Em formação

Como evoluiu a diversidade entre a fermentação do etanol e a fermentação do ácido lático?


Muito simplesmente, alguns organismos metabolizam a glicose em condições anaeróbicas via Glicose -> (2) ácido pirúvico -> (2) álcool etílico. Alguns organismos, no entanto, metabolizam em ácido láctico.

Quando esse processo (ácido lático) surgiu bioquimicamente de sua fermentação relacionada (etanol) e como foi selecionado? ou seja, quais foram as vantagens?

Além disso, alguém pode criar a etiqueta de glicólise ou fermentação?


Em primeiro lugar, não fica claro apenas a partir da fisiologia ou das informações bioquímicas determinar o que evoluiu de quê. O piruvato intermediário está sempre lá, então lactose desidrogenase (LDH) e piruvato descarboxilase (PDC) poderia ter evoluído a qualquer momento, e há boas razões para ambos:

  1. LDH: a reação piruvato + NADH / H + = lactato + NAD + + 25 kJ / mol é altamente exergônica, ou seja, produz calor
  2. PDC: a reação piruvato = acetaldeído + CO2 (e com ALD presente) acetaldeído + NADH / H + = etanol + NAD + onde o etanol é venenoso para outras espécies

Acrescente a isso que existem organismos como Sch. Pombe que têm Ambas enzimas, então podem fazer ambas as reações, suas perguntas devem ser bastante:

Como a enzima LDH evoluiu?

A enzima é semelhante à malato desidrogenase, ambos formam uma família. Eles pertencem a um grupo de enzimas que possuem uma Domínio de ligação NAD (P), então não é muito rebuscado afirmar que o LDH e o MDH evoluíram de outra enzima com domínio de ligação NAD (P).

http://www.ebi.ac.uk/interpro/IEntry?ac=IPR016040

Como a enzima PDC evoluiu?

As sequências de proteínas de piruvato descarboxilase (PDC) derivadas de genes clonados de leveduras (Saccharomyces cerevisiae) e bacterianos (Zymomonas mobilis) foram comparadas entre si e com bancos de dados de sequências. Extensas semelhanças de sequência foram encontradas entre eles e com dois outros: piruvato oxidase ligada ao citocromo de Escherichia coli e acetolactato sintase (ilvI em E. coli; gene ILV2 em S. cerevisiae). Todos catalisam a descarboxilação do piruvato usando pirofosfato de tiamina (TPP) como cofator. A semelhança geral geral sugere ancestralidade comum para essas enzimas.

citado do resumo de

Green, Jeremy. "A piruvato descarboxilase é como a acetolactato sintase ( ILV2) e não como a subunidade E1 da piruvato desidrogenase." FEBS letters 246.1 (1989): 1-5. http://www.ncbi.nlm.nih.gov/pubmed/2651151?dopt=Abstract


Soluções NCERT para Biologia Classe 11 Capítulo 14 Respiração em Plantas

Essas soluções fazem parte das Soluções NCERT para Biologia da Classe 11. Aqui, fornecemos Soluções NCERT para Biologia Classe 11, Capítulo 14 Respiração em Plantas.

Questão 1.
Diferencie entre
(a) Respiração e Combustão
(b) Glicólise e ciclo de Krebs
(c) Respiração aeróbica e fermentação
Solução:
(uma) As diferenças entre respiração e combustão são as seguintes:

(b) As diferenças entre a glicólise e o ciclo de krebs são as seguintes:

(c) As diferenças entre a respiração aeróbica e a fermentação são as seguintes:

Questão 2.
O que são substratos respiratórios? Cite o substrato respiratório mais comum.
Solução:
Os compostos que são oxidados durante esse processo são conhecidos como substratos respiratórios. Normalmente, os carboidratos são oxidados para liberar energia, mas proteínas, gorduras e até ácidos orgânicos podem ser usados ​​como substâncias respiratórias em algumas plantas, sob certas condições.

Questão 3.
Dê a representação esquemática da glicólise.
Solução:

Questão 4.
Quais são as principais etapas da respiração aeróbica? Onde se passa?
Solução:
Na respiração aeróbia que ocorre dentro da mitocôndria, o produto final da glicólise, o piruvato é transportado do citoplasma para a mitocôndria.
Os eventos cruciais na respiração aeróbica são:
A oxidação completa do piruvato pela remoção gradual de todos os átomos de hidrogênio, deixando três moléculas de CO2.
A passagem dos elétrons removidos como parte dos átomos de hidrogênio para o O molecular2 com a síntese simultânea de ATP.
O primeiro processo ocorre na matriz da mitocôndria, enquanto o segundo processo está localizado na membrana interna da mitocôndria.
O piruvato, que é formado pelo catabolismo glicolítico dos carboidratos no citosol, após entrar na matriz mitocondrial sofre descarboxilação oxidativa por um conjunto complexo de reações catalisadas pela desidrogenase pirúvica. As reações catalisadas pela desidrogenase pirúvica requerem a participação de várias coenzimas, incluindo NAD + e Coenzima A.

Durante esse processo, duas moléculas de NADH são produzidas a partir do metabolismo de duas moléculas de ácido pirúvico (produzido a partir de uma molécula de glicose durante a glicólise).
O acetil CoA então entra em uma via cíclica, o ciclo do ácido tricarboxílico, mais comumente chamado de ciclo de Krebs.

Questão 5.
Dê a representação esquemática de uma visão geral do ciclo de Krebs.
Solução:

Questão 6.
Explique o ETS.
Solução:
ETS ou sistema de transporte de elétrons está localizado na membrana mitocondrial interna. Ajuda a liberar e utilizar a energia armazenada em NADH + H + e FADH2 O NADH + H +, que é formado durante a glicólise e o ciclo do ácido cítrico, é oxidado pela NADH desidrogenase. Os elétrons gerados são transferidos para a ubiquinona por meio do FMN. De maneira semelhante, FADH2 gerado durante o ciclo do ácido cítrico é transferido para a ubiquinona. Os elétrons da ubiquinona são recebidos pelo citocromo bc1, e posteriormente são transferidos para o citocromo C. O citocromo C atua como um transportador móvel entre o complexo III e o complexo da oxidase da citocromo C contendo o citocromo ae a3, junto com centros de cobre.


Durante a transferência de elétrons de cada complexo, o processo é acompanhado pela produção de ATP a partir do ADP e do fosfato inorgânico pela ação da ATP sintase. A quantidade de ATP produzida depende da molécula que foi oxidada.

Questão 7.
Faça a distinção entre o seguinte:
(a) Respiração aeróbica e respiração anaeróbica.
(b) Glicólise e fermentação.
(c) Ciclo da glicólise e do ácido cítrico.
Solução:
As diferenças entre a respiração aeróbia e a respiração anaeróbica são as seguintes:

As diferenças entre glicólise e fermentação são as seguintes:

As diferenças entre a glicólise e o ciclo do ácido cítrico são as seguintes:

Questão 8.
Quais são as suposições feitas durante o cálculo do ganho líquido de ATP?
Solução:

  • Existe um funcionamento sequencial e ordenado da via, com um substrato formando o próximo e com a glicólise, o ciclo do TCA e a via ETS seguindo um após o outro.
  • O NADH sintetizado na glicólise é transferido para a mitocôndria e sofre fosforilação oxidativa.
  • Nenhum dos intermediários na via é utilizado para sintetizar qualquer outro composto.
  • Apenas a glicose está sendo respirada - nenhum outro substrato alternativo está entrando no caminho em qualquer um dos estágios intermediários.

Questão 9.
Discuta “A via respiratória é uma via anfibólica”.
Solução:
A respiração é geralmente considerada um processo catabólico porque, durante a respiração, vários substratos são decompostos para derivar energia. Os carboidratos são decompostos em glicose antes de entrar nas vias respiratórias. As gorduras são convertidas em ácidos graxos e glicerol, enquanto os ácidos graxos são convertidos em acetil CoA antes de entrar na respiração. De maneira semelhante, as proteínas são convertidas em aminoácidos, que entram na respiração após a desaminação.

Durante a síntese de ácidos graxos, a acetil CoA é retirada da via respiratória. Além disso, na síntese de proteínas, as substâncias respiratórias são retiradas. Assim, a respiração também está envolvida no anabolismo. Portanto, a respiração pode ser denominada como. via anfibólica, pois envolve anabolismo e catabolismo.

Questão 10.
Defina RQ. Qual é o seu valor para as gorduras?
Solução:
A proporção do volume de CO2 evoluiu para o volume de O2 consumido na respiração é chamado de quociente respiratório (RQ) ou razão respiratória.

Questão 11.
O que é fosforilação oxidativa?
Solução:

Embora o processo aeróbio da respiração ocorra apenas na presença de oxigênio, o papel do oxigênio é limitado ao estágio terminal do processo. No entanto, a presença de oxigênio é vital, pois conduz todo o processo removendo o hidrogênio do sistema. O oxigênio atua como o aceptor final de hidrogênio. Ao contrário da fotofosforilação, onde é a energia da luz que é utilizada para a produção do gradiente de prótons necessário para a fosforilação, na respiração, é a energia de oxidação-redução utilizada para o mesmo processo. É por esse motivo que o processo é denominado fosforilação oxidativa.

Questão 12.
Qual é o significado da liberação gradual de energia na respiração?
Solução:
Durante a oxidação dentro de uma célula, toda a energia contida nos substratos respiratórios não é liberada gratuitamente na célula, ou em uma única etapa. É liberado em uma série de reações lentas em etapas controladas por enzimas e é aprisionado como energia química na forma de ATP.

Portanto, é importante entender que a energia liberada pela oxidação na respiração não é usada diretamente, mas para sintetizar ATP, que é decomposto sempre que (e onde quer que) a energia precise ser utilizada. Conseqüentemente, o ATP atua como a moeda de energia da célula.

Esta energia aprisionada no ATP é utilizada em vários processos que requerem energia dos organismos, e o esqueleto de carbono produzido durante a respiração é usado como precursor para a biossíntese de outras moléculas na célula.

RESPOSTA MUITO CURTA DE PERGUNTAS

Questão 1.
O que é respiração anaeróbica? (Outubro 83)
Solução:
Quebra incompleta ou parcial de moléculas de combustível em compostos como álcool etílico, ácido láctico na ausência de oxigênio molecular.

Questão 2.
Nomeie o aceitador final de um elétron em ETC.
Solução:
O oxigênio é o aceitador de elétrons do ETC.
Questão 3.
A função do oxigênio na respiração aeróbica:
(i) Ele atua como o aceptor final de elétrons.
(ii) Ele conduz todo o processo removendo o hidrogênio do sistema.
Solução:
A função do oxigênio na respiração aeróbica:
(eu) Ele atua como o aceptor final de elétrons.
(ii) Ele conduz todo o processo removendo o hidrogênio do sistema.

Questão 4.
O que é respiração? (Outubro 86)
Solução:
O processo oxidativo no qual a energia quimicamente ligada de moléculas de combustível orgânico complexas, como carboidratos, proteínas e gorduras, é capturada na forma de ATP.

Questão 5.
Onde o sistema de transporte de elétrons opera na mitocôndria?
Solução:
A fosfofrutocinase catalisa a formação de frutose 1, 6 bisfosfatos a partir de frutose 6-fosfato.

Questão 6.
Dê a função da fosfofrutocinase na glicólise.
Solução:
Hexokinase - auxilia na fosforilação da glicose.

Questão 7.
Cite a enzima que catalisa a fosforilação da glicose.
Solução:
A formação de acetil CoA ocorre na matriz mitocondrial.

Questão 8.
Onde ocorre a formação de acetil CoA em uma célula?
Solução:
A primeira etapa do ciclo de Krebs é a condensação de um grupo acetil (acetil CoA) com ácido oxaloacético (OAA) para formar ácido cítrico e liberar a Coenzima A.

Questão 9.
Qual é a primeira etapa da reação no ciclo do TCA?
Solução:
Os ácidos graxos podem ser convertidos em acetil CoA antes de partirem dos substratos respiratórios.

Questão 10.
O que é fermentação alcoólica?
Solução:
A fermentação alcoólica é o processo pelo qual as células de levedura quebram a glicose em álcool etílico e dióxido de carbono sob condições anaeróbicas.

Questão 11.
Cite a via oxidativa pela qual os metabólitos intermediários de glicose, ácidos graxos e aminoácidos são finalmente oxidados.
Solução:
36 ATP / 38 moléculas de ATP são obtidas no processo de respiração e estão relacionadas ao tipo de respiração aeróbia.

Questão 12.
O que é fermentação de ácido láctico? (Outubro de 2001)
Solução:
É o processo de fermentação pelo qual a lactose encontrada no leite é convertida em ácido lático pela ação dos lactobacilos.

Questão 13.
Quais são as duas moléculas obtidas pela ação da aldolase a partir da frutose -1, -6-bifosfato?
Solução:
ATP é produzido.

RESPOSTA CURTA PERGUNTAS

Questão 1.
Como o gradiente de prótons é estabelecido?
Solução:
O gradiente de prótons é estabelecido pela passagem do próton (H +) da matriz através da membrana mitocondrial interna para o espaço intermembranar com a energia liberada durante as transferências de elétrons na ETC.

Questão 2.
Descreva as etapas na formação do ácido láctico a partir do ácido pirúvico.
Solução:
O ácido pirúvico é catalisado pela enzima desidrogenase láctica. O NADH formado na glicólise é usado para a redução.

Questão 3.
Como o ATP é formado pela energia liberada durante o sistema de transporte de elétrons na mitocôndria?
Solução:
As formações de ATP requerem uma enzima chamada ATP sintase. Possui dois componentes F0& # 8211 F1. A ATP- sintase torna-se ativa na formação de ATP quando a concentração de H + no Fo lado é mais alto que o F1 lado. A concentração de prótons oscilante na câmara externa faz com que o próton passe pela câmara interna. F1 partícula induzida pelo fluxo de próton através de Fo canal. A energia do gradiente de prótons liga a radícula de fosfato ao ADP. Isso produz ATP.

Questão 4.
Dê uma descrição detalhada do ganho líquido de ATP em diferentes estágios da respiração.
Solução:

Na maioria das células eucarióticas, 2 moléculas de ATP são necessárias para transportar o NADH produzido na glicólise para a mitocôndria para posterior oxidação. Portanto, o ganho líquido de ATP é de 36 moléculas.

Questão 5.
Enumere as funções do ATP.
Solução:
Funções do ATP: -
(eu) O ATP funciona como um transportador universal de energia de sistemas vivos.
(ii) O ATP armazena pequenos pacotes de energia em suas moléculas.
(iii) É móvel na célula. Portanto, atinge todas as partes da célula longe da região de síntese de ATP.
(4) Ele ativa uma série de produtos químicos ao funcionar como um agente fosforilador.
(v) O ATP fornece energia para a contração muscular.
(vi) Ele está envolvido no transporte de substâncias contra um gradiente de concentração.

Questão 6.
Onde está localizado o citocromo c? Qual é a sua função?
Solução:
O citocromo c está localizado na superfície externa da membrana mitocondrial interna. Ele atua como um portador móvel para a transferência de elétrons entre o complexo III e o complexo IV do sistema de transporte de elétrons.

Questão 7.
Defina o quociente respiratório.
Solução:
O quociente respiratório é definido como a relação entre o volume de dióxido de carbono evoluído e o volume de oxigênio consumido na respiração.

Questão 8.
O que é fosforilação oxidativa?
Solução:
Todo o processo pelo qual o oxigênio permite efetivamente a produção de ATP por fosforilação do ADP é denominado fosforilação oxidativa.

Questão 9.
O rendimento de energia em termos de ATP é maior na respiração aeróbica do que durante a respiração anaeróbica. Por que existe respiração anaeróbica mesmo em organismos que vivem em condições aeróbicas como seres humanos e angiospermas?
Solução:
Os organismos aeróbicos enfrentam situações em que a disponibilidade de oxigênio é pequena. Por exemplo, músculos sobrecarregados não recebem oxigênio suficiente durante exercícios extenuantes. Da mesma forma, os tecidos profundamente arraigados das angiospermas não recebem oxigênio suficiente por meio da difusão externa. Nessas situações, apenas a respiração anaeróbia pode ajudar na sobrevivência do tecido.

Questão 10.
Comente a afirmação- “A respiração é um processo de produção de energia, mas o ATP é usado em algumas etapas do processo”.
Solução:
O ATP é necessário em todas as reações em que a ativação fosforilativa do substrato é necessária. Portanto, apesar de produzir energia (como ATP), a respiração requer ATP em certas etapas, por exemplo, glicose e # 8211 glicose 6-fosfato, frutose 6-fosfato - frutose 1, 6-bifosfato.

PERGUNTAS PARA RESPOSTA LONGA

Questão 1.
Explique as principais etapas do ciclo de Krebs. Por que esse ciclo também é chamado de ciclo do ácido cítrico?
Solução:
Ciclo de Krebs: Este processo ocorre na matriz mitocondrial.
As principais etapas do ciclo de Krebs são as seguintes:

  • O acetil Co-A, formado pela descarboxilação oxidativa do ácido pirúvico, entra no ciclo de Krebs.
  • Ele se combina com o ácido oxaloacético (OAA), um composto 4C, para formar um composto 6C, ácido cítrico, a reação é catalisada pela citrato sintase.
  • O citrato é então isomerizado em isocitrato.
  • O isocitrato é convertido em ácido oxalosuccínico na presença de NAD e isocitrato desidrogenase.
  • O ácido oxalosuccínico é então descarboxilado em ácido a-cetoglutárico (KG), na presença de uma enzima descarboxilase.
  • o ácido a-cetoglutárico é convertido em succinil Co-A na presença de NAD, Co-A e da enzima a-cetoglutarato desidrogenase.
  • Quando o succinil Co-A é convertido em ácido succínico, uma molécula de GTP é formada e o Co-A é liberado.
  • Na parte restante do ciclo, o ácido succínico é convertido em OAA, para que o ciclo do ácido cítrico possa continuar a operar.
  • Durante este ciclo, três moléculas de NAD e uma molécula de FAD são reduzidas a NADH e FADH respectivamente.
  • Este ciclo é chamado de ciclo do ácido cítrico porque o primeiro produto é o ácido cítrico, que é um composto 3-C.

Questão 2.
Nomeie o produto final da glicólise. Onde é produzido na célula? Discuta a descarboxilação oxidativa.
Solução:
A glicólise resulta na formação de duas moléculas de ácido pirúvico, NADH e ATP. Ocorre no citosol da célula.
Oxidação aeróbica: Um dos três carbonos do ácido pirúvico é oxidado a dióxido de carbono na reação chamada descarboxilação oxidativa. O ácido pirúvico é primeiro descarboxilado e depois oxidado pela enzima pirúvica desidrogenase. As unidades de dois carbonos são prontamente aceitas pela coenzima-A (Co-A) para formar acetil Co-A. O resumo da reação é dado na seguinte equação:

Assim, o ácido pirúvico entra no ciclo de Krebs como acetil Co-A. O ciclo de Krebs ocorre na matriz mitocondrial.
O acetil Co-A, formado pela descarboxilação oxidativa do ácido pirúvico, entra no ciclo de Krebs.

Questão 3.
Representam esquematicamente a inter-relação entre as vias metabólicas em uma planta, mostrando a repartição mediada pela respiração de diferentes compostos orgânicos.
Solução:
Representação esquemática entre as vias metabólicas mostrando a decomposição mediada pela respiração de diferentes moléculas orgânicas em CO2 e H2O:

Questão 4.
Como as plantas gerenciam a troca de gases? Dê uma visão geral da respiração nas plantas.
Solução:
As plantas, ao contrário dos animais, não têm órgãos especializados para a troca gasosa, mas têm estômatos e lenticelas para esse fim. Existem várias razões pelas quais as plantas podem sobreviver sem órgãos respiratórios.

  • Cada parte da planta cuida de suas próprias necessidades de troca gasosa. Há muito pouco transporte de gases de uma parte da planta para outra.
  • As plantas não apresentam grandes demandas de troca gasosa. As raízes caem e saem respirando em uma taxa mais baixa do que os animais.
  • Somente durante a fotossíntese, grandes volumes de arrendamentos trocaram e, cada folha está bem adaptada para atender suas próprias necessidades durante esses períodos.
  • Quando as células realizam fotossíntese, a disponibilidade de O2 não é um problema nessas células, pois 02 é libertado
  • A distância que os gases devem se difundir, mesmo em plantas grandes e volumosas, não é grande. Cada célula viva de uma planta está localizada bem próxima à superfície da planta.
  • Mesmo em caules lenhosos, as células "vivas" são organizadas em camadas finas dentro e abaixo da casca. Eles também têm aberturas chamadas lenticelas. As células no interior estão mortas e fornecem apenas suporte mecânico.
  • Assim, a maioria das células de uma planta atestou que uma parte de sua superfície está em contato com o ar. Isso também é facilitado pelo empacotamento solto de células do parênquima nas folhas, caules e raízes, que fornecem uma rede interconectada de espaços aéreos.
  • A combustão completa da glicose, que produz C02 e H20 como produtos finais, produz energia. A maior parte da energia é distribuída como calor.
    C6H12O6 + 6O2 → 6C02 + 6H20 + energia
  • Para que essa energia seja útil para a célula, ela deve ser capaz de utilizá-la para sintetizar outras moléculas de que a célula necessita.
  • A estratégia que a célula vegetal usa é catabolizar a molécula de glicose de tal forma que nem toda a energia liberada saia na forma de calor.
  • A chave é oxidar a glicose não em uma etapa, mas em várias pequenas etapas, permitindo que algumas etapas sejam grandes o suficiente para que a energia liberada possa ser acoplada à síntese de ATP.

Esperamos que as Soluções NCERT para Biologia Classe 11 no Trabalho, Capítulo 14 Respiração em Plantas, ajude você. Se você tiver qualquer dúvida em relação às Soluções NCERT para Biologia da Classe 11 em Ação, Capítulo 14 Respiração em Plantas, deixe um comentário abaixo e entraremos em contato com você o mais breve possível.


Como evoluiu a diversidade entre a fermentação do etanol e a fermentação do ácido lático? - Biologia

Diversidade do metabolismo em procariotos (página 1)

Muita agitação é feita sobre a diversidade microbiana. Os eucariotos unicelulares (protistas) exibem uma boa quantidade de diversidade estrutural, mas os procariotos (bactérias e arquéias) carecem dessa distinção. Existem apenas algumas morfologias básicas, as possibilidades de motilidade e células em repouso (esporos) e uma coloração diferencial principal (a coloração de Gram) que diferencia os procariotos microscopicamente. Então, por que tanto alvoroço em relação aos procariotos? É sobre bioquímica ou diversidade metabólica, especialmente no que se refere ao metabolismo de geração de energia e biossíntese de metabólitos secundários. Os procariotos, como um grupo, conduzem todos os mesmos tipos de metabolismo básico que os eucariotos, mas, além disso, existem vários tipos de metabolismo gerador de energia entre os procariotos que não existem nas células ou organismos eucariotas. A diversidade dos procariotos é expressa por sua grande variação nos modos de geração de energia e metabolismo, e esta característica permite que os procariotos floresçam em todos os habitats adequados para a vida na Terra.

Mesmo dentro de uma espécie procariótica, pode haver grande versatilidade no metabolismo. Considerar Escherichia coli. A bactéria pode produzir energia para o crescimento por fermentação ou respiração. Ele pode respirar aerobicamente usando O2 como um aceptor final de elétrons, ou pode respirar sob condições anaeróbicas, usando NO3 ou fumarato como um aceitador de elétron terminal. E. coli pode usar glicose ou lactose como única fonte de carbono para o crescimento, com a capacidade metabólica de transformar o açúcar em todos os aminoácidos, vitaminas e nucleotídeos necessários que compõem as células. Um parente de E. coli, Rhodospirillum rubrum, tem todas as capacidades heterotróficas como E. coli, mais a capacidade de crescer por meios fotoautotróficos, foto-heterotróficos ou litotróficos. Ele requer um fator de crescimento, no entanto, a biotina deve ser adicionada ao seu meio de crescimento.

Fundamentalmente, a maioria dos eucariotos produz energia (ATP) através da fermentação de álcool (por exemplo, levedura), fermentação de ácido láctico (por exemplo, células musculares, neutrófilos), respiração aeróbica (por exemplo, bolores, protozoários, animais) ou fotossíntese oxigenada (por exemplo, algas, plantas). Esses modos de metabolismo de geração de energia existem entre os procariotos, além de todos os seguintes tipos de produção de energia, que são virtualmente inexistentes nos eucariotos.

Fermentações únicas continuando pela via Embden-Meyerhof

Outras vias de fermentação como a fosfocetolase (heterolática) e as vias de Entner-Doudoroff

Respiração anaeróbica: respiração que usa outras substâncias além de O2 como um aceitador de elétron final

Litotrofia: uso de substâncias inorgânicas como fontes de energia

Fotoheterotrofia: uso de compostos orgânicos como fonte de carbono durante a fotossíntese bacteriana

Fotossíntese anoxigênica: fotofosforilação na ausência de O2

Metanogênese: um tipo antigo de metabolismo arqueano que usa H2 como fonte de energia e produz metano

Fotofosforilação não fotossintética impulsionada pela luz: metabolismo arqueano único que converte a energia da luz em energia química

Além disso, entre os procariotos autotróficos, existem três maneiras de corrigir o CO2, dois dos quais são desconhecidos entre os eucariotos, os CODH (via da acetil CoA) e a ciclo reverso do TCA.

Metabolismo de geração de energia O termo metabolismo refere-se à soma das reações bioquímicas necessárias para a geração de energia E o uso da energia para sintetizar o material celular a partir de pequenas moléculas no ambiente. Portanto, o metabolismo tem um componente gerador de energia, chamado catabolismo, e um consumidor de energia, componente biossintético, chamado anabolismo. Reações catabólicas ou sequências produzem energia como ATP, que pode ser utilizado em reações anabólicas para construir material celular a partir de nutrientes do meio ambiente. A relação entre catabolismo e anabolismo é ilustrada na Figura 1 abaixo.
Figura 1. A relação entre catabolismo e anabolismo em uma célula. Durante o catabolismo, a energia é alterada de uma forma para outra e, de acordo com as leis da termodinâmica, tais transformações de energia nunca são completamente eficientes, ou seja, alguma energia é perdida na forma de calor. A eficiência de uma sequência catabólica de reações é a quantidade de energia disponibilizada à célula (para o anabolismo) dividida pela quantidade total de energia liberada durante as reações.

Durante o catabolismo, a energia útil é temporariamente conservada na "ligação de alta energia" de ATP - trifosfato de adenosina. Não importa a forma de energia que uma célula usa como sua fonte primária, a energia é finalmente transformada e conservada como ATP - a moeda universal de troca de energia em sistemas biológicos. Quando a energia é necessária durante o anabolismo, ela pode ser gasta como a ligação de alta energia do ATP, que tem um valor de cerca de 8 kcal por mol. Portanto, a conversão de ADP em ATP requer 8 kcal de energia, e a hidrólise de ATP em ADP libera 8 kcal.


Figura 2. A estrutura do ATP. O ATP é derivado do nucleotídeo adenosina monofosfato (AMP) ou ácido adenílico, ao qual dois grupos fosfato adicionais são ligados por meio de ligações de pirofosfato (

P). Essas duas ligações são ricas em energia no sentido de que sua hidrólise produz muito mais energia do que uma ligação covalente correspondente. O ATP atua como uma coenzima em reações de acoplamento energético em que um ou ambos os grupos fosfato terminais são removidos da molécula de ATP com a energia de ligação sendo usada para transferir parte do ATP para outra molécula para ativar seu papel no metabolismo. Por exemplo, glicose + ATP ----- & gt Glicose-P + ADP ou Aminoácido + ATP ----- & gtAMP-Aminoácido + PPi.

Por causa do papel central do ATP no metabolismo de geração de energia, espere ver seu envolvimento como uma coenzima na maioria dos processos de produção de energia nas células.


Baixe Agora!

Nós facilitamos para você encontrar um PDF Ebooks sem qualquer escavação. E tendo acesso aos nossos e-books online ou armazenando-os em seu computador, você tem respostas convenientes com o Guia de Estudo de Biologia, Fermentação e Respiração Celular. Para começar a encontrar Fermentation And Cell Respiration do Guia de Estudo de Biologia, você está certo em encontrar nosso site, que tem uma coleção abrangente de manuais listados.
Nossa biblioteca é a maior delas, com literalmente centenas de milhares de produtos diferentes representados.

Finalmente recebo este e-book, obrigado por todos esses Fermentation And Cell Respiration Guia de estudo de biologia que posso obter agora!

Eu não pensei que isso iria funcionar, meu melhor amigo me mostrou este site, e funciona! Eu recebo meu e-book mais procurado

wtf este grande ebook de graça ?!

Meus amigos estão tão bravos que não sabem como eu tenho todos os e-books de alta qualidade, o que eles não sabem!

É muito fácil obter e-books de qualidade)

tantos sites falsos. este é o primeiro que funcionou! Muito Obrigado

wtffff eu não entendo isso!

Basta selecionar seu clique e, em seguida, o botão de download e concluir uma oferta para iniciar o download do e-book. Se houver uma pesquisa que leve apenas 5 minutos, tente qualquer pesquisa que funcione para você.


2. MATERIAIS E MÉTODOS

2.1 Organismo e condições de fermentação

LAB usado neste estudo foram L. lactis subsp. cremoris MG1363, L. lactis subsp. lactis IL1403, S. thermophilus LMG 18311 e L. mesenteroides subsp. cremoris ATCC 19254. Meio quimicamente definido (CDM) descrito por (Otto et al., 1983) e modificado por (Poolman & Konings, 1988) foi usado para a preparação do inóculo e para as fermentações (para a lista completa de componentes, consulte Apoio Arquivo de informações-1, Tabela S1), e o CDM foi esterilizado por filtro com filtros de 0,22 µm. Os experimentos de fermentação foram realizados em condições anaeróbicas em um biorreator de tanque agitado de 1 L (Biostat Q, B. Braun Biotech International) com um volume de trabalho de 0,6 L a temperatura constante e sem controle de pH (pH inicial 6,8). A co-cultura de duas espécies de L. lactis subsp. cremoris e Leu. mesenteroides, e a co-cultura de três espécies de L. lactis subsp. cremoris, L. lactis subsp. lactis e Leu. mesenteroides foram assumidos para representar culturas starter de queijo mesofílico, enquanto a co-cultura de duas espécies de L. lactis subsp. cremoris e S. thermophilus, e a co-cultura de três espécies de L. lactis subsp. cremoris, L. lactis subsp. lactis e S. thermophilus foram assumidos para representar culturas de fermento de queijo termofílico. Culturas puras de L. lactis, Leu. mesenteroides, e S. thermophilus as cepas foram fermentadas a 30 ° C, 30 ° C e 37 ° C, respectivamente, enquanto as co-culturas mesofílicas e termofílicas foram cultivadas a 30 ° C e 33 ° C, respectivamente. O meio de fermentação foi lavado com N esterilizado por filtro2 até que o oxigênio dissolvido caísse a zero antes da inoculação, e não houvesse fornecimento de gás após a inoculação. A manutenção das condições anaeróbias foi assumida com mistura lenta (50 rpm). Para ambas as culturas puras e co-culturas, o biorreator foi inoculado com cultura de inóculo a 2% (vol / vol) cultivada até a fase exponencial tardia. As composições de biomassa iniciais das co-culturas, com base em medições de densidade óptica (OD), foram 1: 1 (OD: OD) e 1: 1: 1 (OD: OD: OD) para co-culturas de duas e três espécies, respectivamente . Para cada experimento de lote diferente (puro e co-culturas), duas réplicas de cultura independentes foram executadas.

2.2 Técnicas analíticas

A concentração de biomassa foi determinada usando medições de DO da cultura de fermentação a 600 nm, que foi então correlacionada com o peso seco da biomassa (gDW). As amostras de cultura foram centrifugadas a 10.000g por 10 min, e o sobrenadante livre de células foi usado para análises de glicose, ácidos orgânicos e aminoácidos. Amostras de biomassa de co-culturas foram imediatamente armazenadas a −20 ° C até a análise da abundância microbiana relativa. A concentração de glicose foi determinada pela análise de açúcares redutores usando o método DNS (Miller, 1959). As concentrações de ácidos orgânicos e aminoácidos foram determinadas por cromatografia líquida de alto desempenho, conforme descrito anteriormente (Özcan et al., 2019). CO2 perfis de produção de L. lactis e S. thermophilus cepas que mostram padrões de fermentação homolática foram consideradas insignificantes em comparação com o fluxo total de carbono em condições anaeróbias, como também afirmado na literatura (Jensen et al., 2001). Concentração molar de etanol e CO2 produzido por Leu. mesenteroides foram estimados com base nas taxas de consumo de glicose e citrato conforme descrito em nosso estudo anterior (Özcan et al., 2019).

2.3 Estimativa da abundância microbiana relativa em co-culturas

O método de PCR quantitativo (qPCR) foi empregado para quantificar as taxas de abundância microbiana relativa de diferentes cepas bacterianas durante a co-cultura. As concentrações de peso seco celular total das co-culturas foram multiplicadas pelas razões de abundância microbiana relativa para estimar as concentrações de biomassa individuais. A extração do DNA foi realizada com o kit peqGOLD Bacterial DNA (Peqlab, VWR), de acordo com o protocolo do fabricante, a partir de 3 ml de cultura. Os primers usados ​​para o procedimento qPCR (Tabela 1) são específicos para genomas alvo e iTaq Universal SYBR Green Supermix (Bio-Rad). O seguinte protocolo de PCR foi usado para todas as amostras: desnaturação inicial a 95 ° C por 5 min, 40 ciclos de 95 ° C por 15 s, 62 ° C por 30 se uma análise da curva de fusão com incrementos de 0,5 ° C / 5 s de 65 ° C a 95 ° C usando o CFX96 Touch Real-Time PCR Detection System (Bio-Rad).

Sequências de primer forward Sequências de primer reverso Tamanho do produto PCR Referências
L. lactis subsp. cremoris MG1363 GTGCTTGCACCAATTTGAA GGGATCATCTTTGAGTGAT 163 Pu et al. (2002)
L. lactis subsp. lactis IL1403 GTACTTGTACCGACTGGAT GGGATCATCTTTGAGTGAT 163 Pu et al. (2002)
S. thermophilus LMG 18311 CGGGTGAGTAACGCGTAGGT CGCCTAGGTGAGCCATTACC 177 Este estudo
Leu. mesenteroides ATCC 19254 CCGCATCTTCACGGGTATTT AGTTTCGGCGAAGGTACGAA 173 Este estudo

2.4 Modelos metabólicos em escala de genoma (GSMMs) usados ​​neste estudo

O modelo metabólico em escala do genoma (GSMM) de Leu. mesenteroides ATCC 19254 (Özcan et al., 2019), L. lactis subsp. cremoris MG1363 (Flahaut et al., 2013) e a versão revisada de S. thermophilus LMG 18311 (Pastink et al., 2009), que foram as mesmas cepas usadas nos experimentos, foram usadas neste estudo. O GSMM de L. lactis subsp. cremoris MG1363 (Flahaut et al., 2013) foi usado para simular os dados experimentais de ambos L. lactis subsp. cremoris e L. lactis subsp. lactis. Além do uso de parâmetros específicos da cepa, auxotrofia de aminoácidos de L. lactis subsp. lactis também foi considerado para a simulação desta cepa. As reações de troca de arginina, glutamina, histidina, isoleucina, leucina, metionina e valina foram restringidas de tal forma que o modelo só pode consumir esses aminoácidos para a simulação de L. lactis subsp. lactis, Porque L. lactis subsp. lactis IL1403 é conhecido por ser incapaz de sintetizar esses aminoácidos (Aller et al., 2014 Cocaign-Bousquet et al., 1995 van Niel & Hahn-Hägerdal, 1999). O GSMM de S. thermophilus LMG 18311 (Pastink et al., 2009) foi revisado através das seguintes etapas: (i) o rascunho do GSMM de S. thermophilus LMG 18311 foi reconstruído usando a sequência do genoma de S. thermsophilus LMG 18311 (Bolotin et al., 2004 número de acesso GenBank GCA_000011825.1) por MetaDraft (BG Olivier 2018. [Online], https://systemsbioinformatics.github.io/metadraft) (ii) o novo conjunto de reação foi comparado com aquele do modelo original e as reações disponíveis apenas no novo modelo de rascunho foi adicionado ao modelo original para obter o GSMM revisado de S. thermophilus LMG 18311. O GSMM revisado de S. thermophilus LMG 18311 contendo 829 reações entre 886 metabólitos governados por 429 genes está disponível no formato SBML em Supporting Information File-3. As taxas de manutenção de ATP não associadas ao crescimento usadas nos GSMMs foram obtidas a partir de estudos de modelos originais (Flahaut et al., 2013 Oliveira et al., 2005 Özcan et al., 2019 Pastink et al., 2009). Para a simulação das culturas no final do lote, a baixa taxa de captação de glicose pode não suportar a taxa de manutenção de ATP original (mATP) restrições, o que resulta em uma solução inviável. Nesses casos, devido a fins de modelagem, diminuímos gradualmente o mATP valor de 0,1 mmol / gDW / h até que uma solução viável foi obtida. Essa diminuição em mATP também foi recentemente demonstrado em um estudo, onde L. lactis e Leu. mesenteroides foram cultivadas em um reator retentostat como uma co-cultura, e mATP os valores de ambas as espécies diminuíram em baixas taxas de crescimento em comparação com altas taxas de crescimento (van Mastrigt et al., 2019).

2.5 A modelagem metabólica dinâmica de culturas puras e coculturas

Perfis de concentração de biomassa e metabólitos extracelulares de culturas em lote foram simulados por abordagens de modelagem metabólica dinâmica. A abordagem de análise de equilíbrio de fluxo dinâmico baseada em otimização estática (dFBA) (Mahadevan et al., 2002) foi aplicada para a cultura pura de L. lactis subsp. cremoris, L. lactis subsp. lactis, S. thermophilus e Leu. mesenteroides, enquanto a abordagem de modelagem metabólica de cocultura dinâmica (Hanemaaijer et al., 2017 Zhuang et al., 2011, 2012), que é uma abordagem dFBA adaptada para sistemas multiespécies, foi aplicada para as coculturas (Figura 1). Em modelos dinâmicos, os balanços de massa diferenciais foram escritos para os seguintes metabólitos extracelulares: os metabólitos medidos experimentalmente (glicose, ácidos orgânicos e aminoácidos), outros metabólitos no meio de fermentação (vitaminas e ácidos nucléicos) e os metabólitos que são conhecidos por serem produzidos (compostos de sabor).

(1) (2) (3) (4)

A distribuição do fluxo metabólico nos modelos dinâmicos foi calculada por duas otimizações sequenciais. O primeiro é um problema de programação linear (LP) (ou seja, análise de balanço de fluxo, FBA Orth et al., 2010) que maximiza a taxa de crescimento restringindo os modelos com a fonte de carbono e as taxas de utilização de aminoácidos, e a otimização secundária é um problema de programação quadrática (QP) que minimiza a soma total dos fluxos absolutos.O QP aplicado nas análises de fluxo como uma otimização secundária após LP é baseado no princípio do uso mínimo de recursos enzimáticos para atingir o objetivo primário, e também ajuda a evitar o problema de ótimo alternativo (Lewis et al., 2010 Tarlak et al. , 2014). As análises de fluxo metabólico foram realizadas usando COBRA Toolbox (Schellenberger et al., 2011) em ambiente MATLAB, com Gurobi6 (http://www.gurobi.com) como o solucionador de otimização. Os conjuntos de equações diferenciais ordinárias (EDO) em modelos dinâmicos foram resolvidos por ode45, que é uma função MATLAB baseada no método numérico de Runge-Kutta. Por fim, as concentrações iniciais de biomassa e metabólitos obtidas experimentalmente foram utilizadas como condições iniciais para a solução dos conjuntos de ODE.

Os parâmetros da cinética de absorção do substrato na Equação (1) foram estimados dinamicamente pela ferramenta de otimização MEIGO (Egea et al., 2014). Os parâmetros cinéticos específicos da cepa foram estimados usando os experimentos de cultura pura, e foram usados ​​nos modelos puro e em co-cultura.


História e bioquímica de alimentos fermentados

Enquanto o processo de fermentação antecede significativamente o surgimento de nossa espécie, os humanos têm aproveitado essa tecnologia microbiana para a produção e preservação de alimentos por milhares de anos. Em muitos casos, alimentos fermentados específicos podem atuar como um marcador de identidade cultural e talvez nos levar de volta aos sabores e cheiros da cozinha da vovó. Aqui, vamos mergulhar na história e na ciência dos alimentos fermentados.

Parte de um antigo artefato egípcio que descreve o cultivo da uva e a produção de vinho. Fonte: Ägyptischer Maler um 1500 v. Chr. [Domínio público], via Wikimedia Commons

Uma breve história

No sentido culinário, a fermentação é a transformação e preservação dos alimentos por bactérias. Embora o processo de fermentação como prática culinária remonte aos primórdios da civilização humana, demorou muito para que os princípios científicos fossem compreendidos (1). No entanto, estudos arqueológicos têm mostrado que as tecnologias de fermentação eram componentes bem estabelecidos de civilizações antigas, e há até evidências de que o conceito de culturas “iniciadoras” foi amplamente apreciado e mantido (2-5). A tabela abaixo destaca alguns marcos da fermentação no contexto da antropologia culinária:

Marcos de fermentação selecionados ao longo da história humana. Tabela adaptada de “The History of Fermented Foods.” (2)

The Dawn of Bioquímica

Um Louis Pasteur não tão jovem

Apesar da incrível e rica história antropológica em torno do uso da fermentação para a preservação de alimentos, foi só em tempos mais “recentes” que começamos a aprender que a fermentação era um processo metabólico inerente aos microrganismos. À medida que as sementes da microbiologia foram semeadas com a descoberta da bactéria por Antonie Van Leeuwenhoek (1683), o empreendimento científico moderno começou a tomar forma, e a fermentação estava no centro desse movimento. A princípio, presumia-se que a decomposição e morte de microrganismos davam origem aos alimentos fermentados, conforme teorizado pelo químico alemão Justus Von Liebig (6). Porém, em 1857, um jovem cientista francês chamado Louis Pasteur fez uma observação interessante que desafiou essa noção & # 8212 e foi tudo por causa de um problema com a produção industrial de uma bebida alcoólica (7).

O suco de beterraba é uma bebida historicamente fermentada

Um ano antes de Pasteur publicar essas importantes observações, ele foi abordado por um industrial de Lille, Monsieur Bigo, que fabricava álcool com suco de beterraba. Muitos tonéis de suco de beterraba Bigo não estavam sendo convertidos em álcool & # 8212, em vez disso, o suco estava azedando (mais parecido com vinagre). Este fenômeno ameaçou seu negócio, então Pasteur veio investigar.

Pasteur, em parte, usou a microscopia para entender a base química e biológica dos alimentos fermentados

Usando um microscópio, Pasteur examinou amostras de cubas bem-sucedidas (contendo álcool) e notou a presença de belos glóbulos de gordura. No entanto, ao olhar para as amostras ácidas, ele viu apenas partículas finas e alongadas. Por meio de um estudo mais aprofundado, ele também concluiu que a amostra ácida continha ácido acético, que definitivamente não é álcool!

Para ajudar a entender essa diferença, ele caracterizou o álcool produzido à medida que o suco de beterraba era fermentado com "sucesso", e Pasteur descobriu que esse composto era opticamente ativo. Ele já vinha estudando estereoquímica há vários anos, e suas observações anteriores sugeriam que todos os compostos orgânicos com atividade óptica eram formados por organismos vivos (8). Assim, ele chegou à conclusão de que as células vivas eram responsáveis ​​pelo processo metabólico de fermentação:

As mudanças químicas da fermentação estão associadas a uma atividade vital, começando e terminando com esta. Acredito que a fermentação alcoólica nunca ocorre sem a organização, desenvolvimento e multiplicação simultânea das células ou a continuidade da vida das células já formadas. Todos os resultados neste artigo me parecem completamente opostos às opiniões de Liebig e Berzelius & # 8230Agora & # 8230 em que consiste o ato químico de decompor o açúcar e qual é sua causa precisa? Confesso que simplesmente não sei. & # 8212 Louis Pasteur (8)

Pasteur usou frascos com pescoço de cisne (à direita) para demonstrar que as partículas vivas do ar eram uma fonte de contaminação, em vez da teoria anteriormente sustentada de geração espontânea

Pasteur continuou estudando a fermentação e descobriu que o fermento transforma os açúcares em álcool e que o efeito “acidificante” do suco de beterraba era o resultado da contaminação com uma espécie bacteriana capaz de converter o etanol em ácido acético. Para eliminar possíveis contaminantes bacterianos, Pasteur foi o pioneiro em uma técnica em que as amostras eram aquecidas a uma temperatura específica por um determinado período de tempo. Este processo, conhecido como pasteurização, ainda é amplamente utilizado hoje.

Embora ainda houvesse muito a aprender, os principais princípios do trabalho de Pasteur sobre a fermentação foram inovadores. Com base nessa história científica estava Moritz Traube, um químico alemão que em 1877 propôs que a fermentação era uma cascata de eventos químicos em que o oxigênio é transferido de uma parte de uma molécula de açúcar para outra, resultando em um produto altamente oxidado (CO2 ) e um produto altamente reduzido ( ou seja, álcool). Além disso, Traube sugeriu que cada evento químico na sequência de fermentação é catalisado por uma substância semelhante a uma proteína (aludindo a enzimas), fornecendo informações notáveis ​​sobre a química celular muito antes de outras no campo (1). Vinte anos depois, Eduard Buchner, também químico alemão, demonstrou que a sacarose poderia ser fermentada em álcool por extratos de levedura, criando o termo “zimase” para descrever o composto celular que catalisa essa conversão. O trabalho de Buchner foi digno do Prêmio Nobel de Química de 1907, e ele modificou o modelo de Pasteur para enfatizar a ideia de que a fermentação é uma função das células vivas, mas não necessariamente da divisão. Além disso, Buchner mostrou que a fermentação é uma cadeia de eventos, com cada etapa catalisada por uma enzima diferente (9).

Por meio de seu trabalho no processo científico de fermentação, Pasteur, Traube, Buchner e muitos outros abriram caminho para o estudo da química da vida, também conhecida como bioquímica, abrindo todo um campo científico.

Fermentação: La vie sans l’air

Do ponto de vista bioquímico, a fermentação é um processo metabólico por meio do qual compostos orgânicos são convertidos em energia, sem o envolvimento de um agente oxidante. Como Louis Pasteur sugeriu sucintamente, a fermentação é “ la vie sans l’air, ”Ou“ vida sem ar ”. No entanto, a fermentação não é tamanho único. Na verdade, existe uma diversidade incrível quando se trata de processos de fermentação, já que diferentes microrganismos abrigam diferentes mecanismos para a conversão de glicose em energia.

No centro da respiração celular, que pode incluir a fermentação, está o processo altamente conservado da glicólise. Por meio dessa reação de dez etapas, uma molécula de glicose é dividida em duas moléculas de piruvato. A glicólise não requer oxigênio e é encontrada em todos os organismos vivos da Terra, sugerindo que foi uma das primeiras vias bioquímicas a evoluir. O destino do piruvato, entretanto, é ditado pela presença ou ausência de oxigênio. Quando o oxigênio, um aceptor de elétrons, está presente, o piruvato se desloca para as vias de respiração celular aeróbia & # 8212 o ciclo de Krebs e a cadeia de transporte de elétrons & # 8212 para gerar ATP. Na ausência de oxigênio, entretanto, as moléculas de piruvato entrarão na cascata de fermentação.

Alguns microrganismos desenvolveram um nível de flexibilidade metabólica, permitindo-lhes alternar entre a respiração aeróbia e a fermentação. Como tal, esses microrganismos são classificados como anaeróbios facultativos. No entanto, outros microrganismos são envenenados por oxigênio e só podem sofrer respiração anaeróbica. Nesse caso, os microrganismos são anaeróbios obrigatórios. Tanto para anaeróbios facultativos quanto para anaeróbios obrigatórios, o processo de fermentação serve para reciclar os produtos da reação glicolítica, garantindo que as células possam continuar produzindo ATP.

Considere a fórmula para glicólise:

Quando o oxigênio não está presente, a glicólise é o principal mecanismo de produção de energia, gerando 2 moléculas líquidas de ATP por molécula de glicose. Além de ter acesso a um açúcar, a glicólise requer a coenzima nicotinamida adenina dinucleotídeo (NAD). Especificamente, a enzima glicolítica gliceraldeído fosfato desidrogenase (GAPDH) requer NAD + como cofator, que é reduzido a NADH durante a reação enzimática. No entanto, as células não têm um suprimento ilimitado de NAD +, o que representa um problema para a produção de energia. Portanto, é realmente importante que as células tenham um mecanismo que oxide o NADH de volta a NAD +. Em muitos organismos, isso é realizado por fermentação.

As aplicações da química da fermentação são muitas e variadas e vão além da cozinha. No entanto, para os fins desta discussão, iremos focar nas reações de fermentação aproveitadas para funções culinárias, nomeadamente a produção de ácido láctico e etanol.

Fermentação de ácido láctico

A conversão do piruvato em ácido lático ocorre diretamente por meio da ação enzimática da lactato desidrogenase. Nesta reação, o piruvato é reduzido a ácido láctico, enquanto o NAD + é regenerado e transportado de volta para a via glicolítica. o Lactobacillales A ordem, também conhecida como Bactéria do Ácido Lático (LAB), é uma coleção de bactérias Gram-positivas que produzem ácido láctico no final das cascatas de fermentação de carboidratos. Muitas espécies de LAB são aproveitadas para a fermentação de alimentos, uma vez que a acidificação do ambiente de crescimento (leite, salmoura, etc) impede o crescimento de outros microorganismos que podem “estragar” os alimentos. Como tal, a fermentação do ácido láctico tem sido usada por inúmeras culturas durante séculos para a preservação de alimentos. Mais recentemente, a bactéria LAB demonstrou ser uma parte onipresente de um perfil de microflora saudável no trato intestinal humano, contribuindo para sua notoriedade. Alimentos comuns que contêm LAB são iogurte, kimchi, chucrute e cerveja lambic.

Fermentação de etanol

A transformação do piruvato em etanol e dióxido de carbono ocorre em duas etapas. Primeiro, o grupo carboxila é removido do piruvato pela piruvato descarboxilase para produzir acetaldeído e dióxido de carbono (esta etapa é a razão pela qual as bebidas alcoólicas podem ser carbonatadas). Em seguida, o acetaldeído é convertido em etanol por meio da ação de uma álcool desidrogenase, que produz NAD + em paralelo & # 8212, fornecendo um substrato necessário para que a glicólise continue. As leveduras são anaeróbios facultativos muito importantes, pois são muito eficazes na produção de etanol, permitindo que os humanos “se sintam agitados” ao ingerir bebidas como vinho e cerveja. Além disso, esse processo é essencial para panificação. Enquanto a maior parte do etanol é cozido no pão, a liberação de CO2 durante o processo de fermentação do etanol é o que torna os pães fofos.

Do ponto de vista culinário, isso cria uma oportunidade para criar uma vasta gama de produtos alimentícios e perfis de sabor. Muitos de nós já desfrutamos dos frutos do trabalho de microrganismos e estima-se que até um terço de todos os alimentos consumidos pelos humanos no planeta Terra são fermentados (10). Picles, azeitonas, pão, cerveja, vinho, chocolate, café, vinagre, molho de soja ... Todos esses alimentos deliciosos, assim como muitos, muitos outros tipos de fermentos, são o resultado do lançamento do piruvato em alguma cascata de fermentação. Às vezes, os fermentadores de cozinha utilizam um processo de “fermentação selvagem” no qual aproveitam a coleção natural de microorganismos presentes nos alimentos para criar um resultado culinário específico. Outras vezes, uma cultura inicial bem definida e caracterizada é usada para criar produtos alimentícios fermentados específicos. Deve ser mencionado que a fermentação também é útil em ambientes industriais, e muitas empresas de biotecnologia estão despejando recursos incríveis na pesquisa e desenvolvimento da fermentação industrial ( ou seja, biocombustível).

Independentemente da estratégia, é importante lembrar que os microrganismos na natureza não existem na monocultura & # 8212, o que significa que, em qualquer ambiente ecológico, há uma variedade de espécies de microrganismos vivendo e trabalhando juntas em resposta às suas condições ambientais.


Soluções adicionais de livros didáticos de ciências

Biologia: a unidade e a diversidade da vida (lista de cursos MindTap)

Biologia: The Dynamic Science (MindTap Course List)

Biologia Humana (lista de cursos MindTap)

Hereditariedade humana: princípios e questões (lista de cursos MindTap)

Biologia: a unidade e a diversidade da vida (lista de cursos MindTap)

Anatomia Cardiopulmonar e Fisiologia

Biologia (lista de cursos MindTap)

Química geral - livro independente (lista de cursos MindTap)

Oceanografia: um convite à ciência marinha, Versin de folha solta

Nutrição: conceitos e controvérsias - livro independente (lista de cursos MindTap)

Física para cientistas e engenheiros: fundamentos e conexões

Ciência Ambiental (Lista de Cursos MindTap)

Física para cientistas e engenheiros

Fundamentos da Astronomia (lista de cursos MindTap)

Fundamentos da Geografia Física

Física para cientistas e engenheiros com física moderna

Nutrição ao longo do ciclo de vida

Química Orgânica e Biológica

Química para hoje: geral, orgânica e bioquímica

Química introdutória: uma base

Química: Princípios e Reações

Ciência Ambiental (lista de cursos MindTap)

Química e reatividade química amp

Química Geral, Orgânica e Biológica

Introdução ao Geral, Orgânico e Bioquímica

Noções básicas sobre nutrição (lista de cursos MindTap)

Química para estudantes de engenharia

Química para estudantes de engenharia

Uma introdução à ciência física

Horizontes: Explorando o Universo (lista de cursos MindTap)

Química: uma primeira abordagem dos átomos

Física para cientistas e engenheiros, atualização tecnológica (sem códigos de acesso incluídos)


Fermentação

Muitas células são incapazes de realizar a respiração devido a uma ou mais das seguintes circunstâncias:

  1. A célula carece de uma quantidade suficiente de qualquer aceitador de elétrons final inorgânico apropriado para realizar a respiração celular.
  2. A célula carece de genes para fazer complexos apropriados e transportadores de elétrons no sistema de transporte de elétrons.
  3. A célula não tem genes para fazer uma ou mais enzimas no ciclo de Krebs.

Enquanto a falta de um aceptor final de elétrons inorgânico apropriado é ambientalmente dependente, as outras duas condições são determinadas geneticamente. Assim, muitos procariotos, incluindo membros do gênero clinicamente importante Estreptococo, são permanentemente incapazes de respirar, mesmo na presença de oxigênio. Por outro lado, muitos procariotos são facultativos, o que significa que, caso as condições ambientais mudem para fornecer um aceptor de elétrons final inorgânico apropriado para a respiração, os organismos contendo todos os genes necessários para fazer isso irão mudar para a respiração celular para o metabolismo da glicose porque a respiração permite um ATP muito maior produção por molécula de glicose.

Se a respiração não ocorrer, o NADH deve ser reoxidado em NAD + para reutilização como um transportador de elétrons para a glicólise, o único mecanismo da célula para a produção de ATP, para continuar. Alguns sistemas vivos usam uma molécula orgânica (comumente piruvato) como um aceitador de elétrons final por meio de um processo chamado fermentação. A fermentação não envolve um sistema de transporte de elétrons e não produz diretamente qualquer ATP adicional além do produzido durante a glicólise por fosforilação em nível de substrato. Os organismos que realizam a fermentação, chamados de fermentadores, produzem no máximo duas moléculas de ATP por glicose durante a glicólise. A Tabela 1 compara os aceitadores de elétrons finais e métodos de síntese de ATP na respiração aeróbia, respiração anaeróbica e fermentação. Observe que o número de moléculas de ATP mostrado para glicólise assume o Via Embden-Meyerhof-Parnas. O número de moléculas de ATP feitas por fosforilação em nível de substrato (SLP) contra fosforilação oxidativa (OP) são indicados.

Os processos de fermentação microbiana têm sido manipulados por humanos e são amplamente usados ​​na produção de vários alimentos e outros produtos comerciais, incluindo produtos farmacêuticos. A fermentação microbiana também pode ser útil para identificar micróbios para fins de diagnóstico.

A fermentação por algumas bactérias, como aquelas no iogurte e outros produtos alimentares azedos, e por animais nos músculos durante o esgotamento de oxigênio, é fermentação de ácido láctico. A reação química da fermentação do ácido láctico é a seguinte:

Bactérias de vários gêneros gram-positivos, incluindo Lactobacillus, Leuconostoc, e Estreptococo, são conhecidos coletivamente como os bactéria láctica (LAB), e várias cepas são importantes na produção de alimentos. No decorrer iogurte e queijo Na produção, o ambiente altamente ácido gerado pela fermentação do ácido lático desnatura as proteínas contidas no leite, fazendo com que ele se solidifique. Quando o ácido láctico é o único produto da fermentação, o processo é considerado fermentação homolática tal é o caso de Lactobacillus delbrueckii e S. thermophiles usado na produção de iogurte. No entanto, muitas bactérias realizam fermentação heterolática, produzindo uma mistura de ácido lático, etanol e / ou ácido acético e CO2 como resultado, devido ao uso da via da pentose fosfato ramificada em vez da via de EMP para a glicólise. Um fermentador heterolático importante é Leuconostoc mesenteroides, que é usado para azedar vegetais como pepino e repolho, produzindo picles e chucrute, respectivamente.

As bactérias do ácido láctico também são importantes do ponto de vista médico.A produção de ambientes de baixo pH dentro do corpo inibe o estabelecimento e o crescimento de patógenos nessas áreas. Por exemplo, a microbiota vaginal é composta em grande parte por bactérias do ácido láctico, mas quando essas bactérias são reduzidas, o fermento pode proliferar, causando uma infecção por fungo. Além disso, as bactérias do ácido láctico são importantes para manter a saúde do trato gastrointestinal e, como tal, são o principal componente dos probióticos.

Outro processo de fermentação familiar é fermentação de álcool, que produz etanol. A reação de fermentação do etanol é mostrada na Figura 1. Na primeira reação, a enzima piruvato descarboxilase remove um grupo carboxila do piruvato, liberando CO2 gás enquanto produz a molécula de acetaldeído de dois carbonos. A segunda reação, catalisada pela enzima álcool desidrogenase, transfere um elétron do NADH para o acetaldeído, produzindo etanol e NAD +. A fermentação do etanol do piruvato pela levedura Saccharomyces cerevisiae é utilizado na produção de bebidas alcoólicas e também faz com que os produtos de panificação aumentem devido ao CO2 Produção. Fora da indústria de alimentos, a fermentação do etanol de produtos vegetais é importante na biocombustível Produção.

Figura 1. As reações químicas da fermentação do álcool são mostradas aqui. A fermentação do etanol é importante na produção de bebidas alcoólicas e pão.

Além da fermentação de ácido láctico e fermentação de álcool, muitos outros métodos de fermentação ocorrem em procariotos, todos com o propósito de garantir um suprimento adequado de NAD + para a glicólise (Tabela 2). Sem essas vias, a glicólise não ocorreria e nenhum ATP seria coletado da quebra da glicose. Deve-se notar que a maioria das formas de fermentação, além fermentação homolática produzem gás, comumente CO2 e / ou gás hidrogênio. Muitos desses diferentes tipos de vias de fermentação também são usados ​​na produção de alimentos e cada um resulta na produção de diferentes ácidos orgânicos, contribuindo para o sabor único de um determinado produto alimentício fermentado. O ácido propiônico produzido durante fermentação de ácido propiônico contribui para o sabor distinto do queijo suíço, por exemplo.

Vários produtos de fermentação são importantes comercialmente fora da indústria de alimentos. Por exemplo, solventes químicos como acetona e butanol são produzidos durante fermentação de acetona-butanol-etanol. Compostos farmacêuticos orgânicos complexos usados ​​em antibióticos (por exemplo, penicilina), vacinas e vitaminas são produzidos através de fermentação ácida mista. Os produtos de fermentação são usados ​​em laboratório para diferenciar várias bactérias para fins de diagnóstico. Por exemplo, as bactérias entéricas são conhecidas por sua capacidade de realizar a fermentação de ácidos mistos, reduzindo o pH, que pode ser detectado por meio de um indicador de pH. Da mesma forma, a produção bacteriana de acetoína durante a fermentação do butanodiol também pode ser detectada. A produção de gás da fermentação também pode ser vista em um tubo Durham invertido que retém o gás produzido em uma cultura de caldo.

Os micróbios também podem ser diferenciados de acordo com os substratos que podem fermentar. Por exemplo, E. coli pode fermentar a lactose, formando gás, enquanto alguns de seus parentes gram-negativos próximos não podem. A capacidade de fermentar o álcool de açúcar sorbitol é usada para identificar a cepa enterohemorrágica O157: H7 patogênica de E. coli porque, ao contrário de outros E. coli cepas, ele é incapaz de fermentar o sorbitol. Por último, a fermentação de manitol diferencia o fermentador de manitol Staphylococcus aureus de outros estafilococos não fermentadores de manitol.

Tabela 2. Vias de fermentação comuns
Caminho Produtos finais Micróbios de exemplo Produtos comerciais
Acetona-butanol-etanol Acetona, butanol, etanol, CO2 Clostridium acetobutylicum Solventes comerciais, alternativa à gasolina
Álcool Etanol, CO2 Candida, Saccharomyces Cerveja, pão
Butanodiol Etanol acetoína 2,3 butanodiol CO de ácido fórmico e láctico2 gás hidrogênio Klebsiella, Enterobacter Vinho chardonnay
Ácido butírico Ácido butírico, CO2, gás hidrogênio Clostridium butyricum Manteiga
Ácido lático Ácido lático Streptococcus, Lactobacillus Chucrute, iogurte, queijo
Ácido misto Etanol de ácidos acético, fórmico, lático e succínico, CO2, gás hidrogênio Escherichia, Shigella Vinagre, cosméticos, produtos farmacêuticos
Ácido propiónico Ácido acético, ácido propiônico, CO2 Propionibacterium, Bifidobacterium queijo suíço

Pense nisso

  • Quando um micróbio metabolicamente versátil realizaria a fermentação em vez da respiração celular?

Identificação de bactérias usando painéis de teste de API

A identificação de um isolado microbiano é essencial para o diagnóstico adequado e o tratamento adequado dos pacientes. Os cientistas desenvolveram técnicas que identificam as bactérias de acordo com suas características bioquímicas. Normalmente, eles examinam o uso de fontes de carbono específicas como substratos para fermentação ou outras reações metabólicas, ou identificam produtos de fermentação ou enzimas específicas presentes nas reações. No passado, os microbiologistas usavam tubos de ensaio e placas individuais para realizar testes bioquímicos. No entanto, os cientistas, especialmente aqueles em laboratórios clínicos, agora usam com mais frequência painéis multitestes de plástico descartáveis ​​que contêm uma série de tubos de reação em miniatura, cada um incluindo tipicamente um substrato específico e indicador de pH. Após a inoculação do painel de teste com uma pequena amostra do micróbio em questão e incubação, os cientistas podem comparar os resultados a um banco de dados que inclui os resultados esperados para reações bioquímicas específicas para micróbios conhecidos, permitindo assim a identificação rápida de um micróbio de amostra. Esses painéis de teste permitiram aos cientistas reduzir custos, melhorando a eficiência e a reprodutibilidade, realizando um grande número de testes simultaneamente.

Muitos painéis de teste bioquímicos miniaturizados comerciais cobrem uma série de grupos clinicamente importantes de bactérias e leveduras. Um dos primeiros e mais populares painéis de teste é o painel Índice de Perfil Analítico (API), inventado na década de 1970. Uma vez que alguma caracterização laboratorial básica de uma determinada cepa tenha sido realizada, como a determinação da morfologia de Gram da cepa, uma tira de teste apropriada que contém de 10 a 20 testes bioquímicos diferentes para cepas de diferenciação dentro desse grupo microbiano pode ser usada. Atualmente, os vários Tiras de API pode ser usado para identificar rápida e facilmente mais de 600 espécies de bactérias, aeróbias e anaeróbias, e aproximadamente 100 tipos diferentes de leveduras. Com base nas cores das reações na presença de produtos finais metabólicos, devido à presença de indicadores de pH, é criado um perfil metabólico a partir dos resultados (Figura 2). Microbiologistas podem então comparar o perfil da amostra com o banco de dados para identificar o micróbio específico.

Figura 2. A tira de teste API 20NE é usada para identificar cepas específicas de bactérias gram-negativas fora de Enterobacteriaceae. Aqui está um resultado da tira de teste API 20NE para Photobacterium damselae ssp. piscicida.

Foco clínico: Alex, parte 2

Este exemplo continua a história de Alex, que começou em Energy Matter and Enzymes.

Muitos dos sintomas de Alex são consistentes com várias infecções diferentes, incluindo gripe e pneumonia. No entanto, seus reflexos lentos, juntamente com sua sensibilidade à luz e pescoço rígido sugerem algum possível envolvimento do sistema nervoso central, talvez indicando meningite. A meningite é uma infecção do líquido cefalorraquidiano (LCR) ao redor do cérebro e da medula espinhal que causa inflamação das meninges, as camadas protetoras que cobrem o cérebro. A meningite pode ser causada por vírus, bactérias ou fungos. Embora todas as formas de meningite sejam graves, a meningite bacteriana é particularmente séria. A meningite bacteriana pode ser causada por várias bactérias diferentes, mas a bactéria Neisseria meningitidis, um diplococo Gram-negativo em forma de feijão, é uma causa comum e leva à morte em 1 a 2 dias em 5% a 10% dos pacientes.

Dada a potencial gravidade das condições de Alex, seu médico aconselhou seus pais a levá-lo ao hospital na capital da Gâmbia, Banjul, para que fosse testado e tratado para possível meningite. Depois de uma viagem de 3 horas até o hospital, Alex foi internado imediatamente. Os médicos coletaram uma amostra de sangue e realizaram uma punção lombar para testar seu LCR. Eles também o iniciaram imediatamente com um tratamento com o antibiótico ceftriaxona, a droga de escolha para o tratamento da meningite causada por N. meningitidis, sem esperar pelos resultados dos testes de laboratório.

  • Como os testes bioquímicos podem ser usados ​​para confirmar a identidade de N. meningitidis?
  • Por que os médicos de Alex decidiram administrar antibióticos sem esperar pelos resultados do teste?

Voltaremos ao exemplo de Alex nas páginas posteriores.

Conceitos-chave e resumo

  • A fermentação usa uma molécula orgânica como um aceptor final de elétrons para regenerar o NAD + do NADH para que a glicólise possa continuar.
  • A fermentação não envolve um sistema de transporte de elétrons, e nenhum ATP é feito diretamente pelo processo de fermentação. Os fermentadores produzem muito pouco ATP - apenas duas moléculas de ATP por molécula de glicose durante a glicólise.
  • Os processos de fermentação microbiana têm sido usados ​​para a produção de alimentos e produtos farmacêuticos e para a identificação de micróbios.
  • Durante a fermentação do ácido láctico, o piruvato aceita elétrons do NADH e é reduzido a ácido láctico. Micróbios atuando fermentação homolática produzem apenas ácido láctico como micróbios do produto de fermentação que desempenham fermentação heterolática produzir uma mistura de ácido lático, etanol e / ou ácido acético e CO2.
  • A produção de ácido láctico pela microbiota normal impede o crescimento de patógenos em certas regiões do corpo e é importante para a saúde do trato gastrointestinal.
  • Durante a fermentação do etanol, o piruvato é primeiro descarboxilado (liberando CO2) em acetaldeído, que então aceita elétrons do NADH, reduzindo o acetaldeído a etanol. A fermentação do etanol é usada para a produção de bebidas alcoólicas, para fazer os produtos de panificação crescerem e para a produção de biocombustíveis.
  • Produtos de fermentação de vias (por exemplo, fermentação de ácido propiônico) fornecem sabores distintos para produtos alimentícios. A fermentação é usada para produzir solventes químicos (fermentação de acetona-butanol-etanol) e produtos farmacêuticos (fermentação de ácido misto).
  • Tipos específicos de micróbios podem ser distinguidos por suas vias de fermentação e produtos. Os micróbios também podem ser diferenciados de acordo com os substratos que são capazes de fermentar.

Múltipla escolha

Qual das alternativas a seguir é o propósito da fermentação?

  1. fazer ATP
  2. para fazer intermediários da molécula de carbono para o anabolismo
  3. para fazer NADH
  4. para fazer NAD +

[revelar-resposta q = & # 8221994743 & # 8243] Mostrar resposta [/ revelar-resposta]
[resposta oculta a = & # 8221994743 & # 8243] Resposta d. O objetivo da fermentação é fazer NAD +. [/ Resposta-oculta]

Qual molécula normalmente serve como o aceptor final de elétrons durante a fermentação?

[revelar-resposta q = & # 8221887966 & # 8243] Mostrar resposta [/ revelar-resposta]
[resposta oculta a = & # 8221887966 & # 8243] Resposta c. O piruvato normalmente serve como o aceptor final de elétrons durante a fermentação. [/ Resposta oculta]

Qual produto de fermentação é importante para fazer o pão crescer?

[revelar-resposta q = & # 8221238691 & # 8243] Mostrar resposta [/ revelar-resposta]
[resposta oculta a = & # 8221238691 & # 8243] Resposta b. CO2 é importante para fazer o pão crescer. [/ hidden-answer]

Qual dos seguintes não é um produto de fermentação comercialmente importante?

[Revelar-resposta q = & # 8221836432 & # 8243] Mostrar resposta [/ revelar-resposta]
[resposta oculta a = & # 8221836432 & # 8243] Resposta b. O piruvato não é um produto de fermentação comercialmente importante. [/ Resposta oculta]

Preencher a lacuna

O micróbio responsável pela fermentação do etanol para fins de produção de bebidas alcoólicas é ________.

[revelar-resposta q = & # 8221205075 & # 8243] Mostrar resposta [/ revelar-resposta]
[resposta oculta a = & # 8221205075 & # 8243] O micróbio responsável pela fermentação do etanol para fins de produção de bebidas alcoólicas é fermento (Saccharomyces cerevisiae). [/ resposta-oculta]

________ resulta na produção de uma mistura de produtos de fermentação, incluindo ácido lático, etanol e / ou ácido acético e CO2.

[Revelar-resposta q = & # 8221513820 & # 8243] Mostrar resposta [/ revelar-resposta]
[resposta oculta a = & # 8221513820 & # 8243]Fermentação heterolática resulta na produção de uma mistura de produtos de fermentação, incluindo ácido lático, etanol e / ou ácido acético e CO2. [/ resposta-oculta]

Os organismos em fermentação produzem ATP através do processo de ________.

[Revelar-resposta q = & # 822193931 & # 8243] Mostrar resposta [/ revelar-resposta]
[resposta oculta a = & # 822193931 & # 8243] Organismos fermentadores produzem ATP através do processo de glicolise. [/ resposta-oculta]

Coincidindo

Combine o caminho de fermentação com o produto comercial correto que é usado para produzir:

___ fermentação de acetona-butanol-etanol uma. pão
___fermentação de álcool b. farmacêuticos
___fermentação de ácido láctico c. queijo suíço
___ fermentação ácida mista d. iogurte
___ fermentação de ácido propiônico e. solventes industriais

[revelar-resposta q = & # 8221283653 & # 8243] Mostrar resposta [/ revelar-resposta]
[resposta oculta a = & # 8221283653 & # 8243]

  1. Os solventes industriais são produzidos pela fermentação de acetona-butanol-etanol.
  2. O pão é produzido por fermentação alcoólica.
  3. O iogurte é produzido pela fermentação do ácido láctico.
  4. Os produtos farmacêuticos são produzidos por fermentação de ácido misto.
  5. O queijo suíço é produzido por fermentação com ácido propiônico.

Pense nisso

  1. Por que alguns micróbios, incluindo Estreptococo spp., incapaz de realizar respiração aeróbia, mesmo na presença de oxigênio?
  2. Como a fermentação pode ser usada para diferenciar vários tipos de micróbios?
  3. A bactéria E. coli é capaz de realizar respiração aeróbica, respiração anaeróbica e fermentação. Quando ele executaria cada processo e por quê? Como é feito o ATP em cada caso?

Viagem de ácido

O que impede a produção bem-sucedida de produtos químicos verdes a partir da biomassa é o que durante anos desacelerou o processamento bioquímico comercial de biomassa em etanol.

Alguns o chamam de mecanismo de defesa inteligente da biologia contra infiltradores e decompositores microbianos. "É um material estrutural da natureza e é montado com muita segurança", diz Dennis Miller, professor de engenharia química na Michigan State University. Desconstruir o material vegetal, separar a lignina da celulose e da hemicelulose para utilizar açúcares de cinco e seis carbonos, é muito mais complicado do que outras formas de utilização de biomassa, como lascar madeira e queimar em uma caldeira de combustível sólido. O professor do Dartmouth College, Lee Lynd, diz que a "recalcitrância da biomassa celulósica" é o maior obstáculo para uma biorrefinação econômica. “Se isso for resolvido, a conversão de açúcares em etanol e a recuperação do etanol estão bem estabelecidas”, afirma. "Para ácidos orgânicos, existem mais desafios, incluindo o título de fermentação e a recuperação do produto."

Alguns especialistas consideram a classe de compostos conhecidos como ácidos orgânicos um dos grupos de produtos mais promissores que surgem da fermentação de biomassa. Um estudo do Laboratório Nacional de Energia Renovável conduzido há alguns anos identificou oito dos 12 principais produtos químicos de valor agregado dos açúcares como sendo ácidos carboxílicos. O ácido acético é um exemplo de ácido carboxílico. Quando o álcool reage com um ácido, é feito um éster. Um éster comum no mundo atual dos combustíveis renováveis ​​é o biodiesel-metanol que reage com ácidos graxos para formar ésteres metílicos.

Os produtores de etanol de moagem a seco de milho estão muito familiarizados com as bactérias do ácido láctico e acético, que se infiltram furtivamente no processo de produção de etanol e fermentam os açúcares em ácidos em vez de álcool, roubando a saccharomyces cerevisiae de nutrientes e minerais vitais, reduzindo assim o rendimento e a produção de trituração a um pare até que a contaminação esteja sob controle. Em uma usina de etanol de milho, apenas alguns fermentadores enormes são usados ​​em refinarias gigantes, mas uma refinaria bioquímica lignocelulósica provavelmente teria muitos mais fermentadores, de acordo com um relatório de subcontratados conduzido para NREL por Lynd et al, intitulado "Análise Estratégica de Biorrefinaria: Análise das Biorrefinarias. " Ele diz: "O número de fermentadores mesmo em uma biorrefinaria de tamanho moderado é tão grande - maior que 25 para muitos projetos - que o custo da capacidade de fermentação não depende se essa capacidade é dedicada a um produto ou a vários produtos." Diante disso, uma biorrefinaria poderia facilmente dedicar um fermentador à produção bioquímica de ácido lático, acético ou succínico, que pode ser vendido no mercado aberto como tal, ou reagir com um fluxo de deslizamento do produto primário da biorrefinaria, o etanol, para fazer uma variedade de ésteres úteis.

Lactato de etila por destilação reativa
Para as empresas que desenvolvem etanologens para fermentar açúcares de cinco e seis carbonos, o que deve ser tratado é a tendência natural dessas feras de quererem produzir ácidos. Uma empresa chamada TMO Renewables Ltd. desenvolveu um organismo com apetite por açúcares de cinco e seis carbonos e "desligou" os genes do organismo que produzem os ácidos láctico e acético.

"Quando você olha para alguns dos organismos lá fora, alguns dos produtos comuns que a natureza já projetou são fermentações em ácidos", diz o professor de engenharia química e termodinâmica da MSU, Carl Lira. "Em vez de tentar fazer com que o organismo faça outro produto, deixe-o fazer o ácido orgânico que deseja e então podemos descobrir como convertê-lo em outros intermediários." E é exatamente isso que Lira, Miller e outros professores da MSU, junto com Richard Glass, vice-presidente de pesquisa e desenvolvimento da National Corn Growers Association, fizeram.

“Não seria maravilhoso se pudéssemos pegar um produto que atualmente é produzido pela indústria petroquímica e encontrar um par competitivo para ele - um que seja renovável, competitivo e verde”, diz Glass. "Essa era a nossa missão. Nós lançamos o sistema modelo porque o lactato de etila é produzido comercialmente hoje a partir de produtos petroquímicos e sabemos exatamente quanto custa porque o modelo existe." O projeto MSU-NCGA começou a jusante da fermentação e envolveu a reação de fluxos separados de ácido lático e etanol. Em última análise, os pesquisadores pretendiam licenciar o retrofit de fábricas de etanol de milho moído a seco existentes para diversificar sua estreita linha de produtos, mas também é totalmente aplicável ao conceito de biorrefinaria lignocelulósica. "Nosso processo é independente da matéria-prima", diz Miller. "Não importa se usamos glicose do grão de milho para fazer o ácido láctico ou se usamos açúcares da palha do milho ou da biomassa lenhosa. A corrente de açúcar usada para fazer etanol é a mesma corrente de açúcar que usaríamos para fazer ácido láctico . "

O lactato de etila é um composto de éster derivado da reação de etanol com ácido láctico. Segundo Lira, o lactato de etila não é muito utilizado hoje em dia pelo alto custo, mas tem aplicações na indústria eletrônica para fabricação de microcircuitos, principalmente por ser um solvente limpo. Lira diz que durante o tempo que ele e seus colegas estavam trabalhando neste projeto, cujos resultados foram publicados em 2007, o custo de produção de lactato de etila estava entre US $ 1,30 e US $ 1,60 o quilo. Os pesquisadores da MSU e NCGA conseguiram cortar esse custo pela metade usando um processo chamado destilação reativa.

"A destilação reativa existe há muito tempo - não é nova", disse Glass à Biomass Magazine. "Mas o que é novo é a nossa aplicação. Geralmente, o problema com as reações é que para separá-las você tem que destilá-las, e quando você destila você tem pontos de ebulição muito próximos, muito difíceis de separar. Mas a destilação reativa nos permite para produzir compostos chamados hemiacetais, que são estáveis ​​no sistema e têm pontos de ebulição completamente diferentes do que seriam para o produto químico original. " Assim, uma vez que a destilação esteja completa, o hemiacetal pode ser quebrado e o composto puro recuperado com uma alta porcentagem de pureza.

Glass chama a química envolvida na destilação reativa de "elegante" porque é extraordinariamente eficaz e simples. Miller diz que do ponto de vista de equipamento e energia, a destilação reativa é uma maneira eficiente de realizar uma série de reações químicas. “Se você olhar para o processamento convencional, a reação vai em parte e depois para, em outra parte e para, e a ideia com a destilação reativa é continuar empurrando a reação por todo o caminho até que esteja completa”, diz Miller.

Pelo menos duas alimentações são usadas na coluna de destilação reativa, com o reagente menos volátil, o ácido, entrando no topo e o etanol mais volátil entrando no fundo. O objetivo é fornecer uma zona reativa onde o éster e o subproduto da água se movam em direções opostas na coluna. Este processo requer duas colunas porque em solução o ácido lático forma oligômeros, e os pesquisadores observam que a modelagem precisa do comportamento do oligômero e do equilíbrio das fases da mistura são aspectos integrais do design deste projeto específico. A NCGA atualmente busca empresas que possam estar interessadas em comprar uma licença para este processo de produção de lactato de etila, que pode ser adaptado em uma planta de etanol de moagem a seco.

Mercados e diversidade de produtos
“Se tudo o que você produz de uma biorrefinaria é etanol, isso é bom para uma indústria nascente, mas, em essência, tudo o que você tem é um pônei de um truque”, diz Glass. "Meu sonho é a biorrefinaria integrada onde os únicos limites são sua imaginação e capacidade de fazer o sistema." Lira diz que as refinarias de etanol são unidimensionais. “Em uma biorrefinaria, você realmente deseja essa diversidade”, diz ele. "Mas agora grande parte do esforço é fazer um único organismo - fazer um único produto - porque isso simplifica a separação a jusante, e se você pode fazer apenas etanol, então pode converter o design em um sistema pronto para uso." A palavra "chave na mão" não foi associada às refinarias de etanol de biomassa como na indústria de etanol à base de amido.

Um exemplo clássico: acetato de metila versus lactato de etila

Este diagrama compara as principais diferenças de fluxo de processo e design usado na fabricação petroquímica de lactato de etila, à esquerda, com o processo de destilação reativa, muito mais simples, à direita.
fonte: MICHIGAN STATE UNIVERSITY

Glass diz que a partir de uma usina de etanol de 25 MMgy, um fluxo lateral de etanol de 1 MMgy desviado para fazer produtos químicos como lactato de etila poderia trazer a mesma quantidade de receita que os 24 MMgy restantes de etanol vendido como combustível. Alguém pode se perguntar por que não desviar mais etanol e produzir ainda mais produtos químicos de valor agregado em vez de produzir o etanol de menor valor. O problema com isso é que os mercados são frágeis e o que alguns consideram pequenos aumentos na produção podem derrubar os preços. O uso de lactato de etila nos Estados Unidos, por exemplo, é entre 10 milhões e 20 milhões de libras por ano e é vendido por cerca de US $ 1,50 a libra, de acordo com a MSU. "Tenha em mente que existem alguns grandes jogadores por aí e se você entrar e tentar tirar o mercado deles, o que eles vão tentar fazer?" Poses de vidro. "Eles não vão ficar felizes." Natureworks LLC opera a maior fábrica de ácido polilático do mundo em Blair, Nebraska, que produz 300 milhões de libras por ano.

De acordo com um relatório intitulado "Produção e mercado de ácido succínico na China", a China produz cerca de um quarto a um terço do ácido succínico mundial. O relatório afirma que os principais métodos de produção em jogo na China hoje são a redução eletroquímica e a hidrogenação. Globalmente, a maior parte do ácido succínico é produzida por fermentação, "o que pode reduzir significativamente o custo de fabricação", afirma o relatório. Lira diz que muito do ácido acético produzido hoje é feito de metanol - metano para metanol e ácido acético. “O ácido acético também pode ser feito por fermentação, mas não tenho certeza de quão competitivo é o custo do processo de petróleo”, diz Lira. "Estamos trabalhando agora com ácidos succínicos, mas não posso compartilhar detalhes sobre isso ainda porque o trabalho está em andamento." O trabalho envolve esterificar o ácido succínico com etanol para fazer succinato de dietila.

Dado que muitos desses ácidos são produzidos por métodos diferentes da fermentação, isso proporcionará uma grande oportunidade para as biorrefinarias construídas na plataforma bioquímica diversificarem seus fluxos de produtos. Mas o desenvolvimento de novos mercados para ácidos orgânicos e compostos de éster seria um componente crítico dessa abordagem. “A grande lição que aprendemos é definir os mercados”, diz Lira. "Esse vai ser o grande desafio entrar no mercado, encontrar empresas que sejam as primeiras a aproveitar essas oportunidades."


O animálculo vegetativo molecular

[O fermento - explorando a relação entre ciência e religião (cont.)]

O fermento é um organismo domesticado que se tornou quase indispensável na sociedade moderna. Embora não seja essencial para a dieta básica, as prateleiras dos supermercados estão abarrotadas de produtos que requerem fermentação com fermento. A produção de pão, chocolate e álcool envolve a atividade metabólica desses micróbios unicelulares simples. Restaurantes, bares, clubes e muitos aspectos do comportamento social giram em torno de produtos de fermento.

Ao longo dos séculos, a levedura tem sido o foco da vida doméstica e industrial. Embora sua capacidade de fermentação tenha sido o foco de muitas hipóteses e mudanças de paradigma diferentes. A fermentação era considerada a consequência de uma reação química por algum tipo de substância e não a atividade metabólica de um organismo vivo. Durante a era bíblica, não haveria concepção de que a via metabólica de um inseto microscópico era a fonte de fermentação.

As leveduras são naturalmente abundantes no meio ambiente, especialmente no solo onde são transferidas, por insetos ou outros meios, para a pele de frutas e animais, incluindo humanos. O ambiente contém muitos tipos diferentes de fermento, daqueles que causam infecção fúngica (Candida spp.) a outros que são usados ​​na indústria de panificação e na produção de vinho (Saccharomyces spp.). O fermento pertence ao reino Fungi e à divisão Ascomycota. Nos últimos tempos, tornou-se um ator importante na pesquisa biológica e agora é um dos organismos mais estudados da Terra. Foi o primeiro organismo eucariótico a ter um genoma totalmente sequenciado. A maioria de seus genes foram pesquisados ​​e analisados ​​funcionalmente e, como muitos deles possuem análogos em outros organismos multicelulares, é possível estudar processos moleculares de sistemas de mamíferos dentro de um modelo eucarioto unicelular. Também está bem estabelecido como uma alternativa favorável aos sistemas de modelos animais.

Experimentos em grande escala envolvendo computadores, robótica e novas técnicas moleculares, como a reação em cadeia da polimerase (PCR) para amplificar genes e micromatrizes de DNA, que organizam centenas desses genes em uma pequena grade, geraram uma grande quantidade de dados que novas disciplinas científicas, por exemplo, genômica, transcriptômica, evoluíram para processar tudo em resultados significativos. A simplicidade do ciclo de vida da levedura a tornou inestimável para a pesquisa médica e biotecnológica. Certamente, o fermento teve um grande impacto na sociedade do século 21, que infligiu no comportamento social e na pesquisa médica. A antropologia teria evoluído de forma diferente se esse organismo deixasse de existir.


Assista o vídeo: Jak zrobić Zakwas żytni chlebowy od (Dezembro 2021).