Em formação

19.1.9: Código de barras - Biologia


Código de barras é o termo aplicado a uma tecnologia que está sendo desenvolvida para acelerar a identificação de espécimes de seres vivos. Até agora, a identificação e classificação dos animais progrediram mais. Embora cada indivíduo na maioria das espécies tenha uma sequência de genoma única, as diferenças entre os indivíduos de uma espécie são muito menores do que as diferenças entre os indivíduos de espécies diferentes. Assim, determinar a sequência do genoma de um espécime deve permitir que ele seja classificado positivamente se as sequências de outros membros de sua espécie já estiverem em um banco de dados.

No entanto, sequenciar genomas inteiros de animais é uma tarefa enorme. (A maioria dos mamíferos tem cerca de 3 bilhões de pares de bases de DNA.) Uma abordagem mais prática é estabelecer a sequência de um único gene que é encontrado em toda a vida animal. O que foi escolhido para os animais é o gene, COI, que codifica a maior subunidade da citocromo c oxidase.

Vantagens

  • É um gene mitocondrial e, portanto, cada célula tem centenas a milhares de cópias dele, em oposição a apenas duas cópias de cada um de seus genes nucleares.
  • Não tem íntrons (em animais).
  • Graças à redundância do código genético, ele pode sofrer mutações com bastante liberdade, especialmente na terceira posição de seus códons.
  • Além disso, as sequências de genes mitocondriais variam mais entre as espécies relacionadas do que seus genes nucleares. Por exemplo, enquanto as diferenças de sequência entre os genes nucleares de humanos e chimpanzés são de apenas cerca de 1%, a diferença entre suas sequências de genes mitocondriais é de cerca de 9%.
  • Dentro de uma espécie, entretanto, há pouca variação de espécime para espécime em suas sequências de genes mitocondriais.

Procedimento

  • O DNA mitocondrial é extraído.
  • Um fragmento da extremidade 5 'de COI (~ 648 pares de bases) é isolado (o gene inteiro tem ~ 1500 pares de bases).
  • O fragmento é amplificado por PCR usando iniciadores prontamente disponíveis.
  • A sequência é determinada e comparada com as que já estão em um banco de dados.

Primeiros resultados

A análise do código de barras de várias centenas de pássaros diferentes mostrou que os resultados dos códigos de barras geralmente refletem a identificação das espécies com base em critérios mais convencionais. No entanto, surgiram alguns casos em que:

  • espécimes que se pensa pertencerem à mesma espécie diferem substancialmente no COI seqüência e, portanto, provavelmente representam a evolução convergente.
  • espécimes que se pensa pertencerem a espécies diferentes têm semelhantes COI sequências e, portanto, são provavelmente variantes locais do que na verdade é uma única espécie.

Olhando para a Frente

  • Desenvolvimento de genes de código de barras apropriados para plantas (cujo COI genes variam pouco) e fungos (cujos COI genes são interrompidos por íntrons). Um candidato promissor para plantas é o gene do cloroplasto rbcL que codifica a grande subunidade de RUBISCO.
  • Desenvolvimento de sequenciadores portáteis que podem codificar o DNA de um espécime em campo.

O Consórcio para o Código de Barras da Vida (CBOL) está promovendo o desenvolvimento do código de barras. Sua página inicial (link abaixo) fornece outros links que descrevem objetivos, métodos, realizações, etc. No momento em que este livro foi escrito, códigos de barras para mais de 112.000 espécies foram inseridos em bancos de dados.


Hashing celular com anticorpos com código de barras permite multiplexação e detecção de dupleto para genômica de célula única

Apesar do rápido desenvolvimento no sequenciamento de uma única célula, os efeitos de lote específicos da amostra, a detecção de multipletos de células e os custos experimentais permanecem desafios pendentes. Aqui, apresentamos Cell Hashing, onde anticorpos marcados com oligo contra proteínas de superfície expressas de forma ubíqua marcam células de amostras distintas, que podem ser subsequentemente agrupadas. Ao sequenciar essas marcas ao lado do transcriptoma celular, podemos atribuir cada célula à sua amostra original, identificar de forma robusta os multipletos de amostra cruzada e "supercarregar" sistemas comerciais baseados em gotículas para redução significativa de custos. Validamos nossa abordagem usando uma abordagem genética complementar e demonstramos como o hashing pode generalizar os benefícios da multiplexação de uma única célula para diversas amostras e projetos experimentais.


Código de barras de DNA: a melhor maneira de descobrir espécies

Stefan Caddy-Retalic é afiliado à University of Adelaide and Terrestrial Ecosystems Research Network.

Andrew Lowe é professor de Biologia de Conservação de Plantas e Diretor do Centro Australiano de Biologia Evolutiva e Biodiversidade da Universidade de Adelaide, Chefe de Ciências do Departamento de Meio Ambiente e Recursos Naturais da Austrália do Sul e presidente da Rede de Código de Barras da Vida da Austrália. Ele recebe financiamento dos governos da Austrália do Sul e da Comunidade Britânica para projetos genéticos e de conservação de plantas, incluindo código de barras de DNA. O Prof Lowe é Diretor Científico e acionista da Double Helix Tracking Technologies, uma empresa que usa códigos de barras de DNA e tecnologias de rastreamento para promover a conservação e o manejo florestal sustentável.

Sócios

The Conversation UK recebe financiamento dessas organizações

Você pode ficar surpreso ao saber que a ideia de uma “espécie” é um dos conceitos mais ambíguos da ciência.

Originalmente, “espécie” (que significa “tipo” ou “tipo” em latim) era usado para se referir a organismos que pareciam diferentes e, por mais de 250 anos, diferenças físicas foram usadas para diferenciar as espécies.

Mas agora, com o surgimento de uma técnica conhecida como "DNA barcoding", é mais fácil do que nunca determinar a identidade e as relações entre as espécies.

Nos 250 anos desde que o botânico sueco Carl Linnaeus formalizou o método taxonômico, houve uma série de descobertas que exigiram uma melhor definição de “espécie”.

  • dimorfismo sexual: onde os sexos da mesma espécie parecem diferentes (como leões e leoas)
  • metamorfose: onde os organismos mudam radicalmente de forma (como de lagarta para borboleta)
  • homoplasia: onde organismos não relacionados parecem e funcionam de forma semelhante devido a pressões de seleção ambiental semelhantes (como o desenvolvimento de asas em insetos, pássaros e morcegos).

Uma mudança para a ideia de isolamento sexual - o conceito de que uma espécie é um grupo de organismos que podem se cruzar com sucesso - foi útil do ponto de vista ecológico e evolutivo, mas não muito útil para a identificação de espécies. Mais recentemente, os cientistas se voltaram para a genética.

Comparar o código genético dos organismos tornou a identificação das espécies muito mais fácil, mas ainda existem fortes argumentos sobre o nível de diferença genética que indica uma fronteira entre as espécies.

Essa falta de consenso sobre como definir uma espécie realmente significa que qualquer identificação é subjetiva. A identificação por meio de taxonomia (os atributos físicos de um organismo) ou filogenética (código genético de uma espécie) é um pouco como uma "arte negra", dependendo da opinião de um ou de um pequeno número de especialistas. Essas identificações costumam ser altamente contestadas.

Por exemplo, o gênero Eucalyptus foi controversamente revisado várias vezes desde a década de 1930. Isso incluiu a divisão do eucalipto de um a três gêneros e 13 subgêneros e a adição de mais de 100 espécies (geralmente como resultado da divisão das espécies existentes).

“Nenhuma definição satisfez todos os naturalistas, mas cada naturalista sabe vagamente o que ele quer dizer quando fala de uma espécie”.

Portanto, apesar de toda a dificuldade que temos em compreender e identificar as espécies, uma pergunta melhor poderia ser: isso realmente importa?

O dimorfismo sexual é uma das razões pelas quais a definição de “espécie” precisa ser revisada. tobyjm

O código de barras do DNA é um desenvolvimento recente na genética, no qual uma curta sequência de DNA é lida de qualquer amostra genética. Esta sequência de DNA é registrada em um banco de dados público, como GenBank ou Barcode of Life Data Systems (BOLD).

Esta amostra pode então ser comparada com todas as outras amostras para inferir quão intimamente relacionados são dois organismos. Em vez de registrar o melhor julgamento de um cientista (ou um pequeno grupo) ao dizer que um espécime pertence a uma espécie específica, o código de barras do DNA pode fornecer uma análise mais objetiva.

Em um famoso estudo de caso, o código de barras do DNA foi usado para demonstrar que uma borboleta comum da América Central era na verdade um complexo de pelo menos dez espécies com morfologia (forma e estrutura) muito semelhante vivendo na mesma região. Esta descoberta expôs uma riqueza de biodiversidade oculta.

Pela primeira vez na biologia, o código de barras do DNA significa que cada amostra é um “ponto de dados” genuíno, mostrando que em um determinado lugar e um determinado momento, um organismo com uma sequência de genes gravada estava presente. Quando as espécies são reclassificadas ou as taxonomias anteriores são postas em dúvida, a ambigüidade sobre os limites das espécies é removida. Todos os dados coletados são tão valiosos quanto o dia em que foram registrados.

A disponibilidade de dados genéticos individuais significa que podemos transformar a ecologia de uma visão baseada em espécies para uma visão baseada em genes. Isso é importante, porque está muito mais próximo de como o mundo biológico realmente funciona.

Os ecossistemas são, na verdade, um sistema dinâmico de genes com fronteiras fluidas entre o que consideramos espécies. Embora pensemos na "evolução" como um processo linear pelo qual os organismos se tornam mais complexos, na verdade é apenas o processo pelo qual os genes mudam na natureza. Essa mudança é particularmente fluida no mundo microscópico, onde as bactérias podem incorporar espontaneamente genes de organismos não relacionados em seu próprio código genético.

A coleta de informações genéticas também permitirá que os dados sejam processados ​​de maneiras completamente novas e complexas, e com um nível de robustez e quantificação que não era possível anteriormente. Podemos rastrear genes individuais ao longo do tempo e paisagens para entender a natureza da evolução e como os ecossistemas ao nosso redor estão mudando no nível mais fundamental.

A adoção de tecnologias genéticas pode transformar a ecologia de uma “ciência leve” - sujeita às opiniões e caprichos de alguns cientistas - em uma “ciência dura”. Dados irrefutáveis ​​são coletados e podem ser analisados ​​de várias maneiras diferentes (incluindo relações evolutivas), mudando a forma como vemos os ecossistemas.

Os cientistas continuarão a usar a morfologia para uma identificação rápida e, muitas vezes, isso será bom o suficiente. Mas, para ciência de ponta e responder ao próximo conjunto de questões em biologia, precisaremos melhorar nossa precisão.

Isso não quer dizer que devemos abandonar completamente o conceito de espécie, mas podemos fazer melhor do que ver o conceito de "espécie" como estático com definições e limites rígidos.


A necessidade do código de barras

A taxonomia dos seres vivos foi criada por Carl von Linné, que a formalizou usando um sistema de classificação binomial para diferenciar os organismos. A nomenclatura binomial foi usada para descrever um gênero e um nome de espécie para cada organismo para fornecer uma identidade. Hoje em dia, a classificação dos organismos está se tornando cada vez mais importante como uma medida da diversidade em face da destruição do habitat e da mudança climática global. Não há consenso sobre quantas formas de vida existem neste planeta, mas a estimativa das taxas de extinção é de cerca de 1 espécie por 100-1000 milhões de espécies. A classificação no dia Linné & # 8217s foi realizada principalmente por diferenças morfológicas. Isso foi feito em fósseis. No entanto, a morfologia tem muitas desvantagens, especialmente em espécies sexualmente dimórficas ou espécies com morfologias de desenvolvimento múltiplas.

Larva (em cima) do Lacewing Verde e o adulto (embaixo).

A biologia molecular e as tecnologias de DNA revolucionaram o sistema de classificação dos seres vivos, especialmente ao fornecer a capacidade de combinar o parentesco dessas espécies. Código de barras de DNA , como o nome indica, busca utilizar marcadores de DNA para identificar organismos de forma diferenciada. Mas quais marcadores de DNA devem ser usados? Que critérios usamos para desenvolver códigos de barras? Discriminação, Universalidade e Robustez são os critérios usados ​​para definir a utilidade dos códigos de barras.

Uma vez que o objetivo do código de barras é definir organismos específicos, a discriminação é o objetivo primário. Discriminação refere-se à diferença de sequências que ocorrem entre as espécies. No entanto, a ciência é mais fácil quando há alguma universalidade no locus usado para a discriminação. Pelo que parece, universalidade é uma tentativa de usar o mesmo locus em genomas díspares. Enquanto a discriminação é sobre a unicidade de sequências, a universalidade busca usar um único conjunto de primers de PCR que serão capazes de amplificar essa mesma região distinta com similaridade de sequência variável. Se alguma região do DNA não tem absolutamente nenhum desvio de sequência entre as espécies, isso tem grande universalidade, mas pouca discriminação. Mas se uma sequência tiver similaridade de sequência muito baixa, isso é ótimo para discriminação, mas não tem absolutamente nenhuma universalidade e não pode ser amplificado com o mesmo conjunto de primers. Robustez refere-se à confiabilidade da amplificação por PCR de uma região. Algumas regiões do DNA simplesmente não amplificam bem ou é muito difícil projetar primers apropriados e exclusivos para aquele locus.

Um caso em que há universalidade para a concepção de primers, mas não uma área onde possa ocorrer discriminação.

Embora a discriminação de diferentes organismos possa ocorrer nessa situação, a falta de similaridade na sequência dificultaria o projeto de primers. Ou seja, a falta de universalidade na sequência também tornaria este PCR não robusto.

Bastante variabilidade nessas sequências nos dá a capacidade de discriminar entre as espécies. A alta similaridade nos fornece a universalidade necessária para projetar primers que podem ser robustos o suficiente para amplificar por PCR.

Às vezes, as espécies são tão semelhantes para uma sequência que um segundo marcador é necessário. Assim como o código de barras UPC padrão tem uma série de linhas verticais de diferentes espaçamentos e larguras, um código de barras bidimensional adiciona essa segunda dimensão de informação em um quadrado de pontos como em um código QR (código de resposta rápida). Também podemos utilizar um segundo, um terceiro ou um quarto conjunto de loci que ajudará no aumento da discriminação, assim como o CoDIS utiliza vários sites STR para definir pessoas individuais. Em animais, o código de barras mais comumente usado é o gene mitocondrial, Citocromo Oxidase I ( COI ) Como todos os animais têm mitocôndrias e esse gene mitocondrial, ele oferece alta universalidade. É um locus robusto, fácil de amplificar e com alto número de cópias, com desvio de sequência suficiente entre as espécies para discriminá-las.

Os genomas mitocondriais de animais variam de 16kb-22kb. No entanto, plantas, fungos e protistas têm genomas mitocondriais muito diferentes e maiores. Para as plantas, usamos um gene do cloroplasto, subunidade grande da ribulose-bisfosfato carboxilase ( rbcL ) ou maturase K ( matK ) (Hollingsworth et al. 2011). Os procariontes são frequentemente discriminados por seus 16s gene rRNA, enquanto os eucariotos podem ser identificados por 18s rRNA. COI (um gene transmitido pela mãe) não criará uma imagem clara da identidade da espécie no caso de animais híbridos (mulas, ligres, coydogs, etc.). Às vezes, espécies intimamente relacionadas também são indistinguíveis por um único código de barras, portanto, a inclusão de 18s com COI pode ser necessária para definir a identidade da espécie. Uma vez que é tão difícil atender aos três critérios (robustez, universalidade e discriminação) para todas as espécies, ter esses códigos de barras múltiplos é importante. Os fungos provam ser de difícil identificação por COI, então outro marcador chamado espaçador interno transcrito ( ESTÁ ) é usado para ajudar na sua identificação. Devemos lembrar também que nem tudo com cloroplastos são plantas e, portanto, marcadores adicionais são usados ​​para identificar protistas.

Misturas de organismos

Os líquenes são organismos compostos compostos por cianobactérias ou outras algas com fungos. Nesse caso, um único código de barras identificaria incorretamente a espécie.

Os grânulos de kefir representam colônias de micróbios mistos que são usados ​​para gerar o kefir. Crédito: A. Kniesel (CC-BY-SA 3.0)

Uma colônia simbiótica de bactérias e leveduras é usada para fermentar a kombuchá. Como o nome indica, esta é uma colônia composta complexa de várias espécies que contribuem para as qualidades do kombuchá. Crédito: Lukas Chin (CC-BY-SA 4.0)

Metabarcoding e Microbiomes


Reconhecimentos

Agradecemos a R. Szilard, M. Zimmermann, S. Noordermeer e A. Sartori pela leitura crítica do manuscrito, bem como a D. D'Amours e J. Lukas por estimular discussões e conselhos. N.H. é bolsista de longa data do Human Science Frontier Program. D.D. é Presidente de Pesquisa do Canadá (Nível 1) em Mecanismos Moleculares de Integridade do Genoma. O financiamento para o trabalho no laboratório de D.D relacionado à regulação do reparo do DNA pelo ciclo celular inclui o subsídio do CIHR FDN143343 e um Grant-in-Aid da Krembil Foundation.


A necessidade do código de barras

A taxonomia dos seres vivos foi criada por Carl von Linné, que a formalizou usando um sistema de classificação binomial para diferenciar os organismos. A nomenclatura binomial foi usada para descrever um gênero e um nome de espécie para cada organismo para fornecer uma identidade. Atualmente, a classificação dos organismos está se tornando cada vez mais importante como uma medida da diversidade em face da destruição do habitat e da mudança climática global. Não há consenso sobre quantas formas de vida existem neste planeta, mas a estimativa das taxas de extinção é de cerca de 1 espécie por 100-1000 milhões de espécies. A classificação no dia Linné & # 8217s foi realizada principalmente por diferenças morfológicas. Isso foi feito em fósseis. No entanto, a morfologia tem muitos inconvenientes, especialmente em espécies dimórficas.

A biologia molecular e as tecnologias de DNA revolucionaram o sistema de classificação dos seres vivos, especialmente ao fornecer a capacidade de combinar o parentesco dessas espécies. Código de barras de DNA , como o nome indica, busca utilizar marcadores de DNA para identificar organismos de forma diferenciada. Mas quais marcadores de DNA devem ser usados? Que critérios usamos para desenvolver códigos de barras? Discriminação, Universalidade e Robustez são os critérios usados ​​para definir a utilidade dos códigos de barras.

Uma vez que o objetivo do código de barras é definir organismos específicos, a discriminação é o objetivo primário. Discriminação refere-se à diferença de sequências que ocorrem entre as espécies. No entanto, a ciência é mais fácil quando há alguma universalidade no locus usado para a discriminação. Pelo que parece, universalidade é uma tentativa de usar o mesmo locus em genomas díspares. Enquanto a discriminação é sobre a unicidade de sequências, a universalidade busca usar um único conjunto de primers de PCR que serão capazes de amplificar essa mesma região distinta com similaridade de sequência variável. Se alguma região do DNA não tem absolutamente nenhum desvio de sequência entre as espécies, isso tem grande universalidade, mas pouca discriminação. Mas se uma sequência tiver similaridade de sequência muito baixa, isso é ótimo para discriminação, mas não tem absolutamente nenhuma universalidade e não pode ser amplificado com o mesmo conjunto de primers. Robustez refere-se à confiabilidade da amplificação por PCR de uma região. Algumas regiões do DNA simplesmente não amplificam bem ou é muito difícil projetar primers apropriados e exclusivos para aquele locus.

Às vezes, as espécies são tão semelhantes para uma sequência que um segundo marcador é necessário. Assim como o código de barras UPC padrão tem uma série de linhas verticais de diferentes espaçamentos e larguras, um código de barras bidimensional adiciona essa segunda dimensão de informação em um quadrado de pontos como em um código QR (código de resposta rápida). Também podemos utilizar um segundo, um terceiro ou um quarto conjunto de loci que ajudará no aumento da discriminação, assim como o CoDIS utiliza vários sites STR para definir pessoas individuais. Em animais, o código de barras mais comumente usado é o gene mitocondrial, Citocromo Oxidase I ( COI ) Como todos os animais têm mitocôndrias e esse gene mitocondrial, ele oferece alta universalidade. É um locus robusto, fácil de amplificar e com alto número de cópias, com desvio de sequência suficiente entre as espécies para discriminá-las. Para as plantas, usamos um gene do cloroplasto, subunidade grande da ribulose-bisfosfato carboxilase ( rbcL ) Os procariontes são frequentemente discriminados por seus 16s gene rRNA, enquanto os eucariotos podem ser identificados por 18s rRNA. Por causa de animais híbridos (mulas, ligres, coydogs, etc.), é útil usar COI (um gene transmitido pela mãe) em conjunto com um gene codificado por núcleo, como o 18s. Como é tão difícil atender aos três critérios para todas as espécies, é importante ter esses códigos de barras múltiplos. Os fungos provam ser de difícil identificação por COI, então outro marcador chamado espaçador interno transcrito ( ESTÁ ) é usado para ajudar na sua identificação. Devemos lembrar também que nem tudo com cloroplastos replanta e, portanto, marcadores adicionais são usados ​​para identificar protistas.


2 respostas 2

Você fez um trabalho bastante decente ao responder à sua própria pergunta, mas existem algumas coisas que podem ser elaboradas.

A convenção geral é usar o citocromo C oxidase 1 mitocondrial (COI) gene para animais com código de barras e genes de cloroplasto (rbcL, matK, e trnH-psbA) para plantas. Os três maiores motivos para selecionar esses genes são 1) sua onipresença 2) a presença de muitas cópias por célula, então é mais fácil amplificar as sequências por PCR e 3) o DNA mitocondrial e de plastídio tem uma taxa de mutação muito maior do que o DNA nuclear, o que o torna possível codificar com exclusividade organismos muito próximos. Este método é extremamente sensível, confiável e fácil. A publicação original do código de barras do DNA pode ser encontrada em doi: 10.1098 / rspb.2002.2218

Graças aos esforços de consórcios como CBOL, BOLD e iBOL, existem agora muitos milhões de sequências de referência em banco de dados, cobrindo praticamente qualquer organismo multicelular que você possa encontrar (supondo que você não trabalhe em um sub-seq profundo ou algo assim )

Como você disse em sua postagem, existem limitações significativas no uso de qPCR para identificar espécies. Você tem que saber de antemão o que está procurando e fica com um simples sim-não. Isso não quer dizer que não haja lugar para qPCR no jogo de identificação de espécies, entretanto. O método é muito rápido e, nos casos em que você está interessado apenas em detectar uma única espécie ou um pequeno número de espécies, é muito mais conveniente do que obter o DNA sequenciado (por exemplo, durante o controle de qualidade em uma fábrica de processamento de carne, doi: 10.1080 / 02652030701584041).


O código de barras revela comportamento clonal complexo em xenoenxertos derivados de pacientes de câncer de mama triplo negativo metastático

Os cânceres de mama triplo-negativos primários (TNBC) são propensos à disseminação, mas as relações subclonais entre os tumores e as metástases resultantes são mal compreendidas. Aqui, usamos o código de barras celular de dois xenoenxertos derivados do paciente TNBC virgens de tratamento (PDXs) para rastrear o destino espaço-temporal de milhares de clones com código de barras em tumores primários e suas metástases. A ressecção do tumor teve um grande impacto na redução da diversidade clonal em locais secundários, indicando que a maioria das células tumorais disseminadas não tinham a capacidade de 'semear', portanto, originadas de 'shedders' que não persistiam. Os poucos clones que continuaram a crescer após a ressecção, isto é, 'semeadores', não se correlacionaram em frequência com seus clones parentais em tumores primários. O tratamento com cisplatina de um modelo PDX com mutação de BRCA1 para níveis não palpáveis ​​teve um impacto surpreendentemente menor na diversidade clonal no tumor recidivante, embora tenha eliminado 50% dos clones distais. Portanto, as características clonais de eliminação, semeadura e resistência aos medicamentos são fatores importantes a serem considerados para o desenho de estratégias terapêuticas.

Declaração de conflito de interesse

Os autores declaram não haver interesses conflitantes.

Bonecos

Visão geral experimental e clonal espaço-temporal ...

Visão geral experimental e heterogeneidade clonal espaço-temporal em tumores pseudo-primários. uma Código de barras celular de ...

Mosaicismo clonal em três dimensões.…

Mosaicismo clonal em três dimensões. Exemplo de tumor cortado em uma Oito iguais ...

Relações clonais entre tumor primário ...

Relações clonais entre tumor primário e sítios distais. uma Número de células com código de barras ...

Características de clones "semeadores" metastáticos ...

Características de clones "semeadores" metastáticos após a ressecção do tumor. Relações clonais entre primário ressecado ...

Propriedades das metástases de múltiplos órgãos. uma…

Propriedades das metástases de múltiplos órgãos. uma Exemplos de camundongos individuais de relações clonais entre indicados…

O efeito da cisplatina em ...

O efeito da cisplatina na diversidade clonal. uma Volume médio de tumores de ...


O 'código de barras' do rastreamento genético está revelando rapidamente a jornada e a evolução do COVID-19

Micrografia eletrônica de varredura colorida de uma célula moribunda (azul) fortemente infectada com SARS-CoV-2 (amarelo), o vírus que causa o COVID-19. Crédito: NIAID Integrated Research Facility, Fort Detrick, Maryland.

Pesquisadores da Universidade Drexel relataram um método para identificar e rotular rapidamente versões mutadas do vírus que causa COVID-19. Sua análise, usando informações de um banco de dados global de informações genéticas coletadas de testes de coronavírus, sugere que existem pelo menos 8 a 14 versões ligeiramente diferentes do vírus que infecta pessoas na América, algumas das quais são iguais ou evoluíram posteriormente de, cepas diretamente da Ásia, enquanto outras são as mesmas encontradas na Europa.

Desenvolvida inicialmente como uma forma de analisar amostras genéticas para obter um instantâneo da mistura de bactérias, a ferramenta de análise genética extrai padrões de volumes de informações genéticas e pode identificar se um vírus mudou geneticamente. Eles podem então usar o padrão para categorizar os vírus com pequenas diferenças genéticas usando marcas chamadas marcadores de subtipo informativo (ISM).

Aplicar o mesmo método para processar dados genéticos virais pode detectar e categorizar rapidamente pequenas variações genéticas no SARS-CoV-2, o novo coronavírus que causa o COVID-19, relatou o grupo em um artigo publicado recentemente na revista. PLoS Computational Biology. A ferramenta de análise genética, projetada pelo pesquisador Zhengqiao Zhao da Drexel, que gera esses rótulos está disponível publicamente para pesquisadores do COVID-19 no GitHub.

"Os tipos de vírus SARS-CoV-2 que vemos em testes da Ásia e da Europa são diferentes dos tipos que vemos na América", disse Gail Rosen, Ph.D., professora do Drexel's College of Engineering, que liderou o desenvolvimento da ferramenta. "Identificar as variações nos permite ver como o vírus mudou ao passar de uma população para outra. Também pode nos mostrar as áreas onde o distanciamento social teve sucesso no isolamento de COVID-19."

A ferramenta ISM é particularmente útil porque não requer a análise da sequência genética completa do vírus para identificar suas mutações. No caso do SARS-CoV-2, isso significa reduzir o código genético de 30.000 bases de comprimento do vírus para um rótulo de subtipo de 20 bases de comprimento.

A ferramenta ISM também identificou certas posições na sequência genética do vírus que mudaram juntas com a propagação do vírus. Os pesquisadores descobriram que, do início de abril ao final do verão, três posições na sequência do SARS-CoV-2 sofreram mutação ao mesmo tempo. Essas posições estão em diferentes partes da sequência genética. Acredita-se que uma parte esteja associada à sinalização e replicação celular. Outra parte está associada à formação do pico de proteína - a parte do vírus que permite sua entrada nas células saudáveis ​​- alterada em conjunto com uma terceira parte do código, que não se traduz em proteína.

Pesquisadores da Universidade Drexel estão usando uma nova técnica para detectar padrões na sequência genética do coronavírus SARS-CoV-2 que pode ajudar os cientistas a rastrear o caminho de sua transmissão e como ele sofreu mutação. Crédito: Drexel University

Embora sejam necessárias mais investigações sobre como essas mutações simultâneas afetam a transmissão e a gravidade do vírus, os locais que mudam juntos podem ser usados ​​para consolidar o rótulo do subtipo em 11 bases, o que pode tornar a análise downstream mais eficiente, de acordo com os pesquisadores.

"É o equivalente a ler um código de barras em vez de digitar o número completo do código do produto", disse Rosen. "E agora, todos nós estamos tentando chegar ao supermercado um pouco mais rápido. Para os cientistas, isso significa ser capaz de passar para uma análise de nível superior com muito mais rapidez. Por exemplo, pode ser um processo mais rápido para estudar quais versões de vírus pode estar afetando os resultados de saúde. Ou, as autoridades de saúde pública podem rastrear se novos casos são o resultado de transmissão local ou provenientes de outras regiões dos Estados Unidos ou partes do mundo. "

Embora essas diferenças genéticas possam não ser suficientes para delinear uma nova cepa de vírus, o grupo de Rosen sugere a compreensão desses "subtipos" geneticamente significativos, onde eles estão sendo encontrados e quão prevalentes são nessas áreas são dados granulares o suficiente para serem úteis.

"Isso nos permite ver a impressão digital muito específica do COVID-19 de cada região do mundo e olhar de perto as regiões menores para ver como é diferente", disse Rosen. "Nossa análise preliminar, usando dados disponíveis publicamente em todo o mundo, mostra que a combinação de subtipos de vírus encontrados em Nova York é mais semelhante aos encontrados na Áustria, França e Europa Central, mas não na Itália. E o subtipo da Ásia , que foi detectado aqui no início da pandemia não se espalhou muito, em vez disso, estamos vendo um novo subtipo que só existe na América como o mais prevalente no estado de Washington e na costa oeste. "

Além de ajudar os cientistas a entender como o vírus está mudando e se espalhando, esse método também pode revelar a parte de seu código genético que parece permanecer resistente a mutações - uma descoberta que pode ser explorada por tratamentos para combater o vírus.

"Estamos vendo que a proteína spike e a parte do vírus responsável por empacotar seu material genético desenvolveram algumas mutações importantes, mas, fora isso, estão mudando em um ritmo mais lento", disse Bahrad Sokhansanj, Ph.D., um visitante bolsista da Drexel. "É importante ressaltar que ambos são alvos essenciais para a compreensão da resposta imunológica do corpo, identificação de terapêuticas antivirais e desenvolvimento de vacinas.

O Laboratório de Informática e Processamento Ecológico e Evolutivo de Sinais de Rosen continuará a analisar os dados do COVID-19 à medida que são coletados e a apoiar os pesquisadores de saúde pública usando o processo ISM.


Métodos

As coletas de zooplâncton foram feitas em 19 locais (Tabela 1) sob a Licença de Coleta Científica SC-12162 do Departamento de Peixes e Vida Selvagem da Califórnia.

As coletas em terra foram feitas com uma rede de malha 150 μm (abertura de 30 cm) presa a uma corda, com um tubo coletor de 50 ml na base. Eles foram feitos de um cais público usando varreduras horizontais repetidas perto da superfície e varreduras diagonais até cerca de 15 pés de profundidade. Cerca de 5 a 10 varreduras de um total de cerca de 100 pés geralmente renderam espécimes suficientes, mas nenhuma tentativa foi feita para monitorar as coleções quantitativamente. As coletas foram feitas e analisadas com o auxílio dos alunos de graduação Taylor Sais, Alicia Navarro, Debbie Chung e Lesly Ortiz.

As coletas do oceano foram feitas com uma rede de malha de 250 μm presa a uma corda de 100 pés. A rede (abertura de 30 cm) foi rebocada atrás da embarcação, logo abaixo da superfície, por um período de 7 minutos na velocidade mais lenta possível. A implantação e recuperação estenderam o período total de reboque para 10 minutos.

Um espécime de Cladonema californica foi encontrado em tanques no Orange Coast College, Orange County, CA em 19/07/2018. Provavelmente chegou em uma remessa de ouriços do mar coletados em Long Beach, CA.

Collections were brought to the laboratory at the University of California, Irvine and examined under a dissecting microscope with lateral light and a dark background. Each specimen of interest was removed using a Pasteur Pipette, transferred to a depression slide, and recorded by video microscopy using a Zeiss microscope with a dark-field condenser, fitted with a phototube attached to a Nikon D5100 single-lens reflex camera. The most informative frames were taken from the videos and used in the figures for this paper. Each specimen was preserved in 90% ethanol in a well of a 96-well microplate. Filled plates were sent to the Canadian Centre for DNA Barcoding at the University of Guelph for sequencing of the standard 648-bp “DNA barcode” [7] in the COI mitochondrial gene, using the following primers: (LCO1490 GGTCAACAAATCATAAAGATATTGG HCO2198 TAAACTTCAGGGTGACCAAAAAATCA ). This usually produced a DNA barcode of 658 nucleotides, and only those containing >/ = 650 nucleotides were included in the sequence analysis. Species that could not be identified morphologically were assigned operational taxonomic names of the form nPJB, and groups of specimens with identical or almost identical DNA barcodes were assigned BIN numbers. The DNA sequences are in the public domain at the Canadian Centre for DNA Barcoding.

Hydroid phase specimens were obtained by removing bunches of seaweed from docks in Newport Bay, bringing them to the laboratory and examining them under the dissecting microscope. This provided hydroid stages for many but not all of the medusae investigated, presumably because hydroids of some species live on the seabed or in other locations that are difficult to access for collections. Hydroid specimens were recorded and processed in the same manner as medusae.


Assista o vídeo: Códigos de Barras de ADN:Introducción DNA Barcoding 101 P16 (Dezembro 2021).