube os produtos de PCR contendo attB purificados com um vetor de transporte contendo attP e a recombinase que permite aos produtos de PCR se recombinarem no vetor de acordo com as instruções do fabricante (ver MTabela de materiais).
      NOTA: Os vetores de transporte vazios e os vetores de marcação LAP contêm o ccdGene B e deve ser propagado em ccdCélulas bacterianas resistentes a B (ver Tabela de Materiais) No entanto, o ccdB gene é recombinado quando um ORF é inserido nesses vetores, portanto, use o padrão DH5 & # 945 E. coli células ao propagar vetores com ORFs clonados.
    4. Transformar DH5 e # 945 E. coli células com 1 e # 956l do produto de reação e as células transformadas em placa em uma placa de ágar de caldo Luria (LB) com 50 mg / ml de canamicina 13.
    5. Selecione as colônias resistentes à canamicina.
    6. Cultive as colônias selecionadas em meio LB com 50 mg / ml de canamicina, faça uma mini-preparação de DNA e confirme a integração do gene por sequenciamento de DNA usando os iniciadores de sequenciamento listados em Tabela 3.
    1. Incubar o vetor de transporte contendo a sequência verificada do gene de interesse ORF com o vetor LAP-tag (pGLAP1 para fusão N-terminal) e a recombinase que medeia a transferência do gene de interesse do vetor de transporte para o vetor LAP-tag de acordo com instruções do fabricante & # 39s (consulte Materiais).
      NOTA: Uma série de vetores LAP / TAP que podem ser usados ​​com base no promotor desejado, epítopo-tag e marcação N ou C-terminal pode ser encontrada em Tabela 4.
    2. Transformar DH5 e # 945 E. coli células com 1 & # 956l do produto de reação e as células transformadas em placa em uma placa de ágar LB com 100 mg / ml de Ampicilina 13.
    3. Selecione as colônias resistentes à Ampicilina.
    4. Cultive as colônias selecionadas em meio LB com 100 mg / ml de Ampicilina, faça uma mini-preparação de DNA e confirme a integração do gene por sequenciamento de DNA usando os primers de sequenciamento listados em Tabela 5.

    2. Geração de uma linha celular estável induzível que expressa o gene de interesse marcado com LAP

    1. Selecione a linha celular mais adequada para o projeto de interesse. Alternativamente, crie uma linha celular hospedeira a partir de qualquer linha celular existente que expresse constitutivamente o TetR e contenha um local FRT que permite que o gene marcado com LAP de interesse seja integrado de forma estável no genoma (ver Materiais).
      NOTA: Este protocolo usa uma linha celular HEK293 que contém o TetR e um local FRT, que é cultivado em meio -Tet DMEM / F12 [feito com 10% de soro fetal bovino (FBS) que é desprovido de tetraciclina (-Tet)] 4 .
    2. Determine a concentração mínima de Higromicina necessária para matar a linha celular hospedeira dentro de 1 a 2 semanas após a adição da droga. A concentração pode variar entre as linhas de células hospedeiras, com a maioria variando entre 100 e # 181g / ml e 800 e # 181g / ml.
      NOTA: Células HEK293 cultivadas em meio -Tet DMEM / F12 com 100 & # 181g / ml Higromicina a 37 & # 176C e 5% CO2 morrerá dentro de 1-2 semanas.
    3. Co-transfectar o vetor que expressa a flippase recombinase (medeia a integração do gene LAP marcado de interesse no local FRT dentro do genoma da célula) com o vetor LAP marcado em células HEK293 usando um reagente de transfecção de acordo com o fabricante & # Instruções 39s. Use uma proporção de 4: 1 do vetor recombinase para o vetor LAP 14.
      NOTA: A proporção ideal depende da linha celular hospedeira e do método de transfecção e pode exigir uma titulação. Uma proporção de 4: 1 funciona bem para a maioria das linhas de células. Incluir uma placa transfectada simulada como controle negativo.
    4. Um dia após a transfecção, substitua o meio -Tet DMEM / F12 por meio novo.
    5. Dois dias após a transfecção, divida as células em 25% de confluência. Permitir células

    3. Purificação de complexos de proteínas marcadas com LAP

    NOTA: O protocolo de purificação de proteína LAP a seguir detalha as recomendações sobre as condições e os volumes usados ​​para uma purificação de proteína LAP típica com base na experiência anterior. No entanto, deve-se ter cuidado para garantir que a otimização empírica seja realizada para qualquer complexo de proteína e nível de expressão de proteína de interesse para fornecer os melhores resultados.

    1. Crescimento celular e colheita de células.
      1. Expandir a linha de células com marcação LAP validada para isolamento TAP de complexos de proteínas, passando continuamente todas as células HEK293 em placas maiores e / ou garrafas rotativas em meio -Tet DMEM / F12 a 37 & # 176C e 5% CO2.
      2. Para linhas de células induzíveis por Tet / Dox, induzir por 10-15 horas a uma concentração de 0,2 & # 181g / ml Tet / Dox quando as células atingirem

      1. Use 40 & # 181g de anticorpo para imunoprecipitação de um lisado preparado a partir de um pellet de células de 0,5 ml, volume de células compactadas (PCV).
        NOTA: A quantidade de anticorpos necessária dependerá da abundância da proteína marcada com LAP, entre outros fatores, e exigirá otimização. Uma titulação de 10-40 & # 181g é recomendada.
      2. Equilibre 160 & # 181l volume empacotado (PV) grânulos de Proteína A em PBST (PBS + 0,1% Tween-20) em um tubo de 1,5 ml. Lave 3 vezes com 1 ml de PBST.
        NOTA: Todas as lavagens aqui são realizadas centrifugando os grânulos a 5.000 x g por 10 seg.
      3. Ressuspenda as contas em 500 & # 181l de PBST e adicione 80 & # 181g de anticorpo anti-GFP de coelho purificado por afinidade a cada tubo de 160 & # 181l de contas. Misture por 1 hora à temperatura ambiente (TA).
      4. Lave as contas 2 vezes com 1 ml de PBST. Em seguida, lave as contas 2 vezes com 1 ml de borato de sódio 0,2 M, pH 9 (20 ml de borato de sódio 0,2 M + 15 ml de ácido bórico 0,2 M). Após a lavagem final, adicione 900 & # 181l de borato de sódio 0,2 M, pH 9 para trazer o volume final para 1 ml.
      5. Adicionar 100 & # 181l de dimetilpimelimidato (DMP) 220 mM para uma concentração final de 20 mM. Gire os tubos suavemente em temperatura ambiente por 30 min. Para DMP 220 mM, ressuspender o conteúdo de um frasco de 50 mg em 877 & # 181l de borato de sódio 0,2 M, pH 9 e adicionar imediatamente à suspensão de grânulos.
      6. Após a incubação com DMP, lave as contas 1 vez com 1 ml de etanolamina 0,2 M, NaCl 0,2 M pH 8,5 para inativar o reticulador residual. Ressuspender contas em 1 ml do mesmo tampão e girar por 1 hora em temperatura ambiente. Pellet grânulos e ressuspender grânulos em 500 & # 181l de 0,2 M de etanolamina, 0,2 M de NaCl pH 8,5. As contas são estáveis ​​por vários meses a 4 & # 176C.
      1. Prepare tampões LAPX (onde X é a concentração de sal desejada [mM KCl] do tampão LAP 300 mM para lise celular, 200 mM para a maioria das lavagens de grânulos e 100 mM para lavar grânulos antes de eluir proteínas), fazendo uma solução de pH 7,4 contendo Ácido 4- (2-hidroxietil) -1-piperazinaetanossulfônico (HEPES) 50 mM, KCl X mM, ácido etilenoglicol tetraacético 1 mM (EGTA), MgCl 1 mM2e glicerol a 10%.
        NOTA: Os componentes deste buffer são usados ​​para aproximar o ambiente em células vivas. HEPES é usado como um tampão na faixa de pH de 7,2-8,2. KCl é um sal usado para manter a força iônica do buffer. EGTA é um agente quelante que se liga aos íons de cálcio para reduzir os níveis de cálcio em comparação com o magnésio. Glicerol e MgCl2 são usados ​​para melhorar a estabilidade das proteínas.
      2. Prepare o tampão LAPX N adicionando 0,05% de nonil fenoxipolietoxiletanol ao tampão LAPX.
        NOTA: Nonil fenoxipolietoxiletanol é um detergente suave que solubiliza proteínas, mas preserva as interações proteína-proteína, portanto, uma concentração mais alta é usada durante o processo de extração e é então reduzida durante as etapas de ligação e lavagem.
      1. Ressuspender 500 & # 181l de PCV em 2,5 ml de LAP300 com 0,5 mM de ditiotreitol (DTT) e inibidores de protease. Adicionar 90 & # 181l de nonil fenoxipolietoxietanol a 10% (0,3% final) e misturar por inversão.
      2. Coloque no gelo por 10 min. Centrifugue a 21.000 x g por 10 min. Colete este sobrenadante de baixa velocidade (LSS). Pegue uma amostra de 10 & # 181l do LSS para análise do gel.
      3. Transfira o LSS para um tubo TLA100.3 e gire a 100.000 x g por 1 hora a 4 e # 176C. Colete este sobrenadante de alta velocidade (HSS), em um tubo e coloque no gelo. Pegue uma amostra de 10 & # 181l de HSS para análise de gel.
        NOTA: Evite tirar a camada superior de lipídios e a inferior de detritos celulares. A camada lipídica deve ser removida por aspiração a vácuo antes de coletar o HSS.
      1. Pré-eluir os grânulos acoplados ao anticorpo (usar 160 & # 181l de grânulos por 0,5 ml de pellet celular (PCV)) lavando-os 3 vezes com 1 ml de tampão de eluição [3,5 M MgCl2 com Tris 20 mM, pH 7,4] para se livrar dos anticorpos não acoplados e reduzir o fundo. Faça rápido. Não deixe as contas em alto teor de sal por muito tempo.
      2. Lave as contas 3 vezes com 1 ml de LAP200 N. Misture o extrato de HSS com esferas de anticorpo por 1 hora a 4 & # 176C. Centrifugue a 21.000 x g por 10 min. Pegue uma amostra de 10 & # 181l do sobrenadante (ou seja, o fluxo (FT)) para análise de gel.
      3. Lave as contas 3 vezes com 1 ml de LAP200 N com DTT 0,5 mM e inibidores de protease. Lave as contas 2 vezes (5 min cada) com 1 ml de LAP200 N com DTT 0,5 mM e inibidores de protease. Lavar rapidamente 2 vezes com 1 ml de LAP200 N com DTT 0,5 mM e sem inibidores de protease antes de adicionar a protease do vírus da gravura do tabaco (TEV).
      1. Diluir 10 & # 181g TEV protease em 1 ml de LAP200 N e girar os tubos a 4 & # 176C durante a noite.
        NOTA: Esta etapa pode ser otimizada para qualquer proteína marcada com LAP para ser concluída em poucas horas, ajustando a concentração de protease TEV, que pode ajudar na preservação de complexos de proteínas marcadas com LAP.
      2. Pellet grânulos e transferir o sobrenadante para um tubo novo. Lave as contas duas vezes com 160 & # 181l LAP200 N com DTT 0,5 mM e inibidores de protease (concentração tripla) para remover qualquer proteína residual. Pegue uma amostra de 10 & # 181l do sobrenadante para análise do gel.
      1. Lave 1 tubo de pasta de agarose de proteína 80 & # 181l S (40 & # 181l de resina empacotada) 3 vezes com 1 ml de LAP200 N.
        NOTA: A ligação da proteína S ao S-tag reconstituirá uma RNase ativa e um segundo epítopo tag alternativo deve ser considerado para complexos de proteínas contendo RNA.
      2. Adicionar o sobrenadante eluído com TEV às contas de agarose de proteína S e balançar por 3 horas a 4 & # 176C. Pellet grânulos e lavar 3 vezes com 1 ml de LAP200 N com 0,5 mM DTT e inibidores de protease. Lave as contas 2 vezes com 1 ml de LAP100.
      1. Eluir as proteínas da proteína S agarose adicionando 50 & # 181l de tampão de amostra Laemmli 4x e aquecer a 97 & # 176C por 10 min.
        NOTA: As proteínas também podem ser eluídas das esferas com tampão de eluição (3,5 M MgCl2 com Tris 20 mM, pH 7,4).

      4. Identificar proteínas em interação por análise de espectrometria de massa

      1. Teste a qualidade da purificação analisando as amostras coletadas por eletroforese em gel de poliacrilamida de dodecil sulfato de sódio (SDS-PAGE), coloração com prata do gel (ver Tabela de Materiais) e por imunotransferência dos eluatos e sondagem com anticorpos anti-GFP para garantir que a purificação marcada com LAP funcionou 16, consulte Figura 4.
      2. Para identificar espécies co-purificadoras estequiométricas e subestequiométricas, pegue a amostra de eluição final e separe-a por SDS-PAGE. Mancha o gel com um corante de proteína compatível com espectrometria de massa. Retire as bandas mais proeminentes e o espaço entre elas do gel e processe-as para análise por espectrometria de massa separadamente 16.
        NOTA: Existem inúmeras abordagens para separar os eluatos de purificação final e prepará-los para espectrometria de massa 5. Por exemplo, os complexos purificados por LAP podem ser eluídos a partir de grânulos de proteína S usando alto teor de sal (MgCl 3,5 M2) e toda a população de proteínas em massa pode ser analisada por espectrometria de massa 17. Alternativamente, os eluatos finais podem ser separados por 1 mm por SDS-PAGE e uma única banda de 1 mm pode ser excisada e analisada. Isso limpa a mistura complexa de quaisquer grânulos ou partículas que possam interferir na análise.

      Resultados Representativos

      Para destacar a utilidade deste sistema, a estrutura de leitura aberta (ORF) da proteína de ligação ao microtúbulo Tau foi clonada no vetor de transporte amplificando a ORF Tau com iniciadores contendo os locais attB1 e attB2 (tabela 1) e incubar os produtos de PCR com o vetor de transporte e uma recombinase que medeia a inserção dos produtos de PCR no vetor de transporte. Os produtos da reação foram usados ​​para transformar bactérias DH5 & # 945 13 e o DNA de plasmídeo de colônias resistentes à canamicina foi sequenciado para garantir a inserção de Tau. Um vetor de transporte Tau validado por sequência foi então usado para transferir a Tau ORF para o vetor pGLAP1, que fundiu Tau em quadro com a etiqueta LAP (EGFP-TEV-S-Protein), incubando o vetor de transporte Tau com o vetor pGLAP1 e a recombinase que medeia a transferência da ORF do vetor de transporte para pGLAP1. Os produtos da reação foram usados ​​para transformar bactérias DH5 & # 945 13 e o DNA de plasmídeo de colônias resistentes à ampicilina foi sequenciado para garantir que a fusão LAP-Tau estava no quadro. A sequência validada de pGLAP1-LAP-Tau foi então co-transfectada com um vetor que expressa a enzima de recombinação de flippase em células HEK293 que continham um único local de alvo de reconhecimento de flippase (FRT) em seu genoma, que é o local de integração para genes marcados com LAP 14 Esta linha celular também expressou o TetR que se liga aos operadores Tet a montante dos genes marcados com LAP e silencia sua expressão na ausência de Tet / Dox. Integrantes estáveis ​​foram selecionados com meio -Tet DMEM / F12 com 100 & # 181g / ml Higromicina por 5 dias. Focos de células individuais resistentes à higromicina foram colhidos adicionando 20 & # 181l de tripsina no topo e pipetando para cima e para baixo 2 vezes. As células foram colocadas em uma placa de 24 poços e expandidas por crescimento contínuo em meio -Tet DMEM / F12.

      Para verificar se as células resistentes à higromicina eram capazes de expressar LAP-Tau, as células HEK293 LAP-Tau foram induzidas com 0,1 & # 181g / ml de Dox por 15 horas e os extratos de proteína foram preparados a partir de células não induzidas e induzidas por Dox. Esses extratos foram separados por SDS-PAGE, transferidos para uma membrana de PVDF e imunotransferidos para GFP e Tubulina como controle de carregamento. Como visto em Figura 4A, LAP-Tau (visualizado com anticorpos anti-GFP) foi apenas expresso na presença de Dox. Para validar que LAP-Tau foi adequadamente localizado no fuso do microtúbulo mitótico durante a mitose, como havia sido mostrado anteriormente para Tau 18 endógeno, as células HEK293 LAP-Tau foram induzidas com 0,1 & # 181g / ml Dox por 15 horas e as células foram fixadas com 4% paraformaldeído e co-corado para DNA (Hoechst 33342) e microtúbulos (anticorpos anti-tubulina). Consistentemente, LAP-Tau foi localizado no fuso mitótico durante a metáfase da mitose (Figura 4B) Para verificar se LAP-Tau e suas proteínas de interação poderiam ser purificadas com este sistema, células HEK293 LAP-Tau foram cultivadas em garrafas rotativas para

      70% de confluência, induzida com 0,1 & # 181g / ml de Dox por 15 horas, colhida por agitação, lisada com tampão LAP300 e LAP-Tau foi purificada usando o protocolo acima. Os eluatos da purificação LAP-Tau foram resolvidos por SDS-PAGE e o gel foi corado com prata. Figura 4C mostra a purificação LAP-Tau, marcada com um asterisco é LAP-Tau e várias outras bandas indicativas de proteínas interagindo com Tau podem ser vistas.


      Figura 1: Visão geral da geração de linhas de células estáveis ​​induzíveis marcadas com LAP para qualquer proteína de interesse. O quadro de leitura aberta (ORF) de genes de interesse são amplificados com os locais attB1 e attB2 flanqueando as sequências finais 5 & # 39 e 3 & # 39, respectivamente (as sequências de iniciador são fornecidas em tabela 1) e clonado no vetor de transporte. Os vetores de transporte verificados por sequência com o gene de interesse são então usados ​​para transferir o gene de interesse para o vetor pGLAP1. A sequência verificada do vetor pGLAP1 com o gene de interesse é então co-transfectada com o vetor contendo a flippase recombinase na linha de células desejada que contém um único local de destino de reconhecimento de flippase (FRT) dentro de seu genoma, que é o local de integração para LAP genes marcados. Estas linhas celulares também expressam o repressor Tet (TetR) que se liga aos operadores Tet (TetO2) a montante dos genes marcados com LAP e silencia sua expressão na ausência de Tet / Dox. O gene marcado com LAP de interesse é então recombinado no local FRT e integrantes estáveis ​​são selecionados com Higromicina. Clique aqui para ver uma versão ampliada desta figura.


      Figura 2: Visão geral dos pedidos para linhas de células estáveis ​​marcadas com LAP. Linhas celulares estáveis ​​induzíveis com LAP marcadas são induzidas a expressar a proteína LAP marcada de interesse por adição de Dox e podem ser sincronizadas em vários estágios do ciclo celular ou podem ser estimuladas com produtos químicos ou ligantes para ativar qualquer via de sinalização desejada. A localização subcelular da proteína marcada com LAP de interesse pode ser analisada por imagem de células vivas ou células fixas. As proteínas marcadas com LAP também podem ser purificadas por afinidade em tandem e suas proteínas de interação podem ser identificadas por espectrometria de massa em tandem de cromatografia líquida (LC-MS / MS). Finalmente, o Cytoscape pode ser usado para gerar uma rede de interação proteína-proteína da proteína isca. Dox indica doxiciclina, IP indica imunoprecipitado, EGFP indica proteína fluorescente verde intensificada, Tev indica sítio de clivagem de protease TEV e S indica S-tag. Clique aqui para ver uma versão ampliada desta figura.


      Figura 3: Visão geral da expressão, purificação e preparação de proteínas marcadas com LAP para espectrometria de massa. O protocolo tem 9 etapas: 1) crescimento e indução da expressão de proteína marcada com LAP, 2) coleta e lise de células, 3) a preparação de lisados, 4) a ligação de lisados ​​a grânulos anti-GFP, 5) clivagem de protease TEV de a tag GFP, 6) a ligação de lisados ​​a grânulos de proteína S, 7) a eluição da proteína isca e proteínas de interação e 8-9) a preparação de amostras para análises proteômicas baseadas em espectrometria de massa. Clique aqui para ver uma versão ampliada desta figura.


      Figura 4: Verificação da expressão de LAP-Tau. (UMA) Análise de Western blot (WB) de amostras de proteínas de células LAP-Tau HEK293 não induzidas e induzidas por Dox, sondadas com anticorpos anti-GFP e anti-tubulina para detectar a proteína Tau marcada com LAP e o controle de carregamento de tubulina, respectivamente. Observe que o LAP-Tau é expresso apenas quando as células são induzidas com Dox. (B) As células mitóticas que expressam LAP-Tau foram fixadas e co-coradas para DNA (Hoechst 33342) e Tubulina (Tub) com anticorpos anti-tubulina e a localização subcelular de LAP-tau foi analisada por microcopia de fluorescência. Observe que o LAP-Tau se localiza no fuso mitótico e nos pólos do fuso durante a mitose. (C) Gel corado com prata da purificação LAP-Tau. MW indica peso molecular, CL indica lisados ​​clarificados e E indica eluatos finais. As amostras foram executadas em SDS-PAGE 4-20% e o gel foi corado com prata para visualizar as proteínas purificadas. Observe que uma banda correspondente a LAP-Tau está marcada com um asterisco e várias outras bandas correspondentes a proteínas co-purificadoras podem ser vistas. Clique aqui para ver uma versão ampliada desta figura.

      Fusão N-terminal
      Avançar 5'-GGGGACAAGT TTGTACAAAAAAGCAGGCTTCATG - (& # 6218gsn) -3 & # 8217
      Reverter 5'-GGGGACCACTTTGTACAAGAAAGCTGGGTT TTATCA - (& # 6218gsn) -3 & # 8217
      Fusão C-terminal
      Avançar 5'-GGGGACAAGTTTGTACAAAAAAGCAGGCTTCACC - (& # 6218gsn) -3 & # 8217
      Reverter 5'-GGGGACCACTTTGTACAAGAAAGCTGGGTG - (& # 6218gsn) -3 & # 8217

      Tabela 1: Primers direto e reverso para amplificar ORFs ou interesse para inserção no vetor de transporte. Os locais attB são destacados em letras em negrito, gsn denota que mais de 18 nucleotídeos específicos do gene são adicionados ao primer.

      Etapa Temperatura Tempo
      Desnaturação inicial 94 e # 176C 2 minutos
      Ciclos de amplificação de PCR (35) Desnaturar 94 e # 176C 30 s
      Recozer 55 e # 176C (dependendo do primer Tm) 30 s
      Ampliar 72 e # 176C 1 min / kb
      Segurar 4 e # 176C indefinidamente

      Tabela 2: Condições de PCR para amplificação das ORFs de interesse.

      Vetor Primer de sequenciamento direto Primer de sequenciamento reverso
      Vetor de ônibus espacial 5 & ​​# 8217-TGTAAAACGACGGCCAGT-3 & # 8217 5 & ​​# 8217-CAGGAAACAGCTATGAC-3 & # 8217

      Tabela 3: Primers de sequenciamento direto e reverso para o vetor Shuttle.

      EU IRIA Estrutura Parental & # 160 Promotor Bac Res Mam Res Tet reg?
      pGLAP1 Peptídeo N-term EGFP-TEV-S pcDNA5 / FRT / TO CMV Amp Hyg sim
      pGLAP2 Peptídeo Flag-TEV-S de termo N pcDNA5 / FRT / TO CMV Amp Hyg sim
      pGLAP3 N-termo EGFP-TEV-S peptídeo C-termo V5 pEF5 / FRT-V5 EF1a Amp Hyg Não
      pGLAP4 N-termo Flag-TEV-S peptídeo C-termo V5 pEF5 / FRT-V5 EF1a Amp Hyg Não
      pGLAP5 C-termo S peptídeo-PreProt x2-EGFP pEF5 / FRT-V5 EF1a Amp Hyg Não

      Tabela 4: Lista de vetores LAP / TAP disponíveis com promotores variáveis, marcadores de epítopo e capacidades de expressão induzível de Dox para marcação de proteína N ou C-terminal. Os vetores estão disponíveis comercialmente. Bac Res indica marcador de resistência bacteriana, Mam Res indica marcador de resistência de células de mamíferos, Tet reg? indica se a expressão é regulável por Tet / Dox.

      Vetor Primer de sequenciamento direto Primer de sequenciamento reverso
      pGLAP1 5 & ​​# 8217-ATCACTCTCGGCATGGACGAGCTGTACAAG-3 & # 8217 5 & ​​# 8217-TGGCTGGCAACTAGAAGGCACAGTCGAGGC-3 & # 8217
      pGLAP2 5 & ​​# 8217-CGAACGCCAGCACATGGACAGGG-3 & # 8217 5 & ​​# 8217-TGGCTGGCAACTAGAAGGCACAGTCGAGGC-3 & # 8217
      pGLAP3 5 & ​​# 8217-AGAAACCGCTGCTGCTAA-3 & # 8217 5 & ​​# 8217-TAGAAGGCACAGTCGAGG-3 & # 8217
      pGLAP4 5 & ​​# 8217-AGACCCAAGCTGGCTAGGTAAGC-3 & # 8217 5 & ​​# 8217-TAGAAGGCACAGTCGAGG-3 & # 8217
      pGLAP5 5 & ​​# 8217-CGTAATACGACTCACTATAG-3 & # 8217 5 & ​​# 8217-TCCAGGGTCAAGGAAGGCACGG-3 & # 8217

      Tabela 5: Iniciadores de sequenciação direta e reversa para vetores pGLAP.

      Discussão

      O protocolo delineado descreve a clonagem de genes de interesse no vetor de marcação LAP, a geração de linhas de células estáveis ​​marcadas com LAP induzíveis e a purificação de complexos de proteína marcados com LAP para análises proteômicas. No que diz respeito a outras abordagens de marcação LAP / TAP, este protocolo foi simplificado para ser compatível com abordagens de alto rendimento para mapear a localização de proteínas e interações proteína-proteína em qualquer via celular. Esta abordagem tem sido amplamente aplicada à caracterização funcional de proteínas críticas para a progressão do ciclo celular, montagem do fuso mitótico, homeostase do pólo do fuso e ciliogênese, para citar alguns, e ajudou a compreender como a desregulação dessas proteínas pode levar a doenças humanas 15, 16,19,20. Por exemplo, nosso grupo utilizou recentemente este sistema para definir a função e regulação da cinesina mitótica STARD9 (um alvo de câncer candidato) na montagem do fuso 15,21, para definir uma nova ligação molecular entre a cadeia leve da dineína Tctex1d2 e as síndromes de polidactilia de costela curta (SRPS) 19, e para definir uma nova ligação molecular para entender como a mutação da ubiquitina ligase Mid2 pode levar a deficiência intelectual ligada ao X 16. Outros laboratórios também aplicaram com sucesso este método, incluindo um que determinou que Tctn1, um regulador da sinalização de rato Hedgehog, era parte de um complexo de proteína associada à ciliopatia que regulava a composição da membrana ciliar e a ciliogênese de uma maneira dependente do tecido 22,23. Portanto, este protocolo pode ser amplamente aplicado à dissecção de qualquer via celular.

      Uma etapa crítica neste protocolo é a seleção de linhas de células estáveis ​​marcadas com LAP que são resistentes à higromicina. Deve-se tomar cuidado especial para garantir que todas as células na placa de controle estão mortas antes de selecionar os focos na placa experimental para amplificação. A higromicina também pode ser adicionada durante a cultura de células de rotina de linhas de células estáveis ​​marcadas com LAP para assegurar ainda mais que todas as células mantenham o gene marcado com LAP de interesse no local FRT. Advertimos que nem todas as proteínas marcadas com LAP serão funcionais e que é importante ter ensaios que possam ser usados ​​para testar a função da proteína. Exemplos de ensaios usados ​​para testar a função da proteína incluem o resgate de fenótipos induzidos por siRNA e em vitro ensaios de atividade. Para resolver quaisquer problemas potenciais com a adição de uma grande etiqueta LAP, geramos anteriormente vetores TAP-tag compatíveis com este sistema que contêm etiquetas menores, como FLAG, que são menos propensos a inibir a função e localização da proteína de interesse 4 Além disso, existem vetores de marcação LAP para gerar proteínas marcadas com LAP C-terminal ou proteínas marcadas com TAP C-terminal que são compatíveis com este sistema, que podem ser usados ​​nos casos em que uma etiqueta LAP / TAP não é tolerada no N -terminus de uma proteína. Além disso, as concentrações de sal e detergente dos tampões de purificação (LAPX N) podem ser modificadas para aumentar ou diminuir o rigor de purificação se nenhuma ou muitas interações forem observadas. Da mesma forma, o procedimento de purificação de afinidade em tandem é mais rigoroso do que os procedimentos de purificação simples e os interagentes fracos podem ser perdidos, portanto, um único esquema de purificação pode ser usado quando poucos ou nenhum interagente são identificados.

      É importante notar que existem outras abordagens de marcação de epítopo GFP que permitem marcação de proteína GFP em larga escala para estudos de localização e purificação de proteínas 24,25. Estes incluem a abordagem BAC TransgenOmics que utiliza cromossomos artificiais bacterianos para expressar genes marcados com GFP de interesse de seu ambiente nativo que contém todos os elementos reguladores, que imita a expressão de genes endógenos 24. Mais recentemente, os complexos de ribonucleoproteína (RNPs) CAS9 / RNA guiado único (sgRNA) têm sido usados ​​para marcar endogenamente genes de interesse com um sistema de GFP dividido que permite a expressão de genes marcados com GFP a partir de seus loci genômicos endógenos 25. Embora ambas as abordagens permitam a expressão de proteínas marcadas sob condições endógenas, em comparação com o protocolo de marcação LAP descrito aqui, elas não permitem a expressão induzível e sintonizável dos genes marcados de interesse. Além disso, eles ainda precisam ser aplicados à marcação de epítopos em tandem para TAP. Também é importante notar que outros sistemas de marcação também podem ser modificados para se tornarem compatíveis com o sistema descrito aqui para gerar linhas de células estáveis ​​marcadas com epítopo induzível. Por exemplo, a identificação de biotina dependente de proximidade (BioID) atraiu atenção considerável devido à sua capacidade de definir relações espaciais e temporais entre proteínas em interação 26. Esta técnica explora fusões de proteínas a uma cepa promíscua de Escherichia coli biotina ligase BirA, que biotinila qualquer proteína dentro de um

      Raio de 10 nm da enzima. As proteínas biotiniladas são então purificadas por afinidade usando captura por afinidade com biotina e analisadas quanto à composição por espectrometria de massa. BirA irá biotinilar qualquer proteína em estreita proximidade, mesmo transitoriamente, o que o torna especialmente adequado para detectar parceiros de interação mais fracos dentro de um complexo 27. Além disso, o esquema de purificação não exige que as interações proteína-proteína endógena permaneçam intactas e podem ser realizadas em condições desnaturantes, reduzindo assim a taxa de falsos positivos. Dentro do nosso protocolo atual, a substituição do vetor pGLAP1 por um vetor de marcação BirA poderia transformar este sistema de identificação de interações proteína-proteína com base na afinidade para detectá-las com base na proximidade. Tal sistema seria altamente vantajoso para detectar interações transientes de proteínas como é o caso entre muitas interações enzima-substrato e para mapear as interações espaço-temporais proteína-proteína dentro de estruturas definidas como foi realizado para o centrossoma e cílios 26,28.

      Divulgações

      Os autores não têm nada a divulgar.

      Agradecimentos

      Este trabalho foi apoiado pelo National Science Foundation Grant NSF-MCB1243645 (JZT), quaisquer opiniões, descobertas e conclusões ou recomendações expressas neste material são de responsabilidade dos autores e não refletem necessariamente as opiniões da National Science Foundation. Os financiadores não tiveram nenhum papel no desenho do estudo, coleta e análise de dados, decisão de publicar ou preparação do manuscrito.


      Opções de acesso

      Obtenha acesso completo ao diário por 1 ano

      Todos os preços são preços NET.
      O IVA será adicionado mais tarde no check-out.
      O cálculo do imposto será finalizado durante o checkout.

      Obtenha acesso limitado por tempo ou ao artigo completo no ReadCube.

      Todos os preços são preços NET.


      Resultados

      RiNLE1 é especificamente expresso em arbúsculos e transloca-se para o núcleo da planta

      Nossa análise de transcriptoma específica de estágio anterior do Rhizophagus irregularis secretome, identificado c. 50 proteínas efetoras putativas que mostraram expressão específica em arbúsculos (Zeng et al., 2018). Um dos candidatos a efetores específicos de arbúsculos mais expressos, RiNLE1 (GenBank: EXX65927.1), foi previsto para se localizar no núcleo, sugerindo que ele pode se translocar para a célula hospedeira para exercer sua função lá (Fig. S1a), tornando-o um candidato a efetor intrigante potencialmente controlando a formação de arbustos.

      Como um primeiro passo para desvendar o papel deste efetor conservado, confirmamos a expressão específica do arbusto de RiNLE1 usando RNA no local hibridização em raízes micorrizadas de Medicago. Isso mostrou que RiNLE1 foi de fato especificamente expresso em arbúsculos, semelhante à expressão do transportador de fosfato 4 específico para células contendo arbúsculos (PT4 Javot et al., 2007) usado como controle positivo (Fig. 1a, b). Nenhum sinal foi detectado em arbúsculos nos controles negativos quando uma sonda de detecção RiNLE1 foi usada ou quando os conjuntos de sondas foram omitidos (Fig. 1c, d).

      Em seguida, usando um ensaio YSST, confirmamos que RiNLE1 foi secretado como R. irregularis atualmente não pode ser transformado de forma estável (Forbes et al., 1998, Helber & Requena, 2008). Portanto, o RiNLE1 sequência de codificação completa foi fundida a uma invertase de levedura (SUC2) sem seu peptídeo sinal endógeno e transformado no Saccharomyces cerevisiae Cepa Y02321 (Lee et al., 2006). A expressão desta construção permitiu que Y02321 crescesse em meio de seleção de sacarose, enquanto o controle de vetor vazio não pôde (Fig. 2a), indicando a secreção da proteína de fusão RiNLE1.

      RiNLE1 contém um sinal de localização nuclear (NLS) em seu terminal C (Fig. S1a). Para determinar se RiNLE1 poderia se localizar no núcleo da planta em células contendo arbúsculos, primeiro expressamos RiNLE1 marcado com GFP N-terminal (nenhum peptídeo sinal) pelo específico de células contendo arbúsculos MtPT4 promotor (PT4p :: GFP-RiNLE1) Isso mostrou que GFP-RiNLE1 localizado no núcleo e, especialmente, acumulado em corpos nucleares, incluindo o nucléolo, de células contendo arbúsculos (Fig. 1e-h) semelhante à sua localização em Nicotiana Benthamiana folhas (Fig. S1b Zeng et al., 2018 ).

      Em seguida, estudamos se RiNLE1 poderia se translocar para o núcleo do hospedeiro. Primeiro, tentamos localizar RiNLE1 usando anticorpos específicos. No entanto, apesar de vários esforços, não fomos capazes de obter um anticorpo que fosse específico o suficiente para detectar de forma confiável RiNLE1 no local. Portanto, usamos uma abordagem alternativa pela expressão de um construto RiNLE1 marcado com GFP (sem peptídeo de sinal endógeno) contendo uma sequência de peptídeo de sinal de planta de MtBCP1 para direcioná-lo para o apoplasto (Ivanov & Harrison, 2019) sob o controle do constitutivo Ubiquitina 1 de Lotus japonicus promotor (LjUB1p :: BCPsp-GFP-RiNLE1) em folhas de nicotiana. O peptídeo sinal MtBCP1 foi escolhido porque o peptídeo sinal endógeno de RiNLE1 não é bem processado em plantas, causando um acúmulo de proteína recombinante no retículo endoplasmático (Fig. S1c). LjUB1 :: BCPsp-GFP em falta RiNLE1 foi usado como o controle. Isso mostrou que BCP1sp-GFP-RiNLE1 ainda se acumulou no nucléolo, enquanto o controle BCPsp-GFP foi encontrado apenas no apoplasto, sugerindo que RiNLE1 pode se translocar em células vegetais mesmo na ausência do fungo (Fig. 2b). As análises de Western blot confirmaram a presença das proteínas de fusão nas folhas de Nicotiana (Fig. S1d).

      Coletivamente, esses resultados indicaram que RiNLE1 é especificamente expresso em arbúsculos de onde pode se translocar para o núcleo do hospedeiro.

      Proteínas semelhantes a RiNLE1 ocorrem em vários fungos

      Para determinar se os homólogos de RiNLE1 podem ser encontrados em outros fungos, buscamos homólogos usando a proteína B LAST usando os bancos de dados NCBI e JGI MycoCosm. Inúmeras proteínas hipotéticas mostrando homologia parcial com parte de RiNLE1 foram inicialmente identificadas. Para selecionar homólogos efetores potenciais entre esses acertos, os seguintes critérios também foram aplicados: (1) as proteínas devem ter um peptídeo sinal predito usando S ignal P-5.0 (http://www.cbs.dtu.dk/services/SignalP/ ) (1) as proteínas devem ser previstas para serem um efetor potencial com base no E fector P 2.0 (http://effectorp.csiro.au/) (3) as proteínas devem ter um NLS previsto usando L OCALIZER (http: // localizer.csiro.au/). Como resultado, 19 homólogos de RiNLE1 foram identificados (Tabela S3). Estas são todas proteínas hipotéticas e não possuem quaisquer domínios de proteína conhecidos (Fig. S2a). Pudemos detectar a presença de efetores semelhantes a RiNLE1 contendo um peptídeo sinal e um NLS no terminal C, em todos os genomas de fungos AM disponíveis em NCBI e JGI (Fig. S2a, b). Curiosamente, homólogos de RiNLE1 também foram encontrados em fungos ectomicorrízicos Elaphomyces granulatus (semelhança 37,2%), o fungo parasita do molde da água Rozella allomycis (similaridade 43,9%), o fungo parasita de algas verdes Powellomyces hirtus (semelhança 41,6%), e o fungo oídio da cevada Blumeria graminis (semelhança 37,7%). Estes resultados indicaram que os homólogos RiNLE1 existem em uma ampla gama de fungos que interagem intimamente com as plantas ou que colonizam intracelularmente outros hospedeiros.

      A superexpressão de RiNLE1 aumenta a colonização por AM

      Para explorar o papel de RiNLE1 na micorrização, primeiro aplicamos o silenciamento do gene induzido pelo hospedeiro (HIGS) para derrubar sua expressão (Nowara et al., 2010). No entanto, apesar de várias tentativas usando duas construções em gancho diferentes, a expressão de RiNLE1 não pôde ser derrubado com sucesso (dados não mostrados). Como uma abordagem alternativa, investigamos o efeito da superexpressão de RiNLE1 na colonização micorrízica. Portanto, RiNLE1 (sem o peptídeo sinal) foi expresso nas raízes do Medicago sob o controle da LjUbiquitin1 os níveis de promotor e de micorrização foram quantificados usando o método de intersecção (McGonigle et al., 1990) 3 semanas após a inoculação. Duas repetições independentes com cada uma das oito raízes transformadas independentemente mostraram um aumento significativo na abundância de hifas em comparação com o controle de vetor vazio, enquanto a abundância de arbúsculos não foi significativamente alterada (Figs 3a, S3). A falta de efeito sobre o número de arbustos pode ser porque o fungo RiNLE1 em si já é altamente expresso especificamente em células arbusculares. As análises qPCR confirmaram a superexpressão de RiNLE1 e o fenótipo, como o fungo RiEF1 gene de referência foi significativamente mais altamente expresso em UBQp :: RiNLE1 raízes em comparação com raízes de controle, enquanto a expressão de MtPT4, um marcador para abundância de arbúsculos, não mudou significativamente (Fig. 3b). Esses resultados indicaram que RiNLE1 desempenha um papel positivo na colonização por AM.

      RiNLE1 suprime a expressão do gene relacionado à defesa do hospedeiro

      Como raciocinamos que RiNLE1 exerce suas funções dentro dos núcleos do hospedeiro, exploramos a influência de RiNLE1 na expressão de genes de plantas. Portanto, aplicamos um sistema promotor indutível de dexametasona (DEX) (Borghi, 2010) para induzir RiNLE1 expressão (sem peptídeo sinal) em raízes de Medicago. Como controle, substituímos o RiNLE1 sequência de codificação usando uma sequência curta sem sentido (Dummy3 do kit de clonagem Golden Gate Engler et al., 2014). A indução de DEX foi confirmada 20 h após o tratamento com DEX 10 µM por meio da visualização de um marcador de GFP cotransformado que estava sob o controle do mesmo DEX indutível cis- elemento regulador usado para conduzir RiNLE1 (Fig. S4a, b). A análise qPCR confirmou ainda a indução de RiNLE1 (Fig. S4c). Portanto, este ponto de tempo foi escolhido para monitorar as alterações de expressão após a indução de DEX usando sequenciamento de RNA. Três réplicas, representando pools de raízes transformadas independentemente, foram usadas para as amostras de controle e RiNLE1.

      Os dados de RNA-seq foram analisados ​​usando o CLC Genomics workbench 10.0.1 (Qiagen). As informações de mapeamento de leitura estão resumidas na Tabela S4. PCA dos dados de RNA-seq mostraram uma separação clara de amostras DEX-RiNLE1 e amostras de controle DEX-vazio (EV) em PC2 (27% de variância), mas não PC1 (49% de variância) (Fig. S5a). Isso indicou que a indução de RiNLE1 afetou os níveis de expressão do gene, mas que também houve uma variação relativamente grande entre as diferentes amostras replicadas. Essa diferença provavelmente foi causada porque diferentes A. rhizogenes raízes transformadas (representando eventos de transformação independentes) foram analisadas para cada experimento replicado e os níveis de RiNLE1 expressão nas diferentes amostras variaram os níveis de TPM para RiNLE1: 5215, 1993, 3002 nas três repetições, respectivamente (linha inferior na Tabela S5). Usando uma dobra de corte, altere & gt 2, e P & lt 0,05, identificamos 76 genes diferencialmente expressos (DEGs) em amostras DEX-RiNLE1 em relação às amostras de controle induzidas por DEX (Tabela S5). Entre os DEGs identificados, 32 genes foram regulados negativamente após RiNLE1 indução (Fig. 4a Tabela S6).

      Para determinar se os DEGs estariam envolvidos em um processo biológico comum, realizamos análise de enriquecimento de ontologia genética (GO) (Tian et al., 2017). Isso revelou um claro enriquecimento em genes associados a processos de defesa ou relacionados ao estresse entre os 32 genes regulados para baixo (Fig. S5b). Em contraste, os genes regulados positivamente não mostraram enriquecimento em nenhum processo biológico. Portanto, focamos especificamente nos genes regulados para baixo. A maioria dessas proteínas relacionadas à patogênese codificadas, quitinases ou peroxidases, relacionadas à resposta da planta ao estresse biótico (Dodds & Rathjen, 2010) (Fig. 4a Tabela S6).

      Para confirmar os dados de RNA-seq, selecionamos oito genes relacionados à defesa da planta com regulação negativa, bem como dois genes fortemente regulados positivamente, e em um experimento independente quantificamos seus níveis de expressão usando qPCR. Com exceção de um gene, todos os genes mostraram a regulação diferencial esperada após RiNLE1 indução (Fig. 4b). Porque RiNLE1 é especificamente expresso em arbúsculos, também analisamos se os níveis de expressão dos 32 genes regulados negativamente eram mais baixos em células contendo arbúsculos em comparação com suas células vizinhas do córtex não colonizadas, com base em dados de transcriptoma específicos de células disponíveis (Hogekamp & Küster, 2013 Zeng et al., 2018). Este experimento mostrou que os genes, cuja expressão poderia ser detectada com segurança, eram de fato significativamente menos expressos em células contendo arbúsculos em comparação com células vizinhas (não colonizadas) do córtex (Tabela S7).

      Para avaliar ainda mais a capacidade de RiNLE1 de suprimir as respostas de defesa do hospedeiro, testamos a influência de RiNLE1 em um ensaio de patogenicidade comumente usado em que a co-expressão da membrana plasmática está localizada Solanum lycopersicum receptor imune Cf4 com seu alvo de avirulência AVR4 de Cladosporium fulvum levou a um RH em Nicotiana Benthamiana folhas (mãe et al., 2012 Liebrand et al., 2013). A co-expressão de RiNLE1 juntamente com AVR4 e Cf-4 nas folhas de Nicotiana não levou a uma forte HR, enquanto a co-expressão de GFP como o controle negativo mostrou uma resposta clara de HR (Fig. 4c, d). Este resultado apoiou um papel para RiNLE1 na modulação das respostas imunes.

      RiNLE1 interage com Medicago histona 2B

      Como o RiNLE1 pode se localizar no núcleo do hospedeiro e suprimir a expressão do gene relacionado à defesa, concluímos que ele o faz interagindo com as proteínas do hospedeiro. Para identificar potenciais alvos do hospedeiro, realizamos um experimento de co-imunoprecipitação (Co-IP) acoplado a espectrometria de massa em tandem de cromatografia líquida (LC-MS / MS). FLAG-tagged RiNLE1 foi expresso a partir da célula-específica contendo arbuscule MtPT4 promotor nas raízes cabeludas do Medicago. Às 5 semanas após a inoculação com R. irregularis, imunoprecipitamos RiNLE1 marcado com FLAG e seus potenciais interatores de plantas usando esferas magnéticas anti-FLAG (Fig. S6). LC-MS / MS identificou várias proteínas, incluindo histona 2B (H2B) para interagir potencialmente com RiNLE1 (Tabela S8).

      Para confirmar os dados de espectroscopia de massa, realizamos um experimento Co-IP independente expressando com tag FLAG RiNLE1 junto com os possíveis interatores em Nicotiana benthamiana sai. MtH2B.1 (H2B.1 Medtr4g064020) foi escolhido porque é altamente expresso em células contendo arbúsculos. Um alvo nuclear MtSPX3 (Medtr0262s0060 Young et al., 2011) proteína de fusão -FLAG e GFP livre foram usados ​​como controles negativos. As análises de Western blot confirmaram a interação de MtH2B.1 com RiNLE1 (Fig. 5a). Além disso, GFP-RiNLE1 (sem SP) e H2B-mCherry co-localizados no núcleo e nucléolo N. benthamiana folhas (Fig. S7b-d). Além disso, as análises de levedura-dois híbridos também confirmaram a interação de RiNLE1 com MtH2B.1 usando RiNLE1 como isca e MtH2B.1 como presa (Fig. 5b). Em experiências de Co-IP independentes subsequentes, a interação de RiNLE1 com as outras quatro proteínas (Med36a, H1, Dynamin1, API5 Tabela S8) enriquecida nos dados de LC-MS / MS não pôde ser confirmada (dados não mostrados).

      RiNLE1 interfere com a mono-ubiquitinação de H2B

      Os estudos de interação levantaram a questão de como RiNLE1 pode influenciar a expressão do gene de defesa ao interagir com H2B. H2B é um componente central dos nucleossomos e as modificações de H2B demonstraram regular vários processos, desde o desenvolvimento da planta até a resposta ao estresse ambiental (Fleury et al., 2007 Cao et al., 2015 Zhao et al., 2019). Mais notavelmente, vários estudos relataram uma ligação entre a mono-ubiquitinação de H2B e as respostas imunes das plantas (Dhawan et al., 2009 Zou et al., 2014 Zhang et al., 2015). Portanto, formulamos a hipótese de que RiNLE1 pode influenciar a mono-ubiquitinação de H2B.

      Para avaliar o efeito de RiNLE1 na ubiquitinação de H2B (H2Bub), isolamos proteínas nucleares induzidas por DEX RiNLE1 raízes de superexpressão e raízes de controle de EV. Os níveis de H2Bub foram analisados ​​usando western blot e um anticorpo anti-H2Bub, que detecta uma lisina mono-ubiquitinada conservada no domínio C-terminal de H2B. A especificidade deste anticorpo foi bem testada em Arabidopsis (Zou et al., 2014 Chen et al., 2017). Como referência, foi utilizado um anticorpo contra a histona 3. Três experimentos independentes mostraram que os níveis de H2Bub foram significativamente reduzidos quando RiNLE1 a expressão foi induzida (Fig. 6a). A quantificação mostrou um c. 40% de redução nos níveis de H2Bub em RiNLE1- amostras induzidas (Fig. 6b). Isso indica que RiNLE1 pode inibir a mono-ubiquitinação de H2B na planta.

      Os níveis de H2Bub influenciam a expressão do gene de defesa e a micorrização arbuscular

      Para estabelecer ainda que a regulação negativa de genes relacionados à defesa está associada aos níveis de H2Bub, substituímos o local de mono-ubiquitinação H144 previsto para H2B (lisina) por A (alanina), para evitar que se torne ubiquitinado. Em seguida, aplicamos o sistema indutível por DEX para induzir a expressão deste H2BK144A em raízes cabeludas de Medicago e monitorado se sua superexpressão afetaria a expressão do gene de defesa responsivo a RiNLE1. Raízes expressando H2B de tipo selvagem induzidas por DEX foram usadas como controle. H2BK144A a expressão foi induzida significativamente 20 h após o tratamento com DEX 10 µM (Fig. S7a). As análises de Western blot de extratos de proteína nuclear mostraram que as amostras de H2BK144A tinham níveis de H2Bub significativamente mais baixos em comparação com o controle EV (Fig. 7a). Em seguida, determinamos o nível de expressão de genes responsivos a RiNLE1 após a supressão dos níveis de H2Bub. Cinco deles mostraram expressão significativamente mais baixa (Fig. 7b), o restante não diferiu. Isso mostrou que a expressão dos genes foi suprimida após a superexpressão induzível de H2BK144A (Fig. 7b). Esses dados indicaram que RiNLE1 pode inibir a mono-ubiquitinação de H2B que, por sua vez, dificulta a indução de um conjunto de genes associados à defesa em células contendo arbúsculos.

      Para determinar se os níveis aumentados de H2Bub afetaram negativamente a micorrização, superexpressamos a enzima RING E3 ligase H2B monoubiquitinação1 (HUB1) responsável pela ubiquitinação H2B (Liu et al., 2007). Primeiro, confirmamos que a superexpressão induzida por DEX do Medicago MtHUB1 (Medtr7g046250) o ortólogo realmente levou a níveis mais elevados de H2Bub nas raízes do Medicago (Fig. 7a). Em seguida, monitoramos a expressão de 10 genes de defesa selecionados em resposta a MtHUB1 superexpressão usando qPCR. A expressão de quatro genes de defesa aumentou significativamente em raízes MtHUB1 induzidas por DEX em comparação com controles EV. A expressão de dois genes apresentou regulação mais complexa (Fig. 7e). Esses dados indicaram que níveis aumentados de H2Bub afetaram a expressão de genes relacionados à defesa responsivos a RiNLE1.

      Para estudar o efeito de MtHUB1 superexpressão na micorrização, expressamos MtHUB1 sob o controle de células específicas contendo arbúsculos MtPT4 promotor nas raízes do Medicago. Em 3 semanas após a inoculação, o nível de colonização micorrízica foi classificado usando o método de intersecção (McGonigle et al., 1990). Em comparação com as amostras de controle EV, tanto o nível de colonização quanto a abundância de arbustos foram significativamente (N = 8, P & lt 0,05) reduzido em PT4p :: MtHUB1 amostras de superexpressão. Fenótipos semelhantes foram observados em dois experimentos independentes (Fig. 7c). As análises qPCR confirmaram o fenótipo, usando RiEF como um marcador para representar o nível de colonização fúngica e MtPT4 como marcador para abundância de arbúsculos (Fig. 7d).


      Comparando a afinidade de proteínas de ligação a GTPase usando ensaios de competição

      Este protocolo compara as afinidades relativas de parceiros de ligação para GTPases da família Rho, incluindo Rac1. Na Vivo, As proteínas de ligação a Rac1 competem por uma única interface de ligação, cuja conformação é ditada por um nucleotídeo ligado. O nucleotídeo é importante e difícil de controlar experimentalmente, devido à alta taxa de hidrólise.

      Resumo

      Neste protocolo, demonstramos um método para comparar a competição entre proteínas de ligação a GTPase. Tal abordagem é importante para determinar as capacidades de ligação das GTPases por duas razões: O fato de que todas as interações envolvem a mesma face das GTPases significa que os eventos de ligação devem ser considerados no contexto dos competidores e o fato de que o nucleotídeo ligado também deve ser controlado significa que as abordagens convencionais, como a imunoprecipitação, são inadequadas para a bioquímica da GTPase. O ensaio se baseia no uso de proteínas purificadas. Rac1 purificado imobilizado em grânulos é usado como a proteína isca, e pode ser carregado com GDP, uma versão não hidrolisável de GTP ou nucleotídeo deixado livre, para que o estágio de sinalização a ser investigado possa ser controlado. As proteínas de ligação a serem investigadas são purificadas a partir de células de mamíferos, para permitir o dobramento correto, por meio de um tag GFP. O uso da mesma etiqueta em ambas as proteínas é importante porque não só permite purificação e eluição rápidas, mas também permite a detecção de ambos os competidores com o mesmo anticorpo durante a eluição. Isso significa que as quantidades relativas das duas proteínas ligadas podem ser determinadas com precisão.

      Introdução

      O citoesqueleto de actina que determina a forma, polaridade e propriedades migratórias das células de mamíferos é regulado pela família Rho de pequenas GTPases. As GTPases da família Rho incluem RhoA que estimula a contração do citoesqueleto, Rac1 que estimula a ramificação da actina e a protrusão da membrana e Cdc42 que tem efeitos semelhantes na polimerização da actina para Rac1 e causa a formação de filopódios 1,2. A atividade de sinalização da GTPase é determinada pela ligação de um nucleotídeo, que controla a contração e relaxamento dos loops switch I e switch II que medeiam as interações proteína-proteína com reguladores e efetores. As GTPases ligadas à guanosina 5 & # 8217-trifosfato (GTP) ativam os efetores a jusante, enquanto a forma ligada à guanosina 5 & # 8217-difosfato (GDP) é inativa. Na célula, os ciclos de hidrólise de GTP e troca de nucleotídeos permitem uma rápida renovação dos sinais de GTPase que são necessários para a dinâmica do citoesqueleto. O turnover dos nucleotídeos é regulado por três mecanismos. Fatores de troca de nucleotídeos de guanina (GEFs) estabilizam a GTPase livre de nucleotídeos, catalisando a troca de GDP por GTP e, assim, estimulando a atividade de sinalização da GTPase 3,4. As proteínas ativadoras de GTPase (GAPs) catalisam a hidrólise de GTP em GDP, inibindo assim a atividade de sinalização de GTPase 5. As moléculas sequestrantes, como o regulador da condensação da cromatina 2 (RCC2) e os inibidores da dissociação do nucleotídeo guanina (GDIs), obscurecem os laços de troca e, no caso dos GDIs, removem a GTPase da membrana pela interação com a cauda do prenil 6,7. Cada uma das três classes de moléculas regulatórias interage com os loops de switch, assim como os efetores a jusante e alguns reguladores de tráfego, como a coronina-1C 7. O objetivo deste protocolo é medir a competição para o local de ligação do switch I / II entre os reguladores putativos e as moléculas de sinalização a jusante. Deve-se notar que os ensaios de competição testam a ligação a um local de ligação compartilhado, de modo que este protocolo não é adequado para testar interações com outros locais, como a ligação de GDIs à cauda de prenil.

      A sutileza das diferenças de conformação entre as formas ativa e inativa, combinada com a natureza lábil do nucleotídeo ligado, tornou o estudo dos eventos de ligação de GTPase difícil. O papel do nucleotídeo ligado significa que os ensaios de ligação convencionais, como imunoprecipitação ou ressonância plasmônica de superfície, não são adequados para investigação, uma vez que o nucleotídeo não pode ser controlado. Este obstáculo é agravado pela sobreposição nos sítios de ligação de GEFs, GAPs, efetores, moléculas sequestrantes e moléculas de tráfego, que tornam os dados de ligação para uma única interação difíceis de interpretar no contexto da competição que ocorrerá na célula. A imunoprecipitação, em particular, é comprometida pela competição entre parceiros de ligação, pois sob certas condições celulares, um parceiro de ligação pode ser identificado às custas de todos os outros, enquanto sob outras condições, outro parceiro pode dominar. A natureza dinâmica da sinalização da GTPase é essencial para a função da GTPase e deve ser considerada ao analisar as relações entre as interações de ligação de diferentes reguladores. Na verdade, recentemente descrevemos um caminho que dependia fortemente de vínculos competitivos. Identificamos a coronina-1C como uma molécula de tráfego que se ligou aos loops de switch de GDP-Rac1 7. Em áreas de baixa atividade do GEF, o tráfico dominaria, removendo Rac1 dessas regiões. No entanto, quando Rac1 é entregue a regiões da célula onde a atividade de GEF é alta, o GEF superaria a competição com a coronina-1C, ativando assim Rac1 e evitando a remoção de Rac1 mediada pela coronina-1C dessa área. O modelo vai além, porque a ação das trocas do GEF ligou o PIB ao GTP, deslocando o equilíbrio ainda mais da coronina-1C. Consequentemente, a atividade de Rac1 pode ser explicada inteiramente em termos de competição e afinidade relativa.

      Neste protocolo, descrevemos um método para comparar as afinidades relativas de diferentes parceiros de ligação para pequenas GTPases, usando Rac1 como exemplo. Usando uma abordagem de proteína purificada, é possível juntar uma cadeia de eventos de sinalização por comparação de pares, em um experimento onde o nucleotídeo ligado pode ser controlado de perto.

      Protocolo

      1. Purificação de GTPase marcada com GST

      1. Cultura e E. coli cepa tal como BL21 transformada com pGEX-Rac1 O / N a 37 & # 176C, agitando a 220 rpm, em 500 ml de meio de auto-indução (Na 25 mM2HPO4, 25 mM KH2PO4, 50 mM NH4Cl, Na 5 mM2TÃO4, 2 mM de MgSO4, CaCl 2 mM2, 0,5% Glicerol, 0,05% Glicose, 0,2% Lactose, 5 g Triptona, 2,5 g Extrato de Levedura, 100 & # 181 g / ml Ampicilina).
      2. Colher as bactérias por centrifugação por 10 min a 10.000 x g, 4 & # 176C.
      3. Ressuspender o pellet bacteriano em 20 ml de reagente de extração de proteína, inibidor de protease 1x e incubar por 20 min à temperatura ambiente com inversão.
      4. Clarificar o lisado por centrifugação a 40.000 x g durante 30 min.
      5. Adicionar 2 ml de contas magnéticas de glutationa, lavadas com solução salina tamponada com fosfato (PBS: Na 10 mM2HPO4, 1,8 mM KH2PO4, NaCl 137 mM, KCl 2,7 mM).
      6. Incubar por 2 horas, misturando por inversão a 4 & # 176C.
      7. Lave contas carregadas de proteína quatro vezes com 10 ml de PBS, usando um classificador de partículas magnéticas para precipitar as contas em cada etapa.
      8. Ressuspenda as contas carregadas de proteína em 2 ml de PBS e armazene a -80 e # 176C em alíquotas de 100 e # 181l até que seja necessário.

      2. Expressão de proteínas de ligação a GTPase

      1. No dia anterior ao experimento, transfectar plasmídeos que codificam versões marcadas com proteína fluorescente verde (GFP) de cada proteína de ligação a GTPase em um frasco separado de 75 cm2 de HEK293T como se segue. Para validação do carregamento de nucleotídeos, transfectar TrioD1 marcado com GFP em um terceiro frasco de 75 cm 2 de HEK293T.
        1. Diluir a polietilamina para 1 mg / ml em 100 & # 181l de NaCl 150 mM estéril.
        2. Adicionar 27 & # 181 l de polietilamina diluída a 223 & # 181 l de meio de soro reduzido.
        3. Adicionar 12 & # 181g de DNA de plasmídeo a 250 & # 181l de meio de soro reduzido.
        4. Incubar cada tubo por 2 min em temperatura ambiente.
        5. Combine as misturas de polietilamina e DNA em um único tubo e vortex por 2 min.
        6. Incubar por 15-20 min em temperatura ambiente.
        7. Substitua o meio de crescimento (Dulbecco & # 8217s Modified Eagle Media, 10% de soro fetal bovino, 2 mM de L-glutamina, sem antibióticos) em 90% de HEK293T confluente com 5 ml de meio de crescimento fresco.
        8. Adicione a mistura combinada de polietilamina / DNA ao frasco e incube O / N a 37 & # 176C, 5% CO2.

        3. Purificação de proteínas de ligação a GTPase

        1. Enxágüe os frascos de células transfectadas em PBS e drene o frasco por 5 min, aspirando o líquido livre.
        2. Raspe as células em 500 & # 181l tampão de lise (50 mM Tris-HCl (pH 7,8), 1% Nonidet P-40, 1x inibidor de protease) em tubo de microcentrífuga.
        3. Lise as células por mistura por inversão a 4 e # 176C por 30 min.
        4. Durante a lise, lave dois lotes de 40 & # 181l GFP-Trap grânulos três vezes com tampão de lise fresco, sedimentando grânulos a 2.700 x g por 2 min entre as lavagens.
        5. Clarificar os lisados ​​por centrifugação a 21.000 x g durante 10 min.
        6. Transfira o lisado clarificado de cada uma das proteínas concorrentes para separar os grânulos GFP-trap lavados e permitir que as proteínas de fusão GFP se liguem por 2 horas, misturando por inversão a 4 & # 176C. Manter lisado de células GFP-TrioD1 em gelo.
        7. Lave as contas GFP-Trap carregadas duas vezes em 50 mM Tris-HCl (pH 7,8), 50 mM NaCl, 0,7% (w / v) Nonidet P-40 e duas vezes em 50 mM Tris-HCl (pH 7,6), 20 mM MgCl2, sedimentando contas a 2.700 x g por 2 min entre as lavagens.
        8. Eluir proteínas de fusão GFP adicionando 40 & # 181l glicina 0,2 M (pH 2,5) e pipetando para cima e para baixo por 30 seg. Sedimentar imediatamente as esferas a 21.000 x g por 60 se transferir o líquido para um novo tubo de microcentrífuga contendo 4 & # 181l 1 M Tris-HCl (pH 10,4). Faça isso rapidamente para limitar os danos à proteína purificada.
        9. Analisar 1 & # 181l de cada proteína purificada por Western blot e sonda com um anticorpo anti-GFP para estabelecer o rendimento relativo usando um sistema de blotting quantitativo de acordo com o protocolo do fabricante & # 8217s. Alternativamente, determine as concentrações de proteínas pelo ensaio de ácido bicinconínico (BCA), mas isso introduz erros se as proteínas não reagirem com o ensaio de maneira idêntica ou se houver proteínas contaminantes.
        10. Equalize a concentração de proteína molar pela adição de Tris-HCl 50 mM (pH 7,6), MgCl 20 mM2.

        4. Carregamento de nucleotídeo de GTPase

        1. Descongele uma alíquota de esferas magnéticas GST-Rac1, preparadas na etapa 1.
        2. Pegue 90 & # 181l de contas GST-Rac1 e lave três vezes com Tris-HCl 20 mM (pH 7,6), NaCl 25 mM, DTT 0,1 mM, EDTA 4 mM, usando um classificador de partículas magnéticas para precipitar as contas em cada etapa.
        3. Aspirar o tampão das contas e adicionar 100 & # 181l de Tris-HCl 20 mM (pH 7,6), NaCl 25 mM, DTT 0,1 mM, EDTA 4 mM.
        4. De acordo com a necessidade de GDP, GTP ou nenhuma carga de nucleotídeo para o experimento de competição, adicione 12 & # 181l 100 mM de PIB, 12 & # 181l 10 mM de guanosina 5 & # 8217 - [& # 947-tio] trifosfato (GTP & # 947S) ou nenhum nucleotídeo a 60 & # 181l de esferas GST-Rac1.
        5. Para os controles de carregamento de nucleotídeos, divida as contas restantes em três alíquotas de 10 - & # 181l e adicione 2 & # 181l 100 mM de GDP, 2 & # 181l 10 mM GTP & # 947S ou nenhum nucleotídeo a cada tubo.
        6. Incubar as misturas de grânulos por 30 min a 30 & # 176C com agitação.
        7. Estabilizar Rac1 ligado ao nucleotídeo pela adição de 1 M de MgCl2: 3 e # 181l para a mistura experimental (etapa 4.4), 0,5 e # 181l para cada uma das misturas de controle (etapa 4.5).
        1. Configure 6 tubos de microcentrífuga, cada um contendo:
          200 & # 181l Tris-HCl 50 mM (pH 7,6), MgCl 20 mM2
          10 & # 181l esferas Rac1 carregadas com nucleotídeo experimental (da etapa 4.7)
          5 & ​​# 181l proteína A de ligação a Rac1 (proteína de ligação constante)
        2. A cada tubo, adicione 0, 1, 2,5, 5, 10 ou 20 & # 181l de proteína B de ligação a Rac1 (proteína de ligação variável). Esses volumes assumem concentrações de estoque aproximadamente iguais das proteínas de ligação constante e variável e podem precisar ser ajustados.
          1. Ajuste os volumes das proteínas de ligação A e B se houver grandes diferenças nas afinidades de ligação das duas proteínas e isso deve ser determinado empiricamente através das repetições experimentais. Complete o volume total da mistura de ligação para 235 & # 181l pela adição de Tris-HCl 50 mM (pH 7,6), MgCl 20 mM2.

          6. Análise da concorrência

          1. Resolva 10 & # 181l da proteína ligada (etapa 5.6) por eletroforese em gel de poliacrilamida com dodecil sulfato de sódio (SDS-PAGE) e Western blot.
          2. Incube a membrana a 4 & # 176C O / N em anticorpo anti-GFP diluído 1/1000 em tampão de bloqueio diluído a 1x em PBS, 0,1% Tween-20 para detectar ambas as proteínas de ligação a GTPase marcadas.
          3. Lave a membrana três vezes por 10 min com PBS, 0,1% Tween-20.
          4. Incubar a membrana por 30 min à temperatura ambiente em anticorpo secundário anti-coelho conjugado com DyLight 800, diluído 1 / 10.000 em tampão de bloqueio diluído a 1x em PBS, Tween-20 0,1%.
          5. Lave a membrana três vezes por 10 min com PBS, 0,1% Tween-20.
          6. Digitalize a membrana usando um sistema de imagem infravermelho, usando o software para medir a intensidade da banda de acordo com o protocolo do fabricante & # 8217s.
          7. Trace a intensidade da banda de cada proteína contra o volume do competidor variável (Proteína B).
          8. Divida o volume do competidor variável no ponto em que as linhas se cruzam pelo volume do competidor constante (Proteína A, 5 & # 181l) para determinar a proporção do competidor em que o equilíbrio é alcançado.
          9. Para validação do status de carregamento de nucleotídeos, sonda membranas para quinase 1 ativada por p21 (PAK1) (um efetor) e GFP-TrioD1 (um GEF), conforme descrito nas etapas 6.1-6.6.

          Resultados Representativos

          Este protocolo é projetado para calcular as afinidades relativas dos parceiros de ligação para Rac1, sem a necessidade de saber a concentração precisa dos concorrentes (figura 1) A determinação da concentração de proteína introduz erros e ao considerar a competição entre moléculas em uma via de sinalização não é necessária. No entanto, é importante saber que os dois competidores têm a mesma concentração molar nas soluções estoque para permitir que razões simples sejam calculadas ao adicionar diferentes volumes ao ensaio. 40 & # 181l de grânulos GFP-Trap têm uma capacidade de ligação de

          300 pmol, portanto, frascos confluentes de 75 cm 2 de células de alta expressão irão saturar as contas, com o resultado de que as preparações das duas proteínas de ligação diferentes serão semelhantes antes do ajuste (Figura 2A) Se uma das proteínas se expressa mal, esse problema pode ser superado purificando essa proteína de mais de um frasco de células.

          A ligação da maioria dos efetores e reguladores de GTPase depende do carregamento de nucleotídeos da isca GTPase, por isso é importante testar se o carregamento foi bem-sucedido. O carregamento pode ser verificado precipitando proteínas de ligação conhecidas de lisados ​​celulares. Proteínas efetoras, como PAK1 ligam-se a GTP-Rac1 e podem ser facilmente precipitadas a partir de lisados ​​e detectadas por Western blotting 8 (Figura 2B) GEFs ligam-se preferencialmente a GTPase livre de nucleotídeos para estabilizar o estado de transição. Como os GEFs são de baixa abundância, geralmente inativos e frequentemente com manchas insuficientes, é melhor superexpressar um GEF ou fragmento de GEF para testar a GTPase livre de nucleotídeos. Freqüentemente usamos a primeira homologia Dbl de Trio, expressa como uma fusão GFP (GFP-TrioD1 9) (Figura 2B), mas qualquer GEF funcionaria. As proteínas que se ligam à GTPase carregada de GDP são mais raras. Recentemente, relatamos RCC2 como uma dessas proteínas 7, ou o carregamento de GDP pode ser validado simplesmente como não se ligando ao GEF nem ao efetor.

          A saída do experimento será um Western blot representando os dois parceiros de ligação marcados com GFP ligados à GTPase. Usando um único anticorpo para detectar ambas as proteínas, as concentrações às quais quantidades semelhantes de ambos os competidores se ligam podem ser determinadas e, portanto, as afinidades relativas inferidas. Neste exemplo, é demonstrada a competição entre o domínio de hélice da proteína de tráfego Rac1, coronina-1C (proteína A de ligação a Rac1) e a proteína sequestrante de Rac1, RCC2 (proteína B de ligação a Rac1) (Figura 3A) Usando um volume constante de hélice coronina-1C (5 & # 181l) e adicionando volumes crescentes de RCC2, podemos ver a partir do blot GFP que o equilíbrio é alcançado em 1,25-2,5 & # 181l de RCC2 (asterisco), demonstrando que RCC2 tem uma afinidade mais forte para Rac1 do que coronina-1C. Ao medir a intensidade das bandas usando Western blotting quantitativo e traçar valores médios para cada competidor, o ponto de equilíbrio pode ser calculado com precisão, identificando os volumes nos quais as curvas se cruzam (Figura 3B).

          Um dos possíveis obstáculos para um ensaio de competição bem-sucedido é se os parceiros de ligação se ligam um ao outro, bem como se ligam a Rac1. No Figura 3A + B demonstramos competição entre RCC2 e o domínio da hélice da coronina-1C, em vez da coronina-1C de comprimento total. A razão para usar a coronina truncada é que a coronina-1C também se liga a RCC2 através do domínio da cauda. Quando a coronina-1C de comprimento total é titulada contra RCC2, a ligação de ambas as proteínas é detectada, devido à formação do complexo ternário, ao invés da competição (Figura 3C) Se houver competição, a ligação de uma proteína aumentará enquanto a outra diminui, e a fusão de GFP total ligada permanecerá constante. Nos casos em que se forma um complexo ternário, é necessário truncar uma das proteínas de ligação à GTPase para que os competidores não interajam mais.


          Figura 1. & # 160 Fluxo de trabalho. Representação esquemática do fluxo de trabalho para determinar a afinidade de proteínas de ligação a GTPase usando ensaios de competição. Clique aqui para ver uma versão ampliada desta figura.


          Figura 2. Validação de proteínas purificadas. (UMA) Proteínas de ligação Rac1 marcadas com GFP purificadas analisadas por Western blot, sondando com anti-GFP para determinar o rendimento relativo das duas proteínas. Este tipo de equalização durante o experimento permite que a concentração das duas proteínas seja ajustada para que correspondam no experimento de ligação. (B) GDP, GTP & # 947S e nenhum GST-Rac1 carregado com nucleotídeo foi incubado com lisado de HEK293T expressando GFP-TrioD1 e proteínas ligadas detectadas por plotagem para PAK1 endógeno ou GFP-TrioD1 superexpresso. Clique aqui para ver uma versão ampliada desta figura.


          Figura 3. Análise de Western blot da ligação relativa à proteína. Exemplo de resultados de ensaios de ligação de competição. (UMA) Rac1 carregado com GDP foi misturado com 5 & # 181l domínio de hélice GFP-coronina-1C e volumes crescentes de GFP-RCC2 foram titulados. Por Western blotting proteínas ligadas para GFP, problemas com detecção diferencial das duas proteínas são evitados e GFP sinal relata a razão molar entre as duas proteínas de fusão. Os asteriscos indicam as taxas de competição em ambos os lados do ponto de equilíbrio. (B) Intensidades de banda de proteínas de fusão GFP ligadas de três experimentos independentes foram medidas por Western blotting quantitativo, usando anticorpos secundários conjugados com fluoróforo e médias plotadas para calcular a quantidade de RCC2 necessária para atingir o equilíbrio. (C) Exemplo de saída de um experimento em que as proteínas de ligação a Rac1 se ligam umas às outras e formam um complexo ternário, em vez de competir. Rac1 carregado com GDP foi misturado com 5 & # 181l GFP-RCC2 e volumes crescentes de GFP-coronina-1C de comprimento total foram titulados. O aumento em GFP-coronina-1C ligada sem perda de GFP-RCC2 ligada indica formação de complexo ternário . Clique aqui para ver uma versão ampliada desta figura.

          Discussão

          Este protocolo descreve um método para comparar as afinidades relativas de pares de pequenas proteínas de ligação a GTPase. As etapas principais são a preparação de proteínas de ligação à GTPase purificadas e o carregamento de nucleotídeos da GTPase. O uso de proteínas de ligação a GTPase com o mesmo tag GFP permite que as concentrações nas quais quantidades semelhantes de cada competidor se ligam sejam determinadas com precisão. O uso de GTPase carregada com nucleotídeo recombinante permite interrogar as propriedades de ligação da GTPase sob condições de atividade específicas. Esta etapa também é a mais sensível, pois os nucleotídeos irão hidrolisar e se desprender da GTPase se as condições do magnésio não forem mantidas com precisão.

          Na célula, o grande número de proteínas de ligação a GTPase combinadas com a rápida renovação de nucleotídeos torna essas vias difíceis de interpretar. A simplicidade deste método em comparar apenas pares de proteínas de ligação e usar condições de carregamento de nucleotídeos cuidadosamente controladas permite que as vias de sinalização sejam elucidadas. No entanto, a maior força do protocolo é também a maior fraqueza, pois é uma simplificação do na Vivo situação. Os ensaios de competição podem ser usados ​​para construir uma hipótese robusta, mas isso deve então ser testado em células por experimentos de knockdown.

          Existem três características que devem ser consideradas ao selecionar as proteínas de ligação a GTPase marcadas com GFP a serem usadas no experimento. Primeiro, as proteínas de fusão devem se expressar bem em células de mamíferos, como HEK293T, pois os ensaios de competição requerem uma quantidade razoável de proteína. Em segundo lugar, deve ser possível purificar a proteína recombinante sem degradação significativa e, quando isso não for possível, a clonagem de um fragmento de ligação à GTPase deve ser considerada. Terceiro, as duas proteínas de ligação a GTPase devem resolver uma da outra em SDS-PAGE para permitir a análise na seção 6.

          Há uma série de advertências potenciais para o experimento que precisam ser consideradas e, possivelmente, abordadas:

          Possível desnaturação de proteínas de ligação a GTPase purificadas durante a etapa de eluição de ácido ou impedimento estérico pela tag GFP. Em nossas mãos, isso não tem sido um problema, mas deve ser testado. As proteínas purificadas podem ser testadas em ensaios funcionais 10. Agora existem kits comerciais para testar a atividade de GEFs ou GAPs sem a necessidade de nucleotídeos marcados com isótopos. Proteínas sequestrantes, por sua natureza protegem GTPases da atividade de GEF ou GAP, então podem ser usadas como inibidores competitivos nos ensaios comerciais de GEF ou GAP, como fizemos em nossa publicação recente 7. A característica relevante das proteínas que trafegam a GTPase é a capacidade de se ligar à GTPase, e isso pode ser testado facilmente em um ensaio pull down. Uma abordagem alternativa para testar a integridade da proteína que é aplicável a todas as proteínas de ligação é titular a proteína eluída dos grânulos GFP-trap com glicina com a mesma proteína removida dos grânulos GFP-trap por clivagem enzimática. O experimento seria analisado através da sondagem da proteína marcada e clivada com GFP com um anticorpo contra a própria proteína. Se a proteína não for danificada pela eluição, o equilíbrio deve ser alcançado na proporção de 1: 1. Esta abordagem também indicaria se a presença da própria tag GFP compromete as propriedades de ligação da proteína candidata, embora isso exija a produção de um construto com um local de clivagem enzimática entre a tag e a proteína de ligação. Se a proteína está comprometida pela tag ou pela etapa de eluição, o problema pode ser resolvido modificando o protocolo para usar um método de purificação alternativo. Em vez de GFP, as proteínas de ligação poderiam ser marcadas com His, purificadas usando Ni-NTA e analisadas usando um anticorpo contra a etiqueta His. A característica importante é que ambas as proteínas de ligação devem compartilhar uma marca comum, embora, se necessário, duas marcas podem ser adicionadas a uma proteína, uma para purificação e outra para detecção.

          O protocolo é projetado para investigar a competição entre as interações com os domínios do switch I / II. Embora a maioria das interações de GTPase sejam mediadas por esse motivo, há algumas exceções, principalmente as interações de GDIs que se ligam à cauda de prenil, além de obscurecer os domínios de switch. Em princípio, o protocolo pode ser adaptado para usar GTPase purificada de células de mamíferos, de modo que a GTPase seja prenilada, no entanto, a presença de múltiplos locais de ligação ou efeitos alostéricos complicam a interpretação dos dados de ligação por competição. Outros problemas associados a tal modificação são que GDIs co-purificam com GTPase de células de mamíferos, comprometendo a pureza das proteínas isoladas e a natureza hidrofóbica dos grupos prenil significa que GTPases preniladas estão associadas a GDI ou membrana lipídica e tais fatores seriam precisam ser considerados no experimento.

          A quantidade de GST-Rac1 usada no ensaio. A proteína de ligação de GTPase constante deve estar em uma concentração maior do que Rac1, ou quando o competidor for adicionado, ele simplesmente se ligará a Rac1 livre. Será imediatamente óbvio se isso aconteceu, pois a ligação do competidor, sem perda da proteína constante, será detectada da mesma forma como quando as duas proteínas competidoras se ligam uma à outra, conforme mostrado em Figura 3B. Como um controle adicional (Etapa 5.3), uma reação de ligação contendo o dobro da quantidade de proteína de ligação constante e nenhuma proteína de ligação variável deve ser incluída (Etapa 5.3). Se o Rac1 no experimento de titulação estiver saturado, dobrar a quantidade de proteína de ligação constante não terá efeito na saída. Os volumes sugeridos no protocolo devem ser adequados, mas a quantidade de Rac1 pode ser facilmente reduzida. Se a ligação do competidor sem perda do parceiro de ligação constante for observada, deve-se tentar reduzir a quantidade de Rac1 antes de tentar mapear os locais de ligação para evitar a formação de complexo ternário.

          Interação não específica de proteínas de ligação a GTPase com o GST ou grânulo, bem como especificamente com Rac1. Este problema seria manifestado pela ligação residual da proteína de ligação a GTPase constante, mesmo quando a proteína de ligação a GTPase variável atingiu um patamar em alta concentração. A identificação desse problema será auxiliada pela realização de experimentos recíprocos onde as proteínas de ligação a GTPase constantes e variáveis ​​são trocadas. Os experimentos recíprocos também melhoram muito a precisão da estimativa do ponto de equilíbrio, portanto, devem ser sempre incluídos. Em casos de ligação não específica, as concentrações relativas nas quais o equilíbrio é alcançado ainda podem ser calculadas comparando a intensidade da banda entre os máximos e mínimos para cada proteína, ou medindo a extensão da ligação não específica usando grânulos de GST como isca, em vez de GST-Rac1.

          Os ensaios pull down usando diferentes condições de carga de nucleotídeos devem ser usados ​​para complementar o ensaio de competição descrito neste protocolo. Determinar a preferência de nucleotídeos dos parceiros é importante tanto para a compreensão dos eventos de competição quanto para a compreensão da via de sinalização na qual a proteína de ligação à GTPase está envolvida. Figura 2B analisamos a ligação de proteínas com preferência estabelecida para GTPase carregada com GTP ou sem nucleotídeos como um meio para validar a carga de nucleotídeos. No entanto, é sensato investigar o efeito da carga de nucleotídeos em cada um dos competidores também. Se os concorrentes hipotéticos mostrarem preferências diferentes, a competição fará menos contribuição para a via de sinalização e, de fato, o turnover de nucleotídeos provavelmente será o mecanismo que direciona a troca das proteínas de ligação.


          Informação sobre o autor

          Endereço atual: Departamento de Física Aplicada, Universidade de Stanford, Stanford, CA, EUA

          Afiliações

          Departamento de Ciências Biológicas, Instituto Avançado de Ciência e Tecnologia da Coreia, Daejeon, República da Coreia

          Daseuli Yu, Hansol Lee, Jongryul Hong, Hyunjin Jung, Byung-Ha Oh e Won Do Heo

          Departamento de Física, Instituto Avançado de Ciência e Tecnologia da Coreia, Daejeon, República da Coreia

          Instituto KAIST para o BioCentury, Instituto Avançado de Ciência e Tecnologia da Coreia, Daejeon, República da Coreia

          Centro de Cognição e Socialidade, Instituto de Ciências Básicas, Daejeon, República da Coréia

          Byung Ouk Park e Won Do Heo

          Você também pode pesquisar este autor no PubMed Google Scholar

          Você também pode pesquisar este autor no PubMed Google Scholar

          Você também pode pesquisar este autor no PubMed Google Scholar

          Você também pode pesquisar este autor no PubMed Google Scholar

          Você também pode pesquisar este autor no PubMed Google Scholar

          Você também pode pesquisar este autor no PubMed Google Scholar

          Você também pode pesquisar este autor no PubMed Google Scholar

          Você também pode pesquisar este autor no PubMed Google Scholar

          Contribuições

          D.Y., B.O.P. e W.D.H. concebeu a ideia e dirigiu o trabalho. D.Y., H.L., B.-H.O., B.O.P. e W.D.H. projetou os experimentos. D.Y., B.O.P., H.L., H.J. e J.H. realizaram os experimentos. Y.J. criou os scripts MATLAB personalizados. D.Y., H.L., B.O.P. e W.D.H. escreveu o manuscrito.

          Autores correspondentes


          Resumo

          Durante a migração ou diferenciação celular, os receptores da superfície celular são expostos simultaneamente a diferentes ligantes. No entanto, muitas vezes não está claro como esses sinais extracelulares são integrados. A neogenina (NEO1) atua como um receptor de orientação atraente quando o ligante Netrin-1 (NET1) se liga, mas medeia a repulsão por meio de ligantes de molécula de orientação repulsiva (RGM). Aqui, mostramos que a integração do sinal ocorre por meio da formação de um complexo ternário NEO1-NET1-RGM, que dispara o silenciamento recíproco da sinalização a jusante. Nossas estruturas NEO1-NET1-RGM revelam uma supermontagem & # x0201ctrímero de trímeros & # x0201d, que existe na membrana celular. A supermontagem & # x000a0formation resulta na inibição do colapso do cone de crescimento mediado por RGMA-NEO1 e migração de neurônios mediada por RGMA ou NET1-NEO1, evitando a formação de complexos RGM-NEO1 compatíveis com sinalização e agrupamento de ectodomínio NEO1 induzido por NET1. Esses resultados ilustram como a ligação simultânea de ligantes com funções opostas, a um único receptor, não leva à competição pela ligação, mas à formação de um supercomplexo que diminui seus resultados funcionais.


          Posso eluir minha proteína marcada com GFP do anticorpo anti-GFP usando um peptídeo? - Biologia

          Observação: seu navegador não oferece suporte aos recursos usados ​​no site da Addgene. Você pode não conseguir criar uma conta ou solicitar plasmids por meio deste site até que atualize seu navegador. Saber mais

          Observação: seu navegador não oferece suporte completo a alguns dos recursos usados ​​no site da Addgene. Se você tiver problemas para registrar, depositar ou fazer pedidos, entre em contato conosco em [email & # 160protected] Saiba mais

          Plasmídeos 101: Caixa de Ferramentas de Nanocorpo Secundário

          Opto-nanocorpos: usando luz para manipular a sinalização celular e a purificação de proteínas

          Não são necessários lamas - nanocorpos sintéticos contra proteínas de membrana

          RANbodies: Reporter Nanobody Fusions

          150 aminoácidos, único. proteína? Sem problemas! Quanto mais nanocorpos são desenvolvidos, haverá mais nanocorpos para se transformar em RANbodies. Mais nanocorpo plasmídeos de expressão podem ser encontrados aqui. Assista a este vídeo para saber mais sobre nanocorpos Adicional. difícil para laboratórios individuais concluírem. o nanocorpo A plataforma RANbody do Sanes Lab supera. RANbodies, Yamagata et al usaram publicado anteriormente nanocorpo sequências que têm como alvo os seguintes antígenos. e a proteína de ligação à actina gelsolina, mas qualquer nanocorpo seqüência pode ser usada para fazer um RANbody. RANbodies. Tags MYC construídas em um andaime GFP. Alguns GFP nanocorpos mancha mal quando marcado com um Monstro de Espaguete.


          Reconhecimentos

          Agradecemos aos membros do laboratório Shivaprasad e ao Prof. K. Veluthambi pelas sugestões. Agradecemos ao Next Generation Genomics, radiação, espectrometria de massa, NMR e instalações de imagem central (CIFF) em NCBS-TIFR, Bangalore. Agradecemos ao Prof. Deepak Nair e seu laboratório pelo vetor pET 22b + modificado e pelas sugestões. Agradecemos ao Prof. Patrick D’Silva pelo By4741 cepa de levedura e Prof. Utpal Nath para o AH109 cepa. Agradecemos ao Dr. Soumita Das pela ajuda com a clonagem parcial de dímero de DNA A.


          RESULTADOS

          As proteínas ribossomais produzidas em excesso não se acumulam e são degradadas pelo sistema ubiquitina-proteassoma

          Para investigar como as proteínas ribossômicas não montadas são reguladas, primeiro confirmamos que as proteínas ribossômicas superexpressas se acumulam mal, medindo os níveis de estado estacionário de várias proteínas ribossômicas marcadas com um domínio composto hexahistidina-hemaglutinina (HA) -proteína A ZZ (doravante referido como HHZ) tag epítopo e transitoriamente expressa a partir do GAL1 promotor em células de tipo selvagem (WT) após uma curta indução com galactose (Figura 1A). Para este e outros experimentos, nós cultivamos células carregando um GAROTA-driven construto em um plasmídeo de 2 μm em meio contendo rafinose e expressão induzida do GAROTA promotor com 2% de galactose por 60–90 min antes de coletarmos as células para análise. O acúmulo de proteínas ribossomais ectopicamente superexpressas foi menor do que o da proteína não ribossômica Hog1, embora todas as proteínas tenham sido expressas a partir do mesmo GAL1 promotor (Figura 1, B, quantificado e mostrado como barras pretas em C). Este resultado estende o suporte para a hipótese de que, embora as proteínas ribossomais sejam geralmente consideradas estáveis, aquelas feitas em excesso são eliminadas por um mecanismo de controle de qualidade desconhecido.

          FIGURA 1: A superexpressão de proteínas ribossomais é ineficiente. (A) Esquema experimental para avaliar a superexpressão de proteínas ribossomais marcadas com HHZ. (B) Os níveis de estado estacionário de proteínas ribossomais são mais baixos do que os da proteína não ribossômica Hog1 quando todas as proteínas são superexpressas transitoriamente do GAROTA promotor. Os lisados ​​celulares totais foram fracionados por SDS-PAGE e imunotransferidos com anticorpo HA. A hexoquinase foi usada como controle interno. (C) Quantificação de proteínas marcadas com HHZ em B. Os níveis relativos da proteína marcada com HHZ foram normalizados para Hog1 usando o software Odyssey. Os valores são a média de dois experimentos independentes e as barras de erro indicam SDs.

          Se a hipótese anterior estiver correta, previmos que a interrupção das cópias cromossômicas de um gene ribossômico transmitido por plasmídeo restauraria o equilíbrio estequiométrico e permitiria o acúmulo da proteína codificada pelo plasmídeo induzida (Figura 2A). Para testar essa previsão e, de forma mais geral, estudar o destino do excesso de proteínas ribossômicas, nos concentramos em Rpl26 porque 1) o nível de estado estacionário de Rpl26a-HHZ expresso ectopicamente em WT era baixo (Figura 1, B e C), 2) rpl26a∆rpl26b∆ mutantes duplos são viáveis ​​(Babiano et al., 2012 Figura Suplementar S1A) e exibiu apenas um defeito modesto na formação de polissoma (Figura Suplementar S1B), e 3) as interações de Rpl26 com 5.8S e 25S rRNAs são caracterizadas (Ben-Shem et al., 2011 Figura Suplementar S1C). Consistente com a hipótese de QC, a proteína fluorescente verde Rpl26a (GFP Figura 2B) ou Rpl26a-FLAG (Figura 2C) expressa a partir do GAL10 o promotor acumulou-se fracamente após a indução transitória em células WT, mas exibiu uma acumulação robusta em rpl26a∆rpl26b∆ células. Além disso, o acúmulo de GAL10-driven Rpl26a-Flag foi inversamente proporcional ao nível de Rpl26-GFP constitutivamente expresso a partir de um locus cromossômico (Figura 2D). Finalmente, a diferença marcante em GAL10- Acumulação Rpl26a-GFP em WT versus rpl26a∆rpl26b∆ células não foi devido a diferenças na expressão de mRNA (Figura 2E).

          FIGURA 2: Rpl26a superexpresso não se acumula. (A) Desenho experimental. Proteínas ribossomais sintetizadas no citoplasma são importadas para o nucléolo para montagem com rRNA. Em células WT, a proteína ribossomal excessiva expressa transitoriamente a partir de um plasmídeo (círculo preto) monta mal com rRNA por causa da competição de sua contraparte endógena preexistente (círculo azul) e, conseqüentemente, torna-se um substrato de um mecanismo de controle de qualidade. Em células mutantes sem genes de proteína ribossômica cromossômica correspondentes ao gene transmitido por plasmídeo, a proteína ribossômica codificada por plasmídeo (círculo preto) é montada com sucesso com rRNA e, portanto, é estabilizada e se acumula. (B, C) Rpl26 endógeno restringe o acúmulo de Rpl26a induzido. WT ou rpl26a∆rpl26b∆ as células foram induzidas com galactose por 1 h para expressar Rpl26a-GFP (B) ou Rpl26a-FLAG (C), e os lisados ​​celulares foram fracionados por SDS-PAGE. A imunotransferência foi realizada usando um anticorpo contra GFP ou FLAG. A hexoquinase foi usada como controle interno. (D) O acúmulo de Rpl26a-FLAG superexpresso é recíproco ao nível de Rpl26-GFP endógeno. As células dos genótipos indicados foram induzidas com galactose por 1 h para expressar Rpl26a-FLAG. O lisado celular foi fracionado por SDS – PAGE e imunotransferido com anticorpos GFP e FLAG. A hexoquinase foi usada como controle interno. (E) A indução pobre de Rpl26a-GFP em WT não é devido ao nível de mRNA reduzido. O RNA total foi extraído de WT e rpl26a∆rpl26b∆ células induzidas ou não com galactose por 1 h, e RPL26A-GFP mRNA foi medido por qPCR. ATO 1 mRNA foi usado para normalização. Os valores são a média de três experimentos independentes e as barras de erro indicam SDs.

          Em seguida, procuramos identificar o mecanismo pelo qual o acúmulo de excesso de proteína ribossômica foi reprimido. Examinamos primeiro se a degradação do excesso de proteínas ribossômicas foi regulada por autofagia de ribossomo (ribofagia), com base na observação de que a degradação seletiva de proteínas ribossômicas após a fome é mediada por autofagia (Kraft et al., 2008). A supressão da superexpressão de Rpl26a-FLAG permaneceu intacta em mutantes defeituosos em autofagia (atg7∆) ou na degradação de proteínas que entram no vacúolo (pep4∆ Figura 3A). Com base nesse resultado, procuramos testar se a UPS estava envolvida. A adição do inibidor de proteassoma bortezomibe (btz) às células que superexpressam as proteínas ribossomais do GAL10 O promotor resultou em um acúmulo mais forte para Rpl26a-FLAG (Figura 3A) e sete das oito outras proteínas ribossomais testadas (Figura 3, B – D). Para testar se a inibição do proteassoma fez com que o Rpl26a-FLAG superexpresso se acumulasse como espécies conjugadas com ubiquitina, purificamos proteínas celulares totais conjugadas com ubiquitina purificadas por afinidade de células induzidas por galactose em resina de domínio UBA de ligação com ubiquitina e as imunotransferimos com anticorpo anti-FLAG , que revelou que as formas de alto peso molecular (MW) de Rpl26a-FLAG se acumularam na presença de inibidor de proteassoma (Figura 4A) e em um pre9∆ mutante sem a subunidade α3 não essencial do proteassoma 20S (Figura 4B), mas não em pre9∆ células que também careciam do endógeno RPL26A e RPL26B (Figura 4C). Para estabelecer inequivocamente que as espécies acumuladas de MW alto eram conjugados de ubiquitina, digerimos eluatos de resina UBA com a enzima desubiquitinante Usp2 antes do immunoblotting, que causou perda progressiva e dependente do tempo das espécies de MW alto e um aumento em Rpl26a-FLAG não modificado (Figura 4D). Finalmente, mostramos que Rpl26a-FLAG imunoprecipitado de células tratadas com btz sob condições desnaturantes reagiu com anticorpo anti-ubiquitina (Figura 4E). Em conjunto, nossos resultados demonstram que o excesso de proteínas ribossômicas é ubiquitinado e, em seguida, degradado pelo proteassoma.

          FIGURA 3: O excesso de proteínas ribossômicas é degradado pelo proteassoma. (A) A degradação do excesso de Rpl26a não é mediada por autofagia, mas por UPS. As células foram induzidas com galactose por 1 h para expressar Rpl26a-FLAG. Para a inibição do proteassoma, as células induzidas 30 min com galactose para expressar Rpl26a-FLAG foram tratadas com 50 μM btz por mais 30 min. À esquerda, o lisado celular foi fracionado por SDS – PAGE e imunotransferido com anticorpo FLAG. Hexokinase foi usada como um controle interno. Certo, os níveis relativos de proteína foram normalizados para –btz usando o software Odyssey. Os valores são a média de dois experimentos independentes e as barras de erro indicam SDs. (B) Esquema experimental para avaliar o acúmulo de proteínas ribossômicas marcadas com HHZ após a inibição do proteassoma. (C) A degradação de proteínas ribossômicas superexpressas transitoriamente é mediada por proteassoma. As células foram tratadas conforme descrito em B e os lisados ​​celulares foram fracionados por SDS-PAGE e imunotransferidos com anticorpo HA. A hexoquinase foi usada como controle interno. (D) Quantificação de proteínas marcadas com HHZ em C. Os níveis de proteínas marcadas com HHZ tratadas com btz relativas foram normalizados para os tratados com simulação usando o software Odyssey. Os valores são a média de dois experimentos independentes e as barras de erro indicam SDs.

          FIGURA 4: O excesso de Rpl26a é ubiquitinado e então degradado pelo proteassoma. (A) O excesso de Rpl26a se acumula nas formas poliubiquitinadas após o tratamento com inibidor de proteassoma. As células induzidas por 45 min com galactose para expressar Rpl26a-FLAG foram tratadas com 50 μM btz por mais 45 min.O extrato celular total foi adsorvido à resina UBA para enriquecer os conjugados de ubiquitina, e a fração ligada foi separada por SDS-PAGE e imunotransferida com anticorpos contra FLAG e ubiquitina. A hexoquinase foi usada como controle interno. (B) O excesso de Rpl26a é poliubiquitinado em um mutante sem a subunidade α3 do proteassoma 20S (pre9∆) O mesmo que A, exceto que pre9∆ células foram usadas e btz foi omitido. (C) Rpl26a induzido em pre9∆rpl26a∆rpl26b∆ não é poliubiquitinado. O mesmo que B, exceto que as células de diferentes genótipos foram usadas como indicado. (D) Usp2 desconjuga a ubiquitina de Rpl26a. As células induzidas por 45 min com galactose para expressar Rpl26a-FLAG foram tratadas com 50 μM btz por mais 45 min. O extrato celular total foi adsorvido à resina UBA e, em seguida, os conjugados de ubiquitina coletados pela resina UBA foram tratados com ou sem Usp2 (1 μM) nos tempos indicados e imunotransferidos com anticorpos contra FLAG e ubiquitina. (E) Células com ou sem o plasmídeo Rpl26a-FLAG e deletadas para o exportador de múltiplas drogas PDR5 foram suplementados com 50 μM btz após 45 min de indução de galactose. Após 45 min adicionais, o extrato celular total preparado sob condições desnaturantes foi incubado com resina FLAG. A fração ligada foi separada por SDS-PAGE e imunotransferida com um anticorpo contra a ubiquitina. A hexoquinase foi usada como controle interno.

          Rpl26 produzido em excesso, em grande parte, não se reúne em ribossomos, mas é ubiquitinado e, em seguida, degradado pelo proteassoma

          Em geral, as proteínas ribossomais são estáveis. Por exemplo, um estudo amplo do proteoma das taxas de degradação de proteínas em Saccharomyces cerevisiae revelou que a mediana t1/2 para 85 proteínas ribossômicas marcadas com TAP é 144 min, que é maior do que o tempo de duplicação (Belle et al., 2006). No entanto, uma proteína ribossômica superproduzida estaria em excesso em relação ao seu rRNA e parceiros proteicos e, portanto, presumivelmente não se reuniria e estaria sujeita à degradação. Para testar esta previsão, usamos gradientes de sacarose para monitorar a montagem de Rpl26a superexpresso transitoriamente em ribossomos em WT e rpl26a∆rpl26b∆ células. Rpl26a-FLAG superexpressado transitoriamente (Figura 5A), Rpl26a-GFP (Figura 5B) ou Rpl26a-HHZ (Figura 5C) eficientemente montado em ribossomos em rpl26a∆rpl26b∆ células, mas não em células que expressam constitutivamente Rpl26 endógeno. Digno de nota, uma fração substancial do Rpl26a marcado com FLAG e GFP induzido que foi detectável foi encontrada na fração não montada de baixo MW em WT, mas não rpl26a∆rpl26b∆ células (Figura 5, A e B). O Rpl26a detectado na região de baixo MW dos gradientes migrou mais rapidamente do que a entrada e montou o Rpl26a no SDS-PAGE, sugerindo que foi processado. Não sabemos a natureza desta modificação, mas presumivelmente o C-terminal permanece intacto porque a proteína processada reage com anticorpos para as tags C-terminal. Presumivelmente, esse processamento ocorre in vitro, porque não observamos uma quantidade substancial de proteína processada em lisados ​​celulares totais preparados sob condições de desnaturação (Figura 2, B – D). É importante que quando as células superexpressaram transitoriamente Rpl26a-FLAG na presença de bortezomibe, houve um aumento tremendo no pool não montado, mas apenas um aumento muito modesto na quantidade incorporada aos ribossomos (Figura 5D). Para determinar qual população de moléculas foi modificada com ubiquitina, o lisado de células que superexpressam Rpl26a-FLAG na presença de bortezomibe foi fracionado em um gradiente de sacarose, e as frações não montadas, 40S / 60S / 80S e polissomo foram agrupadas separadamente e adsorvidas a um Resina UBA que liga os conjugados de poliubiquitina. O mesmo procedimento também foi realizado em paralelo com células contendo vetor vazio. As proteínas ligadas foram então avaliadas por imunotransferência com anticorpo FLAG. Surpreendentemente, as espécies conjugadas com ubiquitina de Rpl26a-FLAG foram encontradas exclusivamente na fração não montada (Figura 5E). Tomados em conjunto, esses dados indicam que as vias de ubiquitinação e degradação são primorosamente específicas para formas não montadas de Rpl26a.

          FIGURA 5: Rpl26 produzido em excesso em grande parte não se reúne em ribossomos, mas é ubiquitinado e então degradado pelo proteassoma. (A, B) Rpl26a produzido em excesso mal se monta em ribossomos. WT e rpl26a∆rpl26b∆ as células foram induzidas com galactose por 1 h para expressar Rpl26a-FLAG (A) ou Rpl26a-GFP (B) e, em seguida, tratadas com cicloheximida por 15 min antes da lise celular para estabilizar polissomos. O lisado celular foi fracionado em um gradiente de sacarose e as frações foram analisadas por SDS-PAGE e imunoblotting com FLAG ou anticorpo GFP. T, extrato total. (C) Rpl26a-HHZ produzido em excesso mal se monta em ribossomos. O mesmo que A, exceto que um genótipo diferente foi usado. Células careciam de ambos naturais RPL26 loci e continha uma cópia integrada de expressos constitutivamente RPL26A-GFP bem como uma cópia induzível, codificada por plasmídeo de RPL26A-HHZ. O immunoblotting foi realizado usando anticorpos contra GFP e HA. T, extrato total. O círculo preto indica Rpl26a-GFP expresso constitutivamente, e o círculo aberto indica Rpl26a-HHZ induzido transitoriamente. Algumas das bandas têm um centro de cor clara que indica as regiões onde o sinal saturou o detector. (D) O Rpl26a não montado acumula-se nas frações não ribossômicas após a inibição do proteassoma. O mesmo que A, exceto que 50 μM btz foram adicionados após os primeiros 30 min de indução de galactose. (E) O Rpl26a poliubiquitinado se acumula em frações não ribossômicas após a inibição do proteassoma. As células WT foram tratadas como em D. As frações do gradiente de sacarose foram agrupadas como mostrado e incubadas com resina UBA para enriquecer os conjugados de ubiquitina, e as frações ligadas foram separadas por SDS-PAGE e imunotransferidas com anticorpo FLAG. A hexoquinase foi usada como controle interno. L.E e S.E, exposição longa e curta, respectivamente.

          O pequeno pool de estado estacionário de Rpl26 em excesso reside principalmente no núcleo e no nucléolo

          A ubiquitinação e degradação observadas de Rpl26a desmontado levantou a questão de onde esse processo ocorreu. Na deficiência de proteassoma pre9∆ células, a maioria das Rpl26a-GFP superexpressas transitoriamente acumuladas no núcleo, conforme avaliado por fracionamento subcelular (Figura 6A). Ambas as espécies não modificadas e conjugadas com ubiquitina foram prontamente detectadas na fração nuclear, indicando que a ubiquitinação do excesso de Rpl26a não montado ocorreu no compartimento nuclear. Um resultado semelhante foi obtido quando a degradação do excesso de Rpl26a-GFP foi bloqueada pela adição do inibidor de proteassoma MG132 (Figura 6B). Além disso, a microscopia de fluorescência revelou que a fluorescência de Rpl26a-GFP estava confinada ao núcleo em ambos WT e pre9∆ células, mas foi mais intenso e mais frequentemente detectado nas células mutantes (Figura 6C), consistente com os dados de fracionamento subcelular na Figura 5, A e B. De interesse, o foco mais intenso de coloração de GFP em células WT coincidiu com o marcador nucleolar Nop56 - proteína fluorescente vermelha monomérica (mRFP Figura 6, C e D). Dada essa evidência de que Rpl26a superproduzido foi provavelmente degradado no núcleo, testamos se sua degradação dependia do controle de qualidade nuclear ubiquitina ligase San1. No entanto, Rpl26a-FLAG superproduzido não se acumulou em san1∆ (Figura Suplementar S2), sugerindo que alguma outra via PQC está envolvida. Digno de nota, em alguns pre9∆ células, o foco da coloração de GFP era distinto do nucléolo (Figura 6C, canto inferior direito, seta branca). Isso sugere que, se a degradação de Rpl26a-GFP for bloqueada pelo pre9∆ mutação, parte da proteína começa a se agregar no nucleoplasma. Estas estruturas podem corresponder ao compartimento de controle de qualidade intranuclear recentemente descrito (Miller et al., 2015). Em contraste com as células WT, GAL10-driven Rpl26a-GFP foi principalmente citosólico em rpl26a∆rpl26b∆ células (Figura 6D), de acordo com a observação de que se montou eficientemente em ribossomos neste genótipo (Figura 5B). Tomados em conjunto, nossos dados sugerem que após a superexpressão, Rpl26 transloca para o núcleo e nucléolo, onde uma pequena fração da proteína superproduzida supera sua contraparte endógena expressa constitutivamente para se reunir em ribossomos. No entanto, a grande maioria permanece desmontada e é conjugada com a ubiquitina e então degradada pelo proteassoma, provavelmente dentro dos compartimentos nucleolar e / ou nuclear.

          FIGURA 6: O pequeno pool de estado estacionário de Rpl26 em excesso reside principalmente no núcleo e no nucléolo. (A) O Rpl26a induzido é enriquecido no núcleo. WT e pre9∆ as células foram induzidas com galactose por 1 h para expressar Rpl26a-GFP. O extrato de células inteiras (WCE) foi fracionado em frações citosólicas (Cy) e nucleares (Nu), que foram analisadas por SDS-PAGE e imunoblotting com um anticorpo contra GFP. Histona H3 e hexoquinase foram utilizadas como marcadores nucleares e citoplasmáticos, respectivamente. (B) O Rpl26a induzido acumula-se no núcleo após o tratamento com inibidor de proteassoma. O mesmo que A, exceto que 50 μM MG132 foi adicionado às células WT após 30 min de indução de galactose. L.E e S.E, exposição longa e curta, respectivamente. (C) Rpl26a induzido em pre9∆ as células se localizam no núcleo / nucléolo. WT e pre9∆ células que abrigam um NOP56-RFP alelo para marcar nucléolos foram induzidos com galactose por 1 h para expressar Rpl26a-GFP e analisados ​​por microscopia de fluorescência. A seta indica o acúmulo de Rpl26a em uma região não nucleolar. Certo, porcentagem de células positivas para GFP. (D) Rpl26a induzido localiza-se no núcleo / nucléolo de WT, mas no citoplasma de rpl26a∆rpl26b∆ células. Células WT que abrigam um NOP56-RFP alelo para marcar nucléolos e rpl26a∆rpl26b∆ as células foram induzidas com galactose por 1 h para expressar Rpl26a-GFP e analisadas por microscopia de fluorescência. Certo, porcentagem de células positivas para GFP.

          Proteínas ribossômicas endógenas recentemente sintetizadas agregam-se em células tratadas com inibidor de proteassoma

          Nossas observações mostrando a degradação mediada por UPS de proteínas ribossômicas superexpressas levantaram a questão de saber se um mecanismo semelhante opera em proteínas ribossômicas endógenas que falham na montagem. Para resolver isso, tratamos as células com um inibidor de proteassoma para bloquear a degradação de quaisquer proteínas ribossômicas que falham na montagem, preparamos frações de lisado celular solúvel e insolúvel e as avaliamos quanto ao seu conteúdo de proteínas ribossômicas. Immunoblotting com vários anticorpos contra proteínas ribossomais (Rpl3 e Rps2) revelou que a inibição do proteassoma não afeta o nível de proteínas ribossômicas nas frações totais e solúveis (Figura 7A, mostrada em total e solúvel). Em contraste, a fração insolúvel de células tratadas com btz continha quantidades significativamente aumentadas de conjugados de ubiquitina e proteínas ribossomais em comparação com as células não tratadas (Figura 7A, mostrada no pellet). Também observamos que proteínas insolúveis acumuladas em pre9∆- e células tratadas com MG132 (Figura Suplementar S3A), sugerindo que esta é uma resposta geral à inibição do proteassoma e não um efeito fora do alvo de btz.

          FIGURA 7: Proteínas ribossomais endógenas recentemente sintetizadas agregam-se em células tratadas com inibidor de proteassoma. (A) Proteínas ribossomais endógenas não montadas agregam-se em células tratadas com inibidor de proteassoma. As células foram tratadas com 50 μM btz por 1 h. O extrato de células inteiras (WCE) foi fracionado em frações solúveis e de pellets, que foram analisadas por SDS-PAGE seguida por coloração com azul de Coomassie (esquerda) ou imunoblotting com anticorpos contra ubiquitina e as proteínas ribossomais indicadas (direita). A hexoquinase foi usada como controle interno. (B) Gráfico de dispersão representando ∆iBAQ da réplica biológica B vs. A para proteínas agregadas em células tratadas com btz. As proteínas são codificadas por cores conforme indicado. As proteínas ribossomais com o maior aumento na fração de pellets após a inibição do proteassoma e Rpl3 e Rps2 são anotadas. Pearson's r é indicado na parte superior do gráfico. BTZ, células tratadas com btz NC, células não tratadas. (C) Análise da ontologia do gene de proteínas agregadas após inibição do proteassoma. Gráfico de violino que representa a distribuição de ∆iBAQ para todas as proteínas (azul) e as duas categorias mais fortemente afetadas: proteínas relacionadas à mitocôndria (verde) e proteínas ribossomais (vermelho). O número entre parênteses abaixo de cada categoria refere-se ao enriquecimento desproporcional para a categoria nos 10% principais das identificações. Este é o Benjamini – Hochberg corrigido p valor de um teste exato de Fisher. (D) As 20 proteínas com o maior aumento na fração do pellet após a inibição do proteassoma. Os valores são a diferença média de iBAQ entre amostras tratadas com btz e não tratadas, com barras de erro indicando SEM. As barras azuis, vermelhas e cinzas correspondem às proteínas 60S, 40S e não ribossomais, respectivamente. (E) Proteínas ribossômicas endógenas recentemente sintetizadas agregam-se em células tratadas com inibidor de proteassoma. O mesmo que A, exceto que as células foram pré-tratadas com 50 μg / ml de cicloheximida (CHX) por 30 min antes da adição de btz.

          Com base nos resultados anteriores, buscamos investigar mais globalmente o efeito da inibição do proteassoma no acúmulo de proteínas ribossômicas insolúveis. Para fazer isso, identificamos proteínas recuperadas de frações de pelotas por espectrometria de massa (MS) e estimamos suas abundâncias por quantificação absoluta sem rótulo com quantificação absoluta baseada em intensidade (iBAQ), conforme descrito anteriormente (Geiger et al., 2012). A comparação de três réplicas biológicas confirmou excelente reprodutibilidade (Figura 7B e Figura Suplementar S3B). Para todas as três réplicas biológicas, uma tendência geral de aumento do acúmulo de proteína na fração insolúvel foi observada após a inibição do proteassoma, consistente com a coloração com azul de Coomassie (Figura 7A). Digno de nota, as proteínas insolúveis com o maior aumento nas células tratadas com btz em relação às células não tratadas (NC) foram as proteínas ribossomais das subunidades grandes e pequenas, incluindo Rpl3 e Rps2 (Figura 7B, Figura Suplementar S3C e Tabela Suplementar S3). A análise da ontologia genética dos dados de MS confirmou que as proteínas ribossomais de ambas as subunidades compreendem a principal classe de agregadores após a inibição do proteassoma (Figura 7C e Figura Suplementar S3D). Isso é claramente evidente a partir de uma tabela de valores de ∆iBAQ para proteínas ribossômicas versus proteínas não ribossômicas (Tabela Suplementar S4) e um gráfico das 20 principais proteínas propensas a agregados na presença de inibidor de proteassoma (Figura 7D).

          Para explorar ainda mais se as proteínas ribossômicas agregadas foram produzidas a partir de proteínas ribossômicas maduras existentes ou foram recentemente sintetizadas, analisamos as frações de pelotas de células tratadas com btz na presença ou ausência do inibidor da síntese de proteínas cicloheximida. A coloração com azul de Coomassie revelou que o tratamento com cicloheximida suprimiu significativamente o acúmulo de proteínas insolúveis em células tratadas com btz (Figura 7E). De importância, o acúmulo dependente de btz de formas insolúveis das proteínas ribossômicas endógenas Rpl3 foi claramente prejudicado quando as células foram co-tratadas com cicloheximida (Figura 7E), sugerindo que a principal fonte de proteínas ribossômicas agregadas era derivada de proteínas recentemente sintetizadas e não de ribossomos preexistentes.


          A miosina A (MyoA) é uma miosina de Classe XIV implicada na mobilidade de deslizamento e na invasão de células e tecidos do hospedeiro por parasitas da malária. MyoA é parte de um complexo proteico associado à membrana denominado glidossomo, que é essencial para a motilidade do parasita e inclui a proteína de interação com o domínio da cauda da miosina de cadeia leve MyoA (MTIP) e várias proteínas associadas ao glidossomo (GAPs). No entanto, a maioria dos estudos do MyoA se concentrou em estágios únicos do ciclo de vida do parasita. Examinamos a expressão de MyoA em todo o Plasmodium berghei ciclo de vida em mamíferos e insetos hospedeiros. Em oocinetes extracelulares, esporozoítos e merozoítos, MyoA estava localizado na periferia do parasita. Nos estágios sexuais, a formação do zigoto e a diferenciação inicial do oocineto precedem a síntese e a deposição de MyoA, o que ocorreu apenas na protuberância em desenvolvimento. No desenvolvimento de estágios sanguíneos assexuados intracelulares, MyoA foi sintetizado em esquizontes maduros e foi localizado na periferia de segmentação de merozoítos, onde permaneceu durante a maturação, saída de merozoítos e invasão de células hospedeiras. Além dos GAPs conhecidos no parasita da malária, o complexo incluía GAP40, uma cadeia leve adicional de miosina denominada cadeia leve essencial (ELC) e vários outros componentes candidatos. Este ELC vinculou a região do pescoço MyoA adjacente ao sítio de ligação de MTIP e ambas as cadeias leves de miosina co-localizadas ao glidossomo. A co-expressão de MyoA com suas duas cadeias leves revelou que a presença de ambas as cadeias leves aumenta a motilidade da actina dependente de MyoA. Em conclusão, estabelecemos um sistema para estudar a interação e função dos três componentes do glidossomo, permitindo a avaliação de inibidores que têm como alvo este complexo motor para bloquear a invasão da célula hospedeira.

          Este trabalho foi apoiado pelo Francis Crick Institute, que recebe seu financiamento principal do Cancer Research UK (Grants FC001097 e FC001119), do Medical Research Council (MRC) (Grants FC001097 e FC001119) e do Wellcome Trust (Grants FC001097 e FC001119 ) por MRC Project Grant G0900278, MR / K011782 / 1 e um pequeno subsídio de financiamento da School of Life Sciences, University of Nottingham (2015) (para RT). Este trabalho também foi apoiado por uma bolsa de pesquisa 2015/13383-EVR e bolsa de pós-doutorado da Faculdade de Medicina e Odontologia da Universidade de Bergen (para J. V.). Os autores declaram não haver conflito de interesses com o conteúdo deste artigo.

          Observe que o JBC não é responsável pelo arquivamento e manutenção de longo prazo deste site ou de qualquer outro site hospedado por terceiros.

          E. Knuepfer, dados não publicados.

          E. Knuepfer e A. A. Holder, dados não publicados.

          Endereço atual: Divisão de Química Biológica e Descoberta de Drogas, Escola de Ciências da Vida, Universidade de Dundee, Dundee DD1 5EH, Escócia, Reino Unido.

          Apoiado por uma bolsa de pesquisa 2015/13383-EVR e uma bolsa de pós-doutorado da Faculdade de Medicina e Odontologia da Universidade de Bergen.

          Endereço atual: Institute for Medical Research, Jalan Pahang, 50588 Kuala Lumpur, Malásia.

          Endereço atual: Instituto de Pesquisa de Patologia Molecular, Campus-Viena-Biocenter 1, 1030 Viena, Áustria.

          Endereço atual: Departamento de Imunologia e Infecção, Faculdade de Doenças Infecciosas e Tropicais, Escola de Higiene e Medicina Tropical de Londres, Londres WC1E 7HT, Reino Unido.


          Assista o vídeo: GFP Purification (Janeiro 2022).