Em formação

10.1: Descobrindo como as populações mudam - Biologia


A teoria da evolução por seleção natural descreve um mecanismo para a mudança das espécies ao longo do tempo. Essa mudança de espécie havia sido sugerida e debatida bem antes de Darwin. A visão de que as espécies eram estáticas e imutáveis ​​baseava-se nos escritos de Platão, mas também havia gregos antigos que expressavam ideias evolutivas.

No século XVIII, ideias sobre a evolução dos animais foram reintroduzidas pelo naturalista Georges-Louis Leclerc, Conde de Buffon e até mesmo pelo avô de Charles Darwin, Erasmus Darwin. Nessa época, também se aceitava que existiam espécies extintas. Ao mesmo tempo, James Hutton, o naturalista escocês, propôs que a mudança geológica ocorria gradualmente pelo acúmulo de pequenas mudanças de processos (por longos períodos de tempo) exatamente como as que acontecem hoje. Isso contrastava com a visão predominante de que a geologia do planeta era uma consequência de eventos catastróficos ocorridos durante um passado relativamente breve. A visão de Hutton foi posteriormente popularizada pelo geólogo Charles Lyell no século XIX. Lyell se tornou um amigo de Darwin e suas ideias foram muito influentes no pensamento de Darwin. Lyell argumentou que a idade avançada da Terra dava mais tempo para a mudança gradual nas espécies, e o processo fornecia uma analogia para a mudança gradual nas espécies.

No início do século XIX, Jean-Baptiste Lamarck publicou um livro que detalhava um mecanismo de mudança evolutiva que agora é conhecido como herança de características adquiridas. Na teoria de Lamarck, as modificações em um indivíduo causadas por seu ambiente, ou o uso ou desuso de uma estrutura durante sua vida, podem ser herdadas por seus descendentes e, assim, provocar mudanças em uma espécie. Embora esse mecanismo de mudança evolutiva, conforme descrito por Lamarck, tenha sido desacreditado, as ideias de Lamarck foram uma influência importante no pensamento evolucionário. A inscrição na estátua de Lamarck que fica nos portões do Jardin des Plantes em Paris o descreve como o “fundador da doutrina da evolução”.

Charles Darwin e a Seleção Natural

O mecanismo real para a evolução foi concebido e descrito de forma independente por dois naturalistas, Charles Darwin e Alfred Russel Wallace, em meados do século XIX. É importante ressaltar que cada um passou um tempo explorando o mundo natural em expedições aos trópicos. De 1831 a 1836, Darwin viajou ao redor do mundo em H.M.S. Beagle, visitando a América do Sul, Austrália e o extremo sul da África. Wallace viajou para o Brasil para coletar insetos na floresta amazônica de 1848 a 1852 e para o arquipélago malaio de 1854 a 1862. A jornada de Darwin, como as viagens posteriores de Wallace no arquipélago malaio, incluiu paradas em várias cadeias de ilhas, a última sendo as Ilhas Galápagos (oeste do Equador). Nessas ilhas, Darwin observou espécies de organismos em diferentes ilhas que eram claramente semelhantes, mas tinham diferenças distintas. Por exemplo, os tentilhões que habitam as Ilhas Galápagos compreendem várias espécies, cada uma com um formato de bico exclusivo (Figura ( PageIndex {1} )). Ele observou que esses tentilhões se assemelhavam muito a outras espécies de tentilhões do continente da América do Sul e que o grupo de espécies nas Galápagos formava uma série graduada de tamanhos e formatos de bico, com diferenças muito pequenas entre os mais semelhantes. Darwin imaginou que as espécies da ilha podem ser todas as espécies modificadas de uma espécie original do continente. Em 1860, ele escreveu: “Vendo essa gradação e diversidade de estrutura em um pequeno grupo de pássaros intimamente relacionados, pode-se realmente imaginar que, de uma escassez original de pássaros neste arquipélago, uma espécie foi retirada e modificada para fins diferentes. ”1

Wallace e Darwin observaram padrões semelhantes em outros organismos e conceberam independentemente um mecanismo para explicar como e por que essas mudanças poderiam ocorrer. Darwin chamou esse mecanismo de seleção natural. A seleção natural, argumentou Darwin, era um resultado inevitável de três princípios que operavam na natureza. Primeiro, as características dos organismos são herdadas ou passadas de pais para filhos. Em segundo lugar, são produzidos mais descendentes do que são capazes de sobreviver; em outras palavras, os recursos para sobrevivência e reprodução são limitados. A capacidade de reprodução em todos os organismos supera a disponibilidade de recursos para sustentar seu número. Assim, há uma competição por esses recursos a cada geração. O entendimento de Darwin e Wallace sobre esse princípio veio da leitura de um ensaio do economista Thomas Malthus, que discutiu esse princípio em relação às populações humanas. Terceiro, os descendentes variam entre si em relação às suas características e essas variações são herdadas. Destes três princípios, Darwin e Wallace raciocinaram que os filhos com características herdadas que os permitem competir melhor por recursos limitados sobreviverão e terão mais filhos do que os indivíduos com variações que são menos capazes de competir. Como as características são herdadas, essas características serão melhor representadas na próxima geração. Isso levará a mudanças nas populações ao longo das gerações, em um processo que Darwin chamou de "descendência com modificação".

Artigos de Darwin e Wallace (Figure ( PageIndex {2} )) apresentando a ideia de seleção natural foram lidos juntos em 1858 antes da Linnaean Society em Londres. O livro de Darwin no ano seguinte, Na origem das espécies, foi publicado, que descreveu em detalhes consideráveis ​​seus argumentos para a evolução por seleção natural.

Demonstrações de evolução por seleção natural podem ser demoradas. Uma das melhores demonstrações foi nos próprios pássaros que ajudaram a inspirar a teoria, os tentilhões de Galápagos. Peter e Rosemary Grant e seus colegas estudaram as populações de tentilhões de Galápagos todos os anos desde 1976 e forneceram importantes demonstrações da operação da seleção natural. Os Grants encontraram mudanças de uma geração para a outra nas formas dos bicos dos tentilhões de solo médio na ilha de Daphne Major, em Galápagos. O tentilhão de solo médio se alimenta de sementes. As aves herdaram variações no formato do bico, com alguns indivíduos tendo bico largo e profundo e outros tendo bico mais fino. Aves de bico grande se alimentam com mais eficiência de sementes grandes e duras, enquanto as aves de bico pequeno se alimentam de maneira mais eficiente de sementes pequenas e macias. Durante 1977, um período de seca alterou a vegetação da ilha. Após esse período, o número de sementes diminuiu drasticamente: o declínio nas sementes pequenas e macias foi maior do que o declínio nas sementes grandes e duras. Os pássaros de bico grande conseguiram sobreviver melhor do que os de bico pequeno no ano seguinte. No ano seguinte à seca, quando os Grants mediram os tamanhos dos bicos na população muito reduzida, eles descobriram que o tamanho médio da conta era maior (Figura ( PageIndex {3} )). Esta foi uma evidência clara da seleção natural (diferenças na sobrevivência) do tamanho do bico causado pela disponibilidade de sementes. Os Grants haviam estudado a herança dos tamanhos de bico e sabiam que os pássaros de bico grande sobreviventes tenderiam a produzir descendentes com bico maior, de modo que a seleção levaria à evolução do tamanho do bico. Estudos subsequentes realizados pelas concessões demonstraram a seleção e a evolução do tamanho do bico nesta espécie em resposta às mudanças nas condições da ilha. A evolução ocorreu tanto para contas maiores, como neste caso, quanto para contas menores, quando as sementes grandes se tornaram raras.

Variação e Adaptação

A seleção natural só pode ocorrer se houver variação, ou diferenças, entre os indivíduos de uma população. É importante ressaltar que essas diferenças devem ter alguma base genética; caso contrário, a seleção não levará à mudança na próxima geração. Isso é crítico porque a variação entre os indivíduos pode ser causada por razões não genéticas, como um indivíduo ser mais alto por causa de uma melhor nutrição, em vez de genes diferentes.

A diversidade genética de uma população provém de duas fontes principais: mutação e reprodução sexuada. A mutação, uma mudança no DNA, é a fonte final de novos alelos ou novas variações genéticas em qualquer população. Um indivíduo que possui um gene mutado pode ter uma característica diferente de outros indivíduos da população. No entanto, nem sempre é esse o caso. Uma mutação pode ter um de três resultados na aparência dos organismos (ou fenótipo):

  • Uma mutação pode afetar o fenótipo do organismo de uma forma que reduz a aptidão - menor probabilidade de sobrevivência, resultando em menos descendentes.
  • Uma mutação pode produzir um fenótipo com um efeito benéfico na aptidão.
  • Muitas mutações, chamadas mutações neutras, não terão efeito na aptidão.

As mutações também podem ter uma ampla gama de tamanhos de efeito na aptidão do organismo que as expressa em seu fenótipo, de um efeito pequeno a um grande efeito. A reprodução sexual e o crossing over na meiose também levam à diversidade genética: quando dois pais se reproduzem, combinações únicas de alelos se reúnem para produzir genótipos únicos e, portanto, fenótipos em cada um dos descendentes.

Uma característica hereditária que auxilia na sobrevivência e reprodução de um organismo em seu ambiente atual é chamada de adaptação. Uma adaptação é uma “combinação” do organismo com o meio ambiente. A adaptação a um ambiente ocorre quando uma mudança na faixa de variação genética ocorre ao longo do tempo que aumenta ou mantém a correspondência da população com seu ambiente. As variações nos bicos dos tentilhões mudaram de geração em geração, proporcionando adaptação à disponibilidade de alimentos.

Se uma característica é ou não favorável depende do ambiente no momento. As mesmas características nem sempre têm o mesmo benefício ou desvantagem relativa porque as condições ambientais podem mudar. Por exemplo, tentilhões com contas grandes foram beneficiados em um clima, enquanto contas pequenas eram uma desvantagem; em um clima diferente, o relacionamento se inverteu.

Padrões de Evolução

A evolução das espécies resultou em uma enorme variação na forma e na função. Quando duas espécies evoluem em direções diferentes a partir de um ponto comum, isso é chamado de evolução divergente. Essa evolução divergente pode ser vista nas formas dos órgãos reprodutivos das plantas com flores, que compartilham as mesmas anatomias básicas; no entanto, eles podem parecer muito diferentes como resultado da seleção em diferentes ambientes físicos e da adaptação a diferentes tipos de polinizadores (Figura ( PageIndex {4} )).

Em outros casos, fenótipos semelhantes evoluem independentemente em espécies distantemente relacionadas. Por exemplo, o vôo evoluiu tanto em morcegos quanto em insetos, e ambos têm estruturas que chamamos de asas, que são adaptações ao vôo. As asas de morcegos e insetos, no entanto, evoluíram a partir de estruturas originais muito diferentes. Quando estruturas semelhantes surgem por meio da evolução independentemente em espécies diferentes, é chamado de evolução convergente. As asas de morcegos e insetos são chamadas de estruturas análogas; eles são semelhantes em função e aparência, mas não compartilham uma origem em um ancestral comum. Em vez disso, eles evoluíram independentemente nas duas linhagens. As asas de um colibri e de uma avestruz são estruturas homólogas, o que significa que compartilham semelhanças (apesar de suas diferenças serem decorrentes de divergências evolutivas). As asas de colibris e avestruzes não evoluíram independentemente na linhagem do beija-flor e na linhagem do avestruz - elas descendem de um ancestral comum com asas.

A Síntese Moderna

Os mecanismos de herança, genética, não foram compreendidos na época em que Darwin e Wallace estavam desenvolvendo sua ideia de seleção natural. Essa falta de compreensão foi um obstáculo para a compreensão de muitos aspectos da evolução. Na verdade, a herança combinada era a teoria genética predominante (e incorreta) da época, o que tornava difícil entender como a seleção natural poderia operar. Darwin e Wallace desconheciam o trabalho genético do monge austríaco Gregor Mendel, publicado em 1866, não muito depois da publicação de Na origem das espécies. O trabalho de Mendel foi redescoberto no início do século XX, quando os geneticistas estavam rapidamente chegando a uma compreensão dos fundamentos da herança. Inicialmente, a natureza particulada recém-descoberta dos genes tornou difícil para os biólogos entender como a evolução gradual poderia ocorrer. Mas, nas décadas seguintes, a genética e a evolução foram integradas no que ficou conhecido como a síntese moderna - a compreensão coerente da relação entre seleção natural e genética que tomou forma na década de 1940 e é geralmente aceita hoje. Em suma, a síntese moderna descreve como as pressões evolutivas, como a seleção natural, podem afetar a composição genética de uma população e, por sua vez, como isso pode resultar na evolução gradual das populações e espécies. A teoria também conecta essa mudança gradual de uma população ao longo do tempo, chamada de microevolução, com os processos que deram origem a novas espécies e grupos taxonômicos superiores com caracteres amplamente divergentes, chamados de macroevolução.

Genética de População

Lembre-se de que um gene para um determinado personagem pode ter várias variantes, ou alelos, que codificam para diferentes características associadas a esse personagem. Por exemplo, no sistema de tipo sanguíneo ABO em humanos, três alelos determinam a proteína específica do tipo sanguíneo na superfície dos glóbulos vermelhos. Cada indivíduo em uma população de organismos diplóides pode carregar apenas dois alelos para um determinado gene, mas mais de dois podem estar presentes nos indivíduos que constituem a população. Mendel seguiu os alelos à medida que eram herdados de pais para filhos. No início do século XX, os biólogos começaram a estudar o que acontece com todos os alelos em uma população em um campo de estudo conhecido como genética populacional.

Até agora, definimos evolução como uma mudança nas características de uma população de organismos, mas por trás dessa mudança fenotípica está a mudança genética. Em termos de genética populacional, evolução é definida como uma mudança na frequência de um alelo em uma população. Usando o sistema ABO como exemplo, a frequência de um dos alelos, euUMA, é o número de cópias desse alelo dividido por todas as cópias do gene ABO na população. Por exemplo, um estudo na Jordânia encontrou uma frequência de euUMA para ser 26,1 por cento.2 o euB, eu0 os alelos representaram 13,4 por cento e 60,5 por cento dos alelos, respectivamente, e todas as frequências somam 100 por cento. Uma mudança nesta frequência ao longo do tempo constituiria uma evolução na população.

Existem várias maneiras pelas quais as frequências alélicas de uma população podem mudar. Uma dessas maneiras é a seleção natural. Se um determinado alelo confere um fenótipo que permite a um indivíduo ter mais descendentes que sobrevivem e se reproduzem, esse alelo, em virtude de ser herdado por esses descendentes, estará em maior frequência na próxima geração. Como as frequências dos alelos sempre somam 100 por cento, um aumento na frequência de um alelo sempre significa uma diminuição correspondente em um ou mais dos outros alelos. Alelos altamente benéficos podem, ao longo de algumas gerações, se tornarem “fixos” dessa forma, o que significa que cada indivíduo da população carregará o alelo. Da mesma forma, alelos prejudiciais podem ser eliminados rapidamente do pool genético, a soma de todos os alelos em uma população. Parte do estudo da genética populacional está monitorando como as forças seletivas mudam as frequências dos alelos em uma população ao longo do tempo, o que pode dar aos cientistas pistas sobre as forças seletivas que podem estar operando em uma determinada população. Os estudos das mudanças na coloração das asas na mariposa salpicada de branco manchado para escuro em resposta a troncos de árvores cobertos de fuligem e depois de volta ao branco manchado quando as fábricas pararam de produzir tanta fuligem é um exemplo clássico de estudo da evolução em populações naturais (Figura ( PageIndex {5} )).

No início do século XX, o matemático inglês Godfrey Hardy e o médico alemão Wilhelm Weinberg forneceram, independentemente, uma explicação para um conceito um tanto contra-intuitivo. A explicação original de Hardy foi em resposta a um mal-entendido sobre por que um alelo "dominante", que mascara um alelo recessivo, não deve aumentar em frequência em uma população até que elimine todos os outros alelos. A pergunta resultou de uma confusão comum sobre o que significa "dominante", mas obrigou Hardy, que nem era biólogo, a apontar que, se não houver fatores que afetem a frequência de um alelo, essas frequências permanecerão constantes de uma geração para a próximo. Esse princípio agora é conhecido como equilíbrio de Hardy-Weinberg. A teoria afirma que as frequências de alelos e genótipos de uma população são inerentemente estáveis ​​- a menos que algum tipo de força evolutiva esteja agindo sobre a população, a população carregaria os mesmos alelos nas mesmas proporções geração após geração. Os indivíduos, como um todo, pareceriam essencialmente os mesmos e isso não estaria relacionado ao fato de os alelos serem dominantes ou recessivos. As quatro forças evolutivas mais importantes, que irão perturbar o equilíbrio, são a seleção natural, a mutação, a deriva genética e a migração para dentro ou para fora de uma população. Um quinto fator, o acasalamento não aleatório, também perturbará o equilíbrio de Hardy-Weinberg, mas apenas mudando as frequências dos genótipos, não as frequências dos alelos. No acasalamento não aleatório, os indivíduos são mais propensos a acasalar com indivíduos semelhantes (ou diferentes) do que aleatoriamente. Visto que o acasalamento não aleatório não muda as frequências dos alelos, ele não causa a evolução diretamente. A seleção natural foi descrita. A mutação cria um alelo a partir de outro e altera a frequência de um alelo em uma quantidade pequena, mas contínua, a cada geração. Cada alelo é gerado por uma taxa de mutação baixa e constante que aumentará lentamente a frequência do alelo em uma população se nenhuma outra força atuar no alelo. Se a seleção natural atuar contra o alelo, ele será removido da população a uma taxa baixa, levando a uma frequência que resulta de um equilíbrio entre a seleção e a mutação. Esta é uma das razões pelas quais as doenças genéticas permanecem na população humana em frequências muito baixas. Se o alelo for favorecido pela seleção, sua frequência aumentará. A deriva genética causa mudanças aleatórias nas frequências dos alelos quando as populações são pequenas. A deriva genética muitas vezes pode ser importante na evolução, conforme discutido na próxima seção. Finalmente, se duas populações de uma espécie têm frequências alélicas diferentes, a migração de indivíduos entre elas causará mudanças de frequência em ambas as populações. Acontece que não há população na qual um ou mais desses processos não estejam operando, então as populações estão sempre evoluindo, e o equilíbrio de Hardy-Weinberg nunca será exatamente observado. No entanto, o princípio de Hardy-Weinberg dá aos cientistas uma expectativa de base para frequências de alelos em uma população não evolutiva com a qual eles podem comparar populações em evolução e, assim, inferir quais forças evolutivas podem estar em jogo. A população está evoluindo se as frequências de alelos ou genótipos se desviarem do valor esperado do princípio de Hardy-Weinberg.

Darwin identificou um caso especial de seleção natural que chamou de seleção sexual. A seleção sexual afeta a capacidade de um indivíduo de acasalar e, assim, produzir descendentes, e leva à evolução de traços dramáticos que muitas vezes parecem mal-adaptativos em termos de sobrevivência, mas persistem porque dão a seus proprietários maior sucesso reprodutivo. A seleção sexual ocorre de duas maneiras: por meio da competição macho-macho por parceiras e por meio da seleção feminina de parceiras. A competição homem-homem assume a forma de conflitos entre homens, que muitas vezes são ritualizados, mas também podem representar ameaças significativas à sobrevivência de um homem. Às vezes, a competição é por território, com as fêmeas mais propensas a acasalar com machos com territórios de melhor qualidade. A escolha feminina ocorre quando as fêmeas escolhem um macho com base em uma característica particular, como as cores das penas, a execução de uma dança de acasalamento ou a construção de uma estrutura elaborada. Em alguns casos, a competição macho-macho e a escolha fêmea combinam-se no processo de acasalamento. Em cada um desses casos, as características selecionadas, como habilidade de luta ou cor e comprimento das penas, aumentam nos machos. Em geral, pensa-se que a seleção sexual pode prosseguir até um ponto em que a seleção natural contra o aprimoramento posterior de um personagem impede sua evolução porque afeta negativamente a capacidade do homem de sobreviver. Por exemplo, penas coloridas ou uma exibição elaborada tornam o macho mais óbvio para os predadores.

Resumo

A evolução por seleção natural surge de três condições: os indivíduos dentro de uma espécie variam, algumas dessas variações são hereditárias e os organismos têm mais descendentes do que os recursos podem suportar. A consequência é que indivíduos com variações relativamente vantajosas terão mais probabilidade de sobreviver e apresentar taxas reprodutivas mais altas do que indivíduos com características diferentes. As características vantajosas serão transmitidas aos descendentes em maior proporção. Assim, a característica terá maior representação nas gerações seguintes e subsequentes, levando à mudança genética na população.

A síntese moderna da teoria da evolução surgiu da reconciliação dos pensamentos de Darwin, Wallace e Mendel sobre evolução e hereditariedade. A genética populacional é uma estrutura teórica para descrever a mudança evolutiva nas populações por meio da mudança nas frequências dos alelos. A genética populacional define a evolução como uma mudança na frequência dos alelos ao longo das gerações. Na ausência de forças evolutivas, as frequências dos alelos não mudarão na população; isso é conhecido como princípio de equilíbrio de Hardy-Weinberg. No entanto, em todas as populações, mutação, seleção natural, deriva genética e migração agem para alterar as frequências dos alelos.

Múltipla escolha

Que conceito científico Charles Darwin e Alfred Wallace descobriram independentemente?

A. mutação
B. seleção natural
C. overbreeding
D. reprodução sexuada

B

Qual das seguintes situações levará à seleção natural?

A. As sementes de duas plantas pousam perto uma da outra e uma fica maior que a outra.
B. Dois tipos de peixe comem o mesmo tipo de alimento, e um é mais capaz de coletar alimentos do que o outro.
C. Os leões machos competem pelo direito de acasalar com as fêmeas, com apenas um vencedor possível.
D. todas as opções acima

D

Qual é a diferença entre micro e macroevolução?

A. A microevolução descreve a evolução de pequenos organismos, como insetos, enquanto a macroevolução descreve a evolução de grandes organismos, como pessoas e elefantes.
B. Microevolução descreve a evolução de entidades microscópicas, como moléculas e proteínas, enquanto macroevolução descreve a evolução de organismos inteiros.
C. A microevolução descreve a evolução das populações, enquanto a macroevolução descreve o surgimento de novas espécies durante longos períodos de tempo.
D. A microevolução descreve a evolução dos organismos ao longo de suas vidas, enquanto a macroevolução descreve a evolução dos organismos ao longo de várias gerações.

C

A genética populacional é o estudo de ________.

A. como as frequências de alelos em uma população mudam ao longo do tempo
B. populações de células em um indivíduo
C. a taxa de crescimento populacional
D. como os genes afetam o desenvolvimento embriológico

UMA

Resposta livre

Se uma pessoa espalha um punhado de sementes de plantas de uma espécie em uma área, como a seleção natural funcionaria nessa situação?

As plantas que podem usar melhor os recursos da área, inclusive competindo com outros indivíduos por esses recursos, irão produzir mais sementes elas mesmas e as características que lhes permitiram usar melhor os recursos aumentarão na população da próxima geração.

Explique o princípio de equilíbrio de Hardy-Weinberg.

O princípio de equilíbrio de Hardy-Weinberg afirma que as frequências de alelos de uma população são inerentemente estáveis. A menos que uma força evolucionária esteja agindo sobre a população, a população carregaria os mesmos genes nas mesmas frequências, geração após geração, e os indivíduos, como um todo, pareceriam essencialmente os mesmos.

Notas de rodapé

  1. 1 Charles Darwin, Jornal de pesquisas em história natural e geologia dos países visitados durante a viagem de H.M.S. Beagle ao redor do mundo, sob o comando do capitão Fitz Roy, R.N, 2o. ed. (Londres: John Murray, 1860), http://www.archive.org/details/journalofresea00darw.
  2. 2 Sahar S. Hanania, Dhia S. Hassawi e Nidal M. Irshaid, "Allele Frequency and Molecular Genotypes of ABO Blood Group System in a Jordanian Population", Journal of Medical Sciences 7 (2007): 51-58, doi: 10.3923 / jms.2007.51.58

Glossário

adaptação
um traço hereditário ou comportamento em um organismo que auxilia em sua sobrevivência em seu ambiente atual
estrutura análoga
uma estrutura que é semelhante devido à evolução em resposta a pressões de seleção semelhantes, resultando em evolução convergente, não semelhante devido à descendência de um ancestral comum
evolução convergente
uma evolução que resulta em formas semelhantes em diferentes espécies
evolução divergente
uma evolução que resulta em diferentes formas em duas espécies com um ancestral comum
pool genético
todos os alelos carregados por todos os indivíduos da população
deriva genética
o efeito do acaso no pool genético de uma população
estrutura homóloga
uma estrutura que é semelhante devido à descendência de um ancestral comum
herança de características adquiridas
uma frase que descreve o mecanismo de evolução proposto por Lamarck no qual características adquiridas pelos indivíduos através do uso ou desuso podem ser passadas para seus descendentes, levando assim a uma mudança evolutiva na população.
macroevolução
uma escala mais ampla de mudanças evolutivas vistas ao longo do tempo paleontológico
microevolução
as mudanças na estrutura genética de uma população (ou seja, frequência de alelo)
migração
o movimento de indivíduos de uma população para um novo local; na genética populacional, refere-se ao movimento de indivíduos e seus alelos de uma população para outra, potencialmente alterando as frequências dos alelos na velha e na nova população
síntese moderna
o paradigma evolucionário abrangente que tomou forma na década de 1940 e é geralmente aceito hoje
seleção natural
a maior sobrevivência relativa e reprodução de indivíduos em uma população que tem características hereditárias favoráveis, levando à mudança evolutiva
genética populacional
o estudo de como as forças seletivas mudam as frequências dos alelos em uma população ao longo do tempo

10.1: Descobrindo como as populações mudam - Biologia

Ao final desta seção, você será capaz de:

  • Definir a genética populacional e descrever como a genética populacional é usada no estudo da evolução das populações
  • Defina o princípio de Hardy-Weinberg e discuta sua importância

Os mecanismos de herança, ou genética, não eram compreendidos na época em que Charles Darwin e Alfred Russel Wallace estavam desenvolvendo sua ideia de seleção natural. Essa falta de compreensão foi um obstáculo para a compreensão de muitos aspectos da evolução. Na verdade, a teoria genética predominante (e incorreta) da época, a herança mista, tornava difícil entender como a seleção natural poderia operar. Darwin e Wallace desconheciam o trabalho de genética do monge austríaco Gregor Mendel, publicado em 1866, não muito depois da publicação do livro de Darwin & # 8217, Na origem das espécies. O trabalho de Mendel foi redescoberto no início do século XX, quando os geneticistas estavam rapidamente chegando a uma compreensão dos fundamentos da herança. Inicialmente, a natureza particulada recém-descoberta dos genes tornou difícil para os biólogos entender como a evolução gradual poderia ocorrer. Mas, nas décadas seguintes, a genética e a evolução foram integradas no que ficou conhecido como a síntese moderna - a compreensão coerente da relação entre seleção natural e genética que tomou forma na década de 1940 e é geralmente aceita hoje. Em suma, a síntese moderna descreve como os processos evolutivos, como a seleção natural, podem afetar a composição genética de uma população e, por sua vez, como isso pode resultar na evolução gradual das populações e espécies. A teoria também conecta essa mudança de uma população ao longo do tempo, chamada de microevolução, com os processos que deram origem a novas espécies e grupos taxonômicos superiores com caracteres amplamente divergentes, chamados de macroevolução.

Conexão do dia a dia

Todo outono, a mídia começa a reportar sobre vacinações contra gripe e surtos potenciais. Cientistas, especialistas em saúde e instituições determinam recomendações para diferentes partes da população, prevêem a produção ideal e cronogramas de inoculação, criam vacinas e montam clínicas para fornecer inoculações. Você pode pensar na vacina anual contra a gripe como uma grande campanha publicitária da mídia, uma importante proteção à saúde ou apenas uma picada brevemente desconfortável em seu braço. Mas você pensa nisso em termos de evolução?

O hype da mídia de vacinas anuais contra a gripe é cientificamente fundamentado em nosso entendimento da evolução. A cada ano, cientistas de todo o mundo se esforçam para prever as cepas de gripe que, segundo eles, serão mais disseminadas e prejudiciais no próximo ano. Esse conhecimento se baseia em como as cepas de gripe evoluíram ao longo do tempo e nas últimas temporadas de gripe. Os cientistas então trabalham para criar a vacina mais eficaz para combater essas cepas selecionadas. Centenas de milhões de doses são produzidas em um curto período para fornecer vacinas às populações-chave no momento ideal.

Como os vírus, como a gripe, evoluem muito rapidamente (especialmente no tempo evolutivo), isso representa um grande desafio. Os vírus se transformam e se replicam em um ritmo rápido, então a vacina desenvolvida para proteger contra a cepa de gripe do ano passado pode não fornecer a proteção necessária contra a cepa do ano que vem. A evolução desses vírus significa adaptações contínuas para garantir a sobrevivência, incluindo adaptações para sobreviver a vacinas anteriores.


O novo sequenciamento do genoma completo revela a origem da Brassica napus e os loci genéticos envolvidos no seu melhoramento

Brassica napus (2n = 4x = 38, AACC) é uma importante cultura alopoliplóide derivada de cruzamentos interespecíficos entre Brassica rapa (2n = 2x = 20, AA) e Brassica oleracea (2n = 2x = 18, CC). No entanto, nenhuma população de B. napus verdadeiramente selvagem é conhecida e sua origem e os processos de melhoramento permanecem obscuros. Aqui, re-sequenciamos 588 acessos de B. napus. Nós descobrimos que o subgenoma A pode evoluir do ancestral do nabo europeu e o subgenoma C pode evoluir do ancestral comum da couve-rábano, couve-flor, brócolis e couve chinesa. Além disso, a oleaginosa de inverno pode ser a forma original de B. napus. A seleção específica do subgenoma de genes de resposta de defesa contribuiu para a adaptação ambiental após a formação da espécie, enquanto a seleção subgenômica assimétrica levou à mudança do ecótipo. Ao integrar estudos de associação de todo o genoma, sinais de seleção e análises de transcriptoma, identificamos genes associados a melhor tolerância ao estresse, conteúdo de óleo, qualidade de semente e melhoria de ecótipo. Eles são candidatos para posterior caracterização funcional e melhoramento genético de B. napus.

Declaração de conflito de interesse

Os autores declaram não haver interesses conflitantes.

Bonecos

Distribuição geográfica e estrutura populacional ...

Distribuição geográfica e estrutura populacional de B. napus acessões. uma Distribuição geográfica de ...

Estrutura populacional de 588 B. ...

Estrutura populacional de 588 B. napus acessos e 199 de B. rapa acessões. ...

Estrutura populacional de 588 B. ...

Estrutura populacional de 588 B. napus acessos e 119 de B. oleracea acessões. ...

Varredura de todo o genoma e anotações de ...

Genome-wide scanning and annotations of selected regions during the SSI of B. napus…

Overview of flowering-time regulation under…

Overview of flowering-time regulation under the selection of the ecotype improvement of B.…


Resumo

Common genetic variants of mitochondrial DNA (mtDNA) increase the risk of developing several of the major health issues facing the western world, including neurodegenerative diseases. In this Review, we consider how these mtDNA variants arose and how they spread from their origin on one single molecule in a single cell to be present at high levels throughout a specific organ and, ultimately, to contribute to the population risk of common age-related disorders. mtDNA persists in all aerobic eukaryotes, despite a high substitution rate, clonal propagation and little evidence of recombination. Recent studies have found that de novo mtDNA mutations are suppressed in the female germ line despite this, mtDNA heteroplasmy is remarkably common. The demonstration of a mammalian mtDNA genetic bottleneck explains how new germline variants can increase to high levels within a generation, and the ultimate fixation of less-severe mutations that escape germline selection explains how they can contribute to the risk of late-onset disorders.


Challenges and emerging systems biology approaches to discover how the human gut microbiome impact host physiology

Research in the human gut microbiome has bloomed with advances in next generation sequencing (NGS) and other high-throughput molecular profiling technologies. This has enabled the generation of multi-omics datasets which holds promises for big data–enabled knowledge acquisition in the form of understanding the normal physiological and pathological involvement of gut microbiomes. Ample evidence suggests that distinct microbial compositions in the human gut are associated with different diseases. However, the biological mechanisms underlying these associations are often unclear. There is a need to move beyond statistical associations to discover how changes in the gut microbiota mechanistically affect host physiology and disease development. This review summarises state-of-the-art big data and systems biology approaches for mechanism discovery.

Esta é uma prévia do conteúdo da assinatura, acesso através de sua instituição.


Materiais e métodos

Preparation of total RNA

Total RNA was extracted using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) from mixed-stage (including embryos, every instar larvae and adults) Locusta migratoria that we fed in our lab. We collected 0-1, 2-3, 4-5, 6-7, 8-9, 10-11, 12-13 and 14-15 day-old embryos cultured at 30°C in clean sand with relative humidity. For the larvae, we collected the whole body except the midgut and pooled them to ensure every instar was present in the sample. We chose to collect adults at eclosion, sexual maturation, post-spawning, and elderly stages separately and then pooled them together. Total RNA was extracted according to the manufacturer's protocol. We examined the quality of RNA using an Agilent 2100 Bioanalyzer.

Small RNA library construction and high-throughput sequencing

RNA fragments 14-30 bases long were isolated from total RNA by Novex 15% TBE-Urea gel (Invitrogen). Then, a 5' adaptor (Illumina, San Diego, CA, USA) was ligated to purified small RNAs followed by purification of ligation products on Novex 15% TBE-Urea gel. The 5' ligation products were then ligated to a 3' adaptor (Illumina) and products with 5' and 3' adaptors were purified from Novex 10% TBE-Urea gel (Invitrogen). Subsequently, these ligation products were reverse transcribed followed by PCR amplification. The amplification products were excised from 6% TBE-Urea gel (Invitrogen). The purified DNA fragments were used for clustering and sequencing by Illumina Genome Analyzer at the Beijing Genomics Institute, Shenzhen.

Discovery of conserved locust miRNA families

We discarded bad reads that were the result of incorrect sequencing or were the reads of adaptor contamination that were not ligated to any other sequences. We clustered the remaining reads based on sequence similarity and the dominant reads were analyzed as follows: the reads were analyzed by BLAST against EST database [13] and FlyBase [17] to discard rRNA, tRNA and snRNA. Subsequently, the remaining sequences were analyzed by BLAST search against miRBase v11.0 [18]. Sequences in our libraries with identical or related (four or fewer nucleotide substitutions) sequences from D. melanogaster or other insects (mosquito, silkworm, and honeybee) were identified as conserved miRNAs.

Discovery of non-conserved locust miRNA families

We first looked at the high-throughput sequencing data of small RNAs in other species, including C. elegans, D. melanogaster, e Arabidopsis [16, 20, 38], and found that star sequences of most miRNAs were also present in the small RNA libraries, and that the miRNA-miRNA* duplexes exhibited 1 or 2 nucleotide 3' overhangs, a characteristic of RNase III enzyme cleavage (Figure 3a). The 5' end sequences of miRNA clusters showed obvious consistency compared with other small RNAs and degradation fragments (Figure 3a). Thus, if a sequence in the locust small RNA libraries is a canonical miRNA, its star sequence should be identified based on imperfect base-pairing and a 1-2 nucleotide 3' overhang when paired with its complementary mature miRNA.

Based on the biogenesis features of miRNA (Figure 3a), we developed a perl script to search for possible candidate miRNA-miRNA* duplexes, which satisfied the following criteria: they were selected primarily by base-pairing, allowing for G:U pairing, which is common in the miRNA precursors they could contain up to four mismatches they could have a maximum size of 4 nucleotides for a bulge in the candidate miRNA sequence they had to have a 1-2 nucleotide 3' overhang [45, 46] the dominant strand had to have five or more reads in the library because miRNAs with a low expression level were likely to have no star form in the library the length of the dominant strand had to be between 18 and 24 nuceotides long the 5' ends in more than 80% of the reads of those sequences in the cluster of the dominant sequence of the pairs had to be consistent with each other. After these criteria were met, we then used mfold to evaluate the ability of the identified pairs to form a hairpin structure [22, 23], where their free energy of folding (ΔG) was an important standard for use in determining the stability of RNA secondary structure.

In order to satisfy the requirement of input sequences analyzed by mfold, we joined the two sequences in each candidate pair using a standard hairpin-forming linker sequence (GCGGGGACGC). Those pairs that met the following conditions were analyzed further: the pairs had a free energy less than or equal to -21 kcal/mol (in cases where there was more than one partner for a sequence, the pair with the lowest free energy was selected as the true one) the pairs had no bulge bigger than 6 nucleotides and multiple loops. The way of determining the best parameters and of testing this method is described in the Methods in Additional data file 3.

Amplification of the miRNA precursors from locust genomic DNA

We extracted genomic DNA from the fifth instar locust using a Gentra Puregene Tissue Kit (Qiagen, Valencia, CA, USA) according to the manufacture's protocol. We designed primers for 8 conserved miRNAs and 24 candidate miRNA-miRNA* pairs we predicted based on a dependence of the sequences of the mature miRNA and miRNA* species using Primer Premier 5.0. (Premier Biosoft International, Palo Alto, CA, USA) Because mature miRNA may come from either arm of the precursor, we designed two pairs of primers for each duplex. Corresponding fragments were amplified by PCR and the length of amplification products was examined on 2.5% agarose gels. Fragments between 55 and 70 nucleotides in length were subcloned into pMD18-T vector (Takara, Dalian, Liaoning, China) for sequencing analyses.

Discovery of endo-siRNAs and piRNA-like small RNAs using ESTs

The 23-29 nucleotide long RNAs matching ESTs annotated as transposons were considered as piRNA-like small RNAs. Those small RNAs that perfectly matched EST antisense strands were considered as candidate endo-siRNAs if they were not from annotated transposons. Moreover, we also searched the ESTs for miRNA precursors. Although there were some sequences that perfectly matched EST sense strands, no typical hairpin structure of these ESTs could be identified using mfold. Rather than folding the entire EST sequence, regions of 70 nucleotides, 100 nucleotides and 150 nucleotides on either side of the small RNA sequences were folded.

Prediction of miRNA targets

Unigene sequences from the EST database of the locust [13, 14] were chosen to predict the miRNA targets without distinguishing the 3' UTR from the protein coding region. miRanda v3.1 [35] was selected as the prediction tool. A miRanda score greater than 150 was used to select unigene targets.

3' RACE of the locust pale gene

The 3' UTR sequence of the locust pale gene was obtained by 3' rapid amplification of cDNA ends (RACE) using a SMART RACE cDNA Amplification Kit (Clontech, Takara, Dalian, Liaoning, China) with the primer GCGACCTGGACAACTGCAACCACCTCAT according to the manufacturer's protocol.


Methodological Challenges

Perhaps as a result of their novelty in conservation science, some central tenets of good qualitative research relevant for studying coexistence are insufficiently applied. These include rigor in recording and presenting qualitative data, reflecting on the researcher's role in the research process, and thinking through research ethics. Good practice is further hindered by mismatches between academic and funding requirements and the time requirements of ethnographic-style research.

Numerous theses and publications present qualitative data imprecisely, in ways that the same researchers would never countenance presenting quantitative data. For example, tables of interviewees that allow attribution of quotations to specific interviewees (not “an old man told me”) are seldom provided (interviews recorded rigorously as data). Transcriptions of interviews or focus groups are seldom referred to. Methods sections are silent on the social contexts in which data were collected, by whom, and how this could have influenced the information gathered.

Self-reflexivity is an important dimension of field research, particularly research on sensitive topics such as human–wildlife conflict and coexistence. Sometimes noted, it is seldom explored in depth. In essence, it refers to researchers reflecting on their identity and how this positions them (and results in them being positioned) relative to their interviewees (Lute & Gore 2019 ). It reminds researchers that they bring strong biases to interview situations and that knowledge is being coproduced.

Researchers are urged to be as transparent as possible in presenting themselves and their research projects to interviewees. This is to the good, but actual field research is more complicated, raising issues around ethnicity, gender, socioeconomic status, and power relations shaping the nature of interactions (Chattopadhyay 2013 ). Researchers build relationships with individuals and communities that may require omitting certain aspects of their personal circumstances and beliefs, for example, religious beliefs, gender identity, sexual orientation, wealth, and access to resources (relative to interviewees).

Being invited to witness or even participate in illegal activities raises dilemmas for researchers. Researchers are not there to judge locals, but there are times when lives are at stake or their personal values are challenged, when they may feel compelled to act to prevent such activities. Participation may offer access to important knowledge but require researchers to be less judgmental. However, when it comes to writing and publication, the intimate relationships and trust that allowed participation become challenging to represent and explain, and communicating may be difficult to achieve without compromising anyone involved (Chattopadhyay 2013 Smith 2016 ). Self-reflexivity and the constraints on objective observation deserve serious attention.

Researchers have an ethical duty to ensure no harm will come to those they are working with, during and after research activities (ASA 2011 ). Asking people to talk about traumatic events and possibly illegal responses to them requires empathy and tact. It requires putting the feelings of interviewees first when conversations become upsetting. Victims of traumatic events should be interviewed with someone close to them present to support them. Learning about peoples’ lives and experiences requires humility because researchers are the learners, not the experts. In addition to those suffering traumatic events, researchers hearing about them also have a duty of care to themselves: both sets of persons should have someone to discuss their experiences with in confidence. Finally, it is advisable to consider the sensitivities of governments and management organizations and ensure publications and public statements do not compromise local collaborators.

Time and funding constraints, especially those faced by early-career researchers, present serious challenge for ethnographic-style work. Postgraduate research projects and short-term grants demand quick results and publication. Undertaking ethnographic research, however, typically takes years. It takes a brave graduate student to arrive at a field site and spend several months doing “informed hanging out” (anthropologist G. Marvin, personal communication 2018). Not doing so, however, and arriving with preformulated ideas and prestructured research instruments seriously compromises researchers’ abilities to discover concepts and questions they had not already thought of. Conceptually, ethnographic researchers try to avoid preconceptions and biases in questions and analyses based on predetermined categories and theoretical perspectives.

Studying coexistence requires slow research and a willingness and capacity to listen carefully to and learn from others. It requires researchers to take the time to approach communities appropriately, get the necessary permissions, make good contacts, win peoples’ trust, learn about their lives beyond just how they interact with wildlife, and above all empathize with them. Interviewees are individuals with unique biographies they are not simply victims, perpetrators, or demographic variables. This work requires giving the care and attentiveness to people that naturalists give to observing nature.

It is remarkable how little attention has been paid to the experiences of (and posttraumatic effects on) people involved in life-changing encounters with wild animals, including attacks and disastrous losses of livestock, food, or crops (Barua et al. 2013 ). There is a management focus on prevention and one-off or short-term compensation measures, but lives may be changed forever and attitudes deeply affected for the long term by such encounters.


Evidence for whale evolution from paleontology

The critical piece of evidence was discovered in 1994, when paleontologists found the fossilized remains of Ambulocetus natans, which means "swimming-walking whale," according to a 2009 review published in the journal Evolution: Education and Outreach. Its forelimbs had fingers and small hooves, but its hind feet were enormous relative to its size. The animal was clearly adapted for swimming, but it was also capable of moving clumsily on land, much like a seal.

When it swam, the ancient creature moved like an otter, pushing back with its hind feet and undulating its spine and tail.

Modern whales propel themselves through the water with powerful beats of their horizontal tail flukes, but A. natans still had a whip-like tail and had to use its legs to provide most of the propulsive force needed to move through water.

In recent years, more and more of these transitional species, or "missing links," have been discovered, lending further support to Darwin's theory. For example, in 2007, a geologist discovered the fossil of an extinct aquatic mammal, chamado Indohyus, that was about the size of a cat and had hooves and a long tail. Scientists think the animal belonged to a group related to cetaceans such as Ambulocetus natans. This creature is considered a "missing link" between artiodactyls &mdash a group of hoofed mammals (even-toed ungulates) that includes hippos, pigs, and cows &mdash and whales, according to the National Science Foundation.

Researchers knew that whales were related to artiodactyls, but until the discovery of this fossil, there were no known artiodactyls that shared physical characteristics with whales. After all, hippos, thought to be cetaceans' closest living relatives, are very different from whales. Indohyus, on the other hand, was an artiodactyl, indicated by the structure of its hooves and ankles, and it also had some similarities to whales, in the structure of its ears, for example.


Evolution is defined as a change in the allele frequency of population through time. The Hardy-Weinberg model predicts that the allele frequency of a population will not change (i.e., evolution will not occur) if the following conditions are met:

no natural or sexual selection

no gene flow (immigration or emigration from the population)

no genetic drift (changes in allele frequency due to random events)

So we can conclude that if any of the above conditions are not met then there is a change in allele frequency and thus evolution, and thus that factor is the cause of evolution.

What is evolution?

The first step is to remind ourself of the definition of the term "evolution". Evolution is most often defined as "any change in allele frequency in a population". I will assume that you are willing to use this standard definition.

If one were to use another definition of evolution (see How to define “evolution”? for a discussion), of course the below list of mechanisms that are driving evolution would be different.

Forces that drive evolution

Categorizing the processes that affect allele frequencies might be subject to issues of semantics. Without going into the details, we generally recognize 4 forces that drives evolution

  1. Natural selection
    • Natural selection refers to the deterministic change in allele frequency due to a differential in fitness among different genotypes. Sexual selection and artificial selection are typically considered as part of natural selection (although that may vary from author to author)
  2. Genetic Drift
    • Genetic Drift refers to the stochastic sampling process of individuals
  3. Mutações
    • A mutation refers to any spontaneous change (substitution, indel, chromosome duplication, etc. ) in an individual's genotype.
  4. Gene flow (aka. migration)
    • Gene flow refers to the transfer (migration) of DNA sequences among populations.

KennyPeanuts's answer, random mating and hardy-weinberg equilibrium

In his answer, @KennyPeanuts also talk about random mating. Random mating refers to the condition where the probability of two individuals to mate depends only on their respective fitness. Many people phrase random mating as absence of mate choice but it actually refers to the absence of variation for mate choice in the population.

Hardy-Weinberg states that under the above four conditions and random mating, then the frequency of the genotype that has the allele $i$ derived from the mother and the allele $j$ derived from the father, where $x_i$ and $x_j$ are the frequency of these alleles is $cdot x_i cdot x_j$. This means that for a bi-allelic locus, the allele frequency of the genotypes AA , AB , BA and BB are $x^2$, $x(1-x)$, $x(1-x)$ and $(1-x)^2$, respectively where $x$ is the frequency of the allele A . For the heterozygotes ( AB and BA ), we often care little which of the two allele is inherited by the mother and which is inherited by the father (assuming there are genders) and we therefore call AB both AB and BA genotypes (which can eventually be confusing). As such, the frequency of the AB genotype is $2 x(1-x)$.

The condition of random mating ensure that there is no deviation of genotype frequencies from the Hardy-Weinberg's expectations and it ensure that there is no change in genotype frequencies from the first to the second generation considered (after one generation, the equilibrium genotype frequency is immediately reached). Random mating is therefore not a condition for evolution to not occur.


Assista o vídeo: Como MEMORIZAR de maneira FÁCIL e RÁPIDA (Janeiro 2022).