Em formação

Isolamento de RNA - papel do pH


Por que o RNA sozinho vai para a fase aquosa quando tratado com fenol-clorofórmio em pH mais baixo? Em um pH neutro ou básico, tanto o DNA quanto o RNA escapariam para a fase aquosa. Então, como o DNA é retido em pH ácido?


O objetivo da extração com fenol ácido é reter seletivamente o RNA na fase aquosa, enquanto o DNA se divide na fase orgânica ou coalescem na interfase. Eu descobri que muitas pessoas na internet dizem que isso se deve à protonação dos fosfatos de DNA, enquanto os fosfatos de RNA permanecem iônicos, dando assim uma solubilidade diferente. Não aceito esta explicação porque:

  • O pKa da porção fosfodiéster é várias ordens de magnitude menor do que o pH usado em extrações de fenol ácido e, portanto, deve ser amplamente desprotonado.
  • Dadas suas estruturas semelhantes, a diferença drástica em pKa entre o RNA e o DNA necessária para que seja útil em termos preparativos, para mim, parece implausível.
  • Não encontrei tais afirmações na literatura científica.

As propriedades de DNA e RNA que vêm à mente e que podem explicar a solubilidade diferencial são:

  • O DNA é desnaturado em ácido devido à protonação das nucleobases, que transmitem carga positiva. Esse poderia facilitar a agregação.
  • O DNA geralmente é mais longo.
  • O RNA tem um grupo hidroxila 2 'que aumenta a polaridade da molécula.

De certa forma, há um suporte para isso nas perguntas frequentes do ThermoFisher:

A partição dos ácidos nucléicos em fenol é dependente do pH. Em pH 7,0 ou superior, o DNA e o RNA se dividem na fase aquosa. Em um pH ácido (abaixo de 7,0), o DNA é desnaturado e passa para a fase orgânica, mas o RNA permanece na fase aquosa.

A biofísica exata me escapa. Sei que não é uma resposta, mas sim um longo comentário. Achei importante abordar o que, em minha opinião, pode ser um equívoco. As críticas são bem-vindas.


Neste caso, existem duas propriedades que determinam o comportamento do RNA:

  • Sua polaridade;
  • Sua acidez.

Devido à sua polaridade, o RNA tende a escapar da fase fenol-clorofórmio; na verdade, isso posso vai para a fase aquosa mesmo se o pH for neutro [1], mas com uma eficiência menor do que se o pH for ácido. Aí vem a segunda propriedade, a acidez do RNA. Por causa disso, quando o RNA está em uma solução neutra, ele tem uma carga negativa: os $ -OH $ s do grupo fosfato se dissociam em $ -O ^ - $ e $ H ^ + $. No entanto, isso não acontece em uma solução ácida, onde já existem muitos $ H ^ + $. Assim, em pH básico, os grupos $ -OH $ estão intactos e possuem uma carga neutra; isso estabiliza o sistema.
Pense nisso: se a fase aquosa está em pH neutro e se enche de moléculas de RNA carregadas negativamente, depois de um tempo nenhuma outra molécula negativa pode entrar naquela solução. Por outro lado, se as moléculas de RNA que entram na fase aquosa ficarem eletrostaticamente neutras, o número de moléculas que vão para a solução será limitado apenas pela disponibilidade de moléculas de água para dissolvê-las.

É por isso que você usa pH ácido *, é simplesmente uma questão de eficiência.

Isenção de responsabilidade: esta resposta é baseada em um comentário do OP sob o OQ.

[1] Você nunca usaria uma solução de pH alto para extrair RNA, porque tal condição hidrolisa o RNA.


Extração de ácido guanidínio tiocianato-fenol-clorofórmio

Extração de ácido guanidínio tiocianato-fenol-clorofórmio (abreviado AGPC) é uma técnica de extração líquido-líquido em bioquímica. É amplamente utilizado em biologia molecular para isolar RNA (bem como DNA e proteínas em alguns casos). Este método pode demorar mais do que um sistema baseado em coluna, como a purificação baseada em sílica, mas tem maior pureza e a vantagem de alta recuperação de RNA: [1] uma coluna de RNA é tipicamente inadequada para purificação de RNA curto (& lt200 nucleotídeos) espécies, como siRNA, miRNA, gRNA e tRNA.

Foi originalmente desenvolvido por Piotr Chomczynski e Nicoletta Sacchi, que publicaram seu protocolo em 1987. [2] [3] O reagente é vendido pela Sigma-Aldrich com o nome TRI Reagent pela Invitrogen sob o nome TRIzol by Bioline como Trisure e por Tel -Teste como STAT-60.


Extração de DNA, RNA e proteína: o passado e o presente

A extração de DNA, RNA e proteína é o método básico usado em biologia molecular. Essas biomoléculas podem ser isoladas de qualquer material biológico para processos subsequentes a jusante, para fins analíticos ou preparativos. No passado, o processo de extração e purificação de ácidos nucléicos costumava ser complicado, demorado, trabalhoso e limitado em termos de rendimento geral. Atualmente, existem muitos métodos especializados que podem ser usados ​​para extrair biomoléculas puras, como protocolos baseados em solução e baseados em coluna. O método manual certamente percorreu um longo caminho ao longo do tempo com várias ofertas comerciais que incluíam kits completos contendo a maioria dos componentes necessários para isolar o ácido nucleico, mas a maioria deles requer etapas de centrifugação repetidas, seguidas pela remoção dos sobrenadantes, dependendo do tipo de amostra e tratamento mecânico adicional. Os sistemas automatizados projetados para laboratórios de médio a grande porte têm crescido em demanda nos últimos anos. É uma alternativa aos métodos manuais de mão-de-obra intensiva. A tecnologia deve permitir um alto rendimento de amostras, o rendimento, pureza, reprodutibilidade e escalabilidade das biomoléculas, bem como a velocidade, precisão e confiabilidade do ensaio devem ser máximas, ao mesmo tempo que minimiza o risco de contaminação cruzada.


Purificação de RNA usando TRIzol (reagente TRI)

A solubilização e extração de TRIzol é um método geral desenvolvido relativamente recentemente para desproteinizar RNA. Este método é particularmente vantajoso em situações em que células ou tecidos são enriquecidos em RNases endógenas ou quando a separação de RNA citoplasmático de RNA nuclear é impraticável. TRIzol (ou reagente TRI) é uma solução monofásica de fenol e isotiocianato de guanidínio que simultaneamente solubiliza material biológico e desnatura proteínas. Após a solubilização, a adição de clorofórmio causa separação de fases (semelhante à extração com fenol: clorofórmio: álcool isoamílico), onde a proteína é extraída para a fase orgânica, o DNA se resolve na interface e o RNA permanece na fase aquosa. Portanto, o RNA, o DNA e a proteína podem ser purificados de uma única amostra (daí o nome TRIzol). A extração de TRIzol também é um método eficaz para isolar pequenos RNAs, como microRNAs, RNAs associados a piwi ou pequenos RNAs de interferência endógenos. No entanto, o TRIzol é caro e os pellets de RNA podem ser difíceis de ressuspender. Assim, o uso de TRIzol não é recomendado quando a extração regular de fenol é prática.


Métodos de extração de ácido nucleico

Os métodos de extração de núcleo podem ser amplamente caracterizados em dois tipos diferentes:

Métodos baseados em solução

Muitos dos primeiros métodos de extração de ácido nucléico dependiam da trituração de amostras biológicas congeladas e, em seguida, misturá-las com soluções de produtos químicos concebidos para tornar possível a purificação de RNA e / ou DNA.

1. Centrifugação em gradiente de cloreto de césio (com brometo de etídio)

Este método é baseado nos fenômenos de densidade flutuante e específica. O cloreto de césio (CsCl) é um sal extremamente denso. Quando as soluções deste sal são submetidas à centrifugação em velocidades muito altas (normalmente & gt100.000 rpm), o CsCl configura um gradiente de concentração, onde é altamente concentrado em uma extremidade, ou lado, do tubo de centrífuga em que está , e muito menos concentrado no outro. Se o processo de centrifugação for finalizado suavemente, com a centrifugação desacelerando lentamente, a solução mais densa (com maior concentração de CsCl) irá se depositar no fundo do tubo, mantendo o gradiente de concentração por algum tempo. Outras moléculas dissolvidas na solução irão se separar de acordo com sua densidade, com as moléculas mais densas indo em direção ao fundo do tubo e as moléculas menos densas movendo-se em direção ao topo. Quando o DNA está na presença de uma molécula chamada brometo de etídio, ele se liga a ela e se torna fluorescente quando sob luz ultravioleta. O brometo de etídio também ajusta a densidade do DNA para que ele se mova em direção ao centro do tubo durante a centrifugação. Os contaminantes irão para posições diferentes e, portanto, serão separados do DNA, que pode ser facilmente visto e recuperado por ser fluorescente. As etapas subsequentes irão separar o DNA do CsCl e do brometo de etídio. Esta técnica é particularmente eficaz para separar plasmídeos & # 8211, que são pequenas fitas de DNA que as bactérias usam para compartilhar informações sobre resistência a antibióticos umas com as outras, e DNA mitocondrial e outras moléculas de DNA específicas que se ligam a quantidades características de brometo de etídio e, portanto, irão têm densidades únicas. É fácil separar o DNA mitocondrial do plasmídeo. Esses ácidos nucléicos são organizados em padrões circulares altamente enrolados (chamados de superenrolados). O DNA que não é superenrolado (como as espécies de DNA cromossômico muito mais longas) se liga a diferentes quantidades de brometo de etídio e tem uma densidade diferente & # 8211, tornando-os fáceis de separar do DNA do plasmídeo.

2. Extração de ácido nucleico de tiocianato de guanidínio-fenol-clorofórmio

Uma solução aquosa do sal tiocianato de guanidínio, quando misturada com solventes fenol e clorofórmio, permite a purificação eficaz do RNA através de um número mínimo de etapas. Quando as amostras são trituradas e misturadas com clorofórmio, fenol, acetato de sódio e tiocianato de guanidínio e submetidas à centrifugação, a solução de sal se separa dos solventes & # 8211 fornecendo uma fase aquosa superior e uma fase orgânica inferior que consiste nos solventes. O RNA permanecerá na fase aquosa, enquanto as proteínas, outros ácidos nucléicos e outros contaminantes irão para a fase orgânica ou para a interface entre as duas fases.

3. Extração de ácido nucleico de brometo de cetiltrimetilamônio

Esta técnica é usada principalmente para amostras de plantas, bem como suas partes, como grãos, sementes e folhas. Ele também é usado para muitas amostras de alimentos. Os ácidos nucléicos e alguns outros polissacarídeos são insolúveis em soluções de extração de ácido nucléico de brometo de cetiltrimetilamônio a 2% (CTAB), em pH alto. Polissacarídeos neutros e proteínas são solúveis. Isso fornece uma maneira fácil de remover muitos contaminantes vegetais difíceis antes de uma purificação adicional.

4. Extração de Chelex®

Esta técnica é utilizada no campo da perícia para extração de DNA de diferentes fontes, como cotonetes bucais, cartões de manchas de sangue e cabelo. Este método usa uma resina (nome comercial Chelex®, que se liga a inibidores comuns do processo de reação em cadeia da polimerase (PCR). Isso produz uma amostra bastante rudimentar, mas que preserva o DNA e a torna útil para análise forense baseada em PCR.

5. Extração alcalina

Esta técnica é usada para isolamento de DNA de plasmídeo, por si só para preparações relativamente brutas, ou como a primeira etapa em virtualmente todos os processos de purificação de plasmídeo. Envolve a coleta de bactérias de interesse de um meio de cultura e, consequentemente, a exposição das bactérias a uma solução altamente alcalina. Isso geralmente é seguido pela mistura do extrato alcalino com o detergente Dodecil Sulfato de Sódio, que remove as proteínas e a maioria dos outros contaminantes. Uma das maiores vantagens desse método é que, como existem muitas proteínas ligadas ao grande DNA cromossômico, esse DNA é removido junto com as proteínas. Uma vez que as técnicas de clonagem molecular dependem da manipulação do DNA do plasmídeo, a remoção do DNA cromossômico é crítica.

Extração de ácido nucleico em fase sólida

Os métodos de extração em fase sólida fazem com que os ácidos nucleicos se liguem a suportes sólidos, como esferas magnéticas revestidas com sílica ou outros materiais. As contas (ou outros suportes) são então lavadas com álcool para remover os contaminantes. O suporte é então lavado com um líquido que torna os ácidos nucléicos solúveis novamente, o que libera o DNA do suporte em um processo conhecido como eluição. Um método simples é adicionar uma solução contendo um caótropo ao extrato de ácido nucleico bruto. Agentes caotrópicos são moléculas que rompem a rede de ligações de hidrogênio entre as moléculas de água. Na presença de caótropos, os ácidos nucléicos antes são muito menos solúveis e se ligam ao vidro, esferas magnéticas revestidas de sílica e outros suportes sólidos & # 8211 tornando mais fácil separá-los dos contaminantes. Os métodos de extração em fase sólida também podem depender da ligação seletiva de DNA e RNA a resinas de troca iônica ou outras substâncias químicas.


Métodos

Cultura de células

As células MDCK-London 14 foram propagadas usando DMEM (Mediatech, Inc.) suplementado com 10% de soro fetal bovino (Hyclone) e 2 mM de glutamina. A infecção com o vírus influenza (A / Brisbane / 59/2007) foi realizada em um meio de infecção consistindo em DMEM suplementado com glutamina (2 mM), HEPES (25 mM), albumina sérica bovina (0,2% A7888 Sigma) e TPCK-tripsina ( 1 μg / mL T1426 Sigma). Para experimentos usando um formato de placa de cultura de células de 24 poços, uma suspensão de células tripsinizadas (completamente lavada para remover o soro 300.000 células / poço) foi misturada com vírus (10.000 TCID50/ poço) em meio de infecção (1 mL / poço). As células foram deixadas aderir e os lisados ​​celulares foram preparados 6 horas após a infecção.

Preparação de lisados ​​de células prontos para RT-qPCR

As células MDCK-London em placas de 24 poços foram lavadas uma vez com PBS (1 mL / poço). Os lisados ​​celulares foram preparados expondo monocamadas de células a 200 μL / poço de Reagente de Preparação de Amostra Bio-Rad iScript (referido como Bio-Rad SPR 170-8898) ou Tampão de Lise Celular (CL). A formulação final do tampão CL consistia em Tris-HCl 10 mM, pH 7,4, Igepal CA-630 a 0,25% e NaCl 150 mM. O tampão CL foi preparado de fresco a partir das seguintes soluções estoque no dia da experimentação: 1 M Tris-HCl (T2194 Sigma), 10% Igepal CA-630 (I8896 Sigma) e 5 M NaCl (351-036-100 Quality Biological, Inc .). Todos os reagentes eram de grau de biologia molecular e as diluições foram feitas com água tratada com DEPC (351-068-721 Quality Biological, Inc.). Para certos experimentos, o tampão CL também incluiu MgCl2 (M1028 Sigma) ou RNasin Plus RNase Inhibitor (N2615 Promega). Ambos Bio-Rad SPR e tampão CL foram equilibrados à temperatura ambiente antes do uso. As células foram expostas durante os tempos indicados (tipicamente 2 min para Bio-Rad SPR e 5 min para o tampão CL). Os lisados ​​resultantes foram cuidadosamente coletados sem perturbar os remanescentes da monocamada celular e analisados ​​imediatamente ou armazenados congelados (−20 ° C ou −80 ° C).

Análise RT-qPCR da expressão do gene da matriz do vírus influenza

Os experimentos foram projetados para serem compatíveis com as diretrizes do MIQE 15. A análise RT-qPCR foi realizada conforme descrito em um estudo anterior 1. Iniciadores de PCR (direto: AAGACCAATCCTGTCACCTCTGA reverso: CAAAGCGTCTACGCTGCAGTCC) amplificando uma região altamente conservada de 104 bp do gene da matriz do vírus influenza A 16 foram usados ​​em uma etapa SYBR Green RT-qPCR. Cada reação continha: modelo (1 μL de lisado celular), 1 × Supermix SYBR Green RT-PCR de uma etapa iScript (170–8893 Bio-Rad), 600 nM de cada iniciador (sintetizado no Facility for Biotechnology Resources CBER, FDA Bethesda, MD) e água sem nuclease para 10 μL. Um instrumento de PCR em tempo real CFX96 (Bio-Rad) foi usado com o seguinte protocolo: 50 ° C por 10 min (1 ×), 95 ° C por 5 min (1 ×), 95 ° C por 10 s / 61 ° A coleta de dados de C por 15 seg / 72 ° C por 30 seg (40 ×) ocorreu após a etapa de extensão de 72 ° C. O RNA total purificado a partir de células MDCK-London infectadas com a cepa A / PR / 8/34 do vírus influenza foi usado como um padrão de quantificação RT-qPCR conforme descrito anteriormente 1. Para cada execução de RT-qPCR, uma série de diluição de 10 vezes do padrão (usando lisado celular preparado a partir de células não infectadas como diluente) foi avaliada em pelo menos duplicado para validar o desempenho de RT-qPCR e facilitar a quantificação. Além disso, cada execução de RT-qPCR incluía controles negativos (lisado não infectado como entrada) e controles de transcrição não reversa (diluição inicial do padrão de RNA descrito acima como entrada). Esses controles normalmente resultam em nenhuma amplificação ou amplificações não específicas de baixo nível (sugerido pela análise da curva de fusão) com Cq's & gt 36. É importante observar que não há intermediários de DNA no ciclo de vida do vírus da influenza.

Avaliação de RNA baseada em microfluídica

O RNA total de lisados ​​celulares foi purificado usando o kit RNeasy Mini (Qiagen) de acordo com o protocolo de “limpeza” fornecido com o kit. Começando com

200 μL de lisado celular, 700 μL de Tampão RLT e 500 μL de etanol foram adicionados e a mistura foi passada por uma coluna RNeasy Mini spin. Seguindo as etapas de lavagem prescritas, o RNA purificado foi eluído em 30 μL de água livre de nuclease e armazenado a −80 ° C até a avaliação. Amostras de RNA purificado (1 μL) foram submetidas à análise de eletroforese Experion RNA StdSens baseada em microfluídica (Bio-Rad) de acordo com o protocolo do fabricante do sistema. As concentrações de amostra de RNA, medidas pelo Experion, normalmente variaram de 100–300 ng / μL (dentro da faixa de concentração recomendada de 5–500 ng / μL para o chip StdSens).

Ensaio de microneutralização baseado em RT-qPCR para o vírus da gripe

A microneutralização do vírus influenza foi realizada conforme descrito anteriormente 1. Uma amostra de soro humano 17 de um indivíduo com histórico de vacinação contra influenza foi adquirida de W. Wang e C. Weiss (Divisão de Produtos Virais, CBER, FDA). A amostra de soro foi obtida com consentimento informado por escrito, seguindo a aprovação ética pelo Comitê de Pesquisa Envolvendo Assuntos Humanos (RIHSC) da US Food and Drug Administration. A amostra de soro foi inativada por calor por incubação a 56 ° C por 30 minutos antes do uso. Os experimentos de neutralização foram realizados usando meio de infecção. Inoculo de vírus (1000 TCID50/ 50 μL) foi misturado com uma diluição de soro (50 μL) em um poço de uma placa de cultura de 96 poços. Após uma incubação por 1 hora a 37 ° C, uma suspensão de células MDCK-London (30.000 células / 100 μL) foi adicionada. 6 horas após a infecção, os lisados ​​celulares foram preparados lavando as células uma vez com PBS e adicionando 100 μL / poço de Bio-Rad SPR ou tampão CL equilibrado à temperatura ambiente, as células foram expostas por 2 minutos (Bio-Rad SPR) ou 5 minutos (CL Buffer). Os lisados ​​foram coletados e armazenados congelados a −20 ° C (amostras Bio-Rad SPR) ou −80 ° C (amostras de tampão CL) até a avaliação. A replicação do vírus, conforme refletida pela expressão do gene da matriz, foi quantificada submetendo os lisados ​​(1 μL) à análise por RT-qPCR. A quantidade de RNA em cada amostra experimental foi normalizada contra o valor médio (n ≥ 3) obtido dos poços de controle nos quais as células foram infectadas na ausência de soro neutralizante (poços de controle de vírus). O título de neutralização foi determinado como o recíproco da maior diluição de soro (antes da adição de vírus ou células), resultando em pelo menos 90% de inibição do sinal de RT-qPCR.


Avaliação da qualidade da amostra de ácido nucléico

Os procedimentos de manuseio de amostras e extração de ácido nucleico são variáveis, portanto, é fundamental definir um protocolo confiável para a análise da qualidade e quantidade da amostra e incluir detalhes dessa análise nas publicações 2. A quantidade de RNA é amplamente determinada pela produção de rRNA, enquanto a qualidade do RNA é determinada pela pureza (ausência de inibidores) e integridade das moléculas de RNA. No entanto, ao medir a qualidade de uma amostra a pureza e integridade influenciam os resultados, é difícil determinar a pureza e integridade de uma amostra de baixa concentração e a presença de impurezas pode interferir na quantificação. Existem várias técnicas que podem ser usadas para avaliar a quantidade e a qualidade do ácido nucleico, mas nenhuma delas, sozinha, fornece todas as informações necessárias para descrever uma amostra completamente. Portanto, é importante considerar um conjunto de opções para garantir que a qualidade da amostra não influenciará os dados da análise final 1.

Quantificação de ácido nucléico

Espectroscopia UV

Os ácidos nucléicos têm sido tradicionalmente quantificados medindo a absorção de UV usando um espectrofotômetro. A absorbância de uma amostra diluída de DNA ou RNA é lida a 260 nm e 280 nm. A densidade óptica (DO) em 260 nm é usada para determinar a concentração de RNA ou DNA em uma solução usando a lei de Beer-Lambert, que prevê uma correlação linear entre absorbância e concentração.

Lei Beer-Lambert

A = εbc
A = absorbância
b = comprimento do caminho da cubeta em cm (normalmente 1 cm)
c = concentração de analito
ε = coeficiente de extinção

Para RNA, ε = 40 μg / mL
Para DNA, ε = 50 μg / mL

Um OD a 260 nm (A260) a leitura de 1,0 é equivalente a aproximadamente 40 μg / mL de RNA puro e 50 μg / mL de DNA de fita dupla puro. No entanto, a lei de Beer-Lambert só é válida para leituras de OD até 2 e a relação OD / concentração declarada depende das amostras serem puras. Evidentemente, as substâncias contaminantes com absorção a 260 nm ou 280 nm afetarão a leitura de OD estimada. RNA puro tem um A260/UMA280 de 2.1, enquanto o DNA puro terá um A260/UMA280 de 1.8.

A DO de substâncias potencialmente contaminantes, como proteínas, sais caotróficos e fenol também pode ser determinada se a absorbância da amostra for medida em 280 nm e 230 nm (A280 e A230, respectivamente). Desta forma, uma proporção de A260/UMA280 e A260/UMA230 pode ser usado como um indicador de pureza da amostra. No entanto, deve-se notar que a determinação da contaminação de proteínas no DNA é muito insensível ao usar esta abordagem 4.

Além disso, o pH e a força iônica do tampão também perturbam a leitura de DO. Foi demonstrado que existe uma variabilidade significativa no A260/UMA280 razão quando diferentes fontes de água são usadas para realizar as determinações espectrofotométricas. Por exemplo, a variação no pH da água entre 5,4 a 7,5-8,5 usado para suspender o RNA aumentou significativamente o RNA A260/UMA280 proporções de aproximadamente 1,5 a 2,0 5.

É importante que tanto o A260/UMA280 proporção e o A260/UMA230 as proporções estão próximas de 2,0 (Tabela 7.1).

Contaminação por TRIS, etanol e isopropanol

Efeito da contaminação TRIS: A contaminação por TRIS não influencia significativamente o espectro de absorbância de RNA / DNA.

Efeito da contaminação por etanol: O etanol não tem um efeito significativo no espectro de absorbância de RNA / DNA quando medido em TE pH 8,0. No entanto, quando a medição é feita em água pura, o A260/UMA280 a proporção pode ser reduzida e, portanto, uma proporção inferior a 2,0 pode indicar contaminação por etanol.

Efeito da contaminação por isopropanol: O isopropanol não tem um efeito significativo no espectro de absorbância de RNA / DNA quando medido em TE pH 8,0. No entanto, quando a medição é feita em água pura, o A260/UMA280 a proporção pode ser reduzida e, portanto, uma proporção inferior a 2,0 pode indicar contaminação por isopropanol.

Proteína, isotiocianato de guanidina e contaminação de fenol

Efeito da contaminação de proteínas: Uma amostra contendo uma contaminação de 0,01% BSA pode mostrar um espectro de absorbância quase normal, embora o A260/UMA280 a proporção pode cair abaixo de 1,9 (RNA) ou 1,7 (DNA), o que é um alerta de que algo está contaminando a amostra. A 0,5% de BSA, os espectros de absorbância parecem anormais e esta é uma indicação clara de que há um nível significativo de contaminação na amostra. Portanto, altas concentrações de proteína podem ser detectadas por A anormal260/UMA280 proporções, mas as quantidades baixas e moderadas, não.

Efeito da contaminação por isotiocianato de guanidina: Isotiocianato de guanidina tem pouca influência sobre o A260/UMA280 razão, portanto, o isotiocianato de guanidina tem um pequeno efeito na quantificação do RNA. No entanto, a presença de isotiocianato de guanidina tem um efeito muito forte sobre o A260/UMA230 proporção em uma contaminação de 0,5%, o A260/UMA230 a proporção cai abaixo de 0,5. As amostras com suspeita de contaminação por guanidina devem ser evitadas, pois isso teria um efeito deletério nas reações enzimáticas a jusante.

Efeito da contaminação por fenol: O fenol tem um efeito muito forte na quantificação do RNA. A 0,5% de contaminação de fenol de uma amostra de RNA a 50 ng / μL, a concentração medida é três vezes maior. Este forte efeito perturbador do fenol na quantificação do RNA é devido ao pico de absorção contaminante a 270 nm. Em concentrações de RNA muito baixas, abaixo de 10 ng / μL, esse pico contaminante é frequentemente confundido com RNA. No entanto, a absorbância do RNA está sempre em 260 nm e nunca em 270 nm, portanto, se o pico estiver em 270 nm, é devido a uma contaminação. Depois que o RNA foi isolado usando um método baseado em fenol, a superestimação errônea da concentração de RNA é um problema sério. Este é particularmente o caso quando o RNA está em baixa concentração.

Espectrofotometria UV automatizada

Enquanto a espectroforese UV convencional exigia que as medições fossem realizadas usando volumes relativamente altos de amostra, agora existem sistemas como o espectrofotômetro NanoDrop ® 2000 UV-Vis que são automatizados e suportam análises altamente precisas de tamanhos de amostra extremamente pequenos. Os sistemas de retenção de amostra eliminam a necessidade de cubetas e capilares, o que diminui a quantidade de amostra analisada para entre 0,5 μL e 2 μL. O NanoDrop fornece uma varredura da absorbância de cerca de 200 nm a 350 nm, que é a região relevante para determinar a concentração e pureza de RNA / DNA.

Sistemas de quantificação de ácido nucléico com base em fluorescência

O uso de corantes fluorescentes para quantificar os ácidos nucléicos é uma alternativa à espectrofotometria de absorbância 6,7. A determinação da concentração de ácido nucleico usando métodos fluorescentes utiliza a ligação de pequenas moléculas ou corantes aos ácidos nucleicos e mede as mudanças subsequentes nas características de fluorescência. Embora mais cara do que a espectrofotometria de absorvância, a quantificação baseada em fluorescência é mais sensível, precisa e pode ser específica para o ácido nucleico de interesse.

Uma vez que os fluorômetros medem a fluorescência em unidades relativas em vez de absolutas, a medição é primeiro calibrada com uma concentração conhecida de uma solução de ácido nucleico padrão com características semelhantes às da amostra a ser medida. Após a calibração, uma única medição pode estabelecer a concentração de ácido nucleico na solução, mas normalmente uma curva padrão será necessária para determinar a linearidade do ensaio na faixa medida.

Sistemas automatizados como o fluorômetro QuBit ® 2.0 (Life Technologies) podem ser usados ​​com uma variedade de diferentes ensaios de quantificação baseados em fluorescência para a medição da concentração de ácido nucleico em solução. Os ensaios demonstram uma ampla faixa dinâmica de detecção e são capazes de analisar com precisão pequenas amostras.

É fundamental observar que a leitura de DO é uma medida de absorção e não pode ser usada como uma avaliação completa da qualidade da amostra. Da mesma forma, os sistemas baseados em fluorescência fornecem uma medida de quantidade e não de qualidade. Por exemplo, estes não podem ser usados ​​como um teste para a integridade da amostra e uma análise adequada também deve ser realizada, como uma eletroforese capilar, resolução de gel ou o ensaio de razão 3 '/ 5' (conforme descrito abaixo).


Os estágios do método são lisar, ligar, lavar e eluir. [1] [2] Mais especificamente, isso envolve a lise das células alvo para liberar ácidos nucleicos, ligação seletiva do ácido nucleico a uma membrana de sílica, lavagem de partículas e inibidores que não estão ligados à membrana de sílica e eluição do ácido nucleico ácido, com o resultado final sendo ácido nucleico purificado em uma solução aquosa.

Para a lise, as células (sangue, tecido, etc.) da amostra devem ser submetidas a um tratamento para romper a membrana celular e liberar o ácido nucléico. Dependendo do material alvo, isso pode incluir o uso de detergente ou outros tampões, proteinases ou outras enzimas, aquecimento a vários tempos / temperaturas ou interrupção mecânica, como corte com uma faca ou homogeneizador, usando um almofariz e pilão, batendo com um moinho de contas.

Para a ligação, uma solução tampão é então adicionada à amostra lisada junto com etanol ou isopropanol. A amostra na solução de ligação é então transferida para uma coluna de rotação e a coluna é colocada em uma centrífuga ou anexada a um vácuo. A centrífuga / vácuo força a solução através de uma membrana de sílica que está dentro da coluna de spin, onde sob as condições iônicas corretas, os ácidos nucléicos se ligam à membrana de sílica, conforme o resto da solução passa. Com o material alvo ligado, o fluxo pode ser removido.

Para lavar, um novo tampão é adicionado à coluna e, em seguida, centrifugado / aspirado através da membrana. Este tampão se destina a manter as condições de ligação, enquanto remove os sais de ligação e outros contaminantes restantes. Geralmente, são necessárias várias lavagens, geralmente com porcentagens crescentes de etanol / isopropanol, até que o ácido nucléico na membrana de sílica esteja livre de contaminantes. A última 'lavagem' costuma ser uma etapa de secagem para permitir que o álcool evapore, deixando apenas os ácidos nucléicos purificados ligados à coluna.

Finalmente, eluição é o processo de adicionar uma solução aquosa à coluna, permitindo que o ácido nucleico hidrofílico deixe a coluna e retorne à solução. Esta etapa pode ser melhorada com sal, pH, tempo ou calor. Finalmente, para capturar o eluato / eluente, a coluna é transferida para um microtubo limpo antes de uma última etapa de centrifugação.

Mesmo antes dos métodos de ácido nucleico empregados hoje, sabia-se que na presença de agentes caotrópicos, como iodeto de sódio ou perclorato de sódio, o DNA se liga a sílica, partículas de vidro ou a algas unicelulares chamadas diatomáceas que protegem suas paredes celulares com sílica. Esta propriedade foi usada para purificar o ácido nucleico usando pó de vidro ou contas de sílica sob condições alcalinas. [3] Isso foi melhorado posteriormente usando tiocianato de guanidínio ou cloridrato de guanidínio como o agente caotrópico. [4] Para facilitar o manuseio, o uso de contas de vidro foi posteriormente alterado para colunas de sílica. E para permitir o uso de instrumentos de extração automatizados, houve o desenvolvimento de grânulos paramagnéticos revestidos de sílica, mais comumente chamados de extração de "grânulos magnéticos".


O DNA é mais solúvel na fase aquosa

Então, o que isso tem a ver com a separação de DNA e proteína?

Bem, em geral, os compostos polares (carregados) se dissolvem melhor em solventes polares e as moléculas não polares se dissolvem melhor em solventes menos polares ou não polares.

O DNA é uma molécula polar devido às cargas negativas em sua estrutura de fosfato, por isso é muito solúvel em água e menos em fenol. Isso significa que quando a água (+ DNA + proteína) e o fenol são misturados no protocolo, o DNA não se dissolve no fenol, mas permanece na fase aquosa.


O que faz um bom buffer?

Em 1966, Norman Good e colegas decidiram definir os melhores buffers para sistemas bioquímicos (Good et al. 1966). Good estabeleceu vários critérios para tais buffers:

  • A pKuma entre 6 e 8. A maioria dos experimentos bioquímicos tem um pH ideal na faixa de 6 & ndash8. A faixa de tamponamento ideal para um tampão é a constante de dissociação do componente ácido fraco do tampão (pKuma) mais ou menos unidade de pH.
  • Solubilidade em Água. As reações biológicas, em sua maioria, ocorrem em ambientes aquosos, e o tampão deve ser solúvel em água por esse motivo.
  • Exclusão por membranas biológicas. Isso não é importante para todas as reações bioquímicas. However, if this is an important criterion for your particular experiment, it is helpful to remember that zwitterionic buffers (positive and negative charges on different atoms within the molecule) do not pass through biological membranes. Examples of zwitterionic buffers include MOPS and HEPES Tris and phosphate buffers do not isomerize into zwitterions.
  • Minimal salt effects. In other words, the buffer components should not interact or affect ions involved in the biochemical reactions being explored.
  • Minimal effects on the dissociation from changes in temperature and concentration. Usually there is some change in the dissociation with a change in concentration. If this change is small, stock solutions usually can be diluted without changing the pH. However, with some buffers, changes in concentration have more effect on dissociation, and stock solutions cannot be diluted without significantly affecting pH.
    For instance, the pH of Tris decreases approximately 0.1 pH unit per tenfold dilution, and the pH could change dramatically if you dilute a working solution and are at the limits of the optimal buffering range of the Tris (optimal buffering range pH 7.3&ndash9.3 at 20°C). Note that Tris is not one of Good&rsquos buffers.
    Temperature changes can be a problem too. Tris exhibits a large shift in dissociation with a change in temperature. For example, if you prepare a Tris buffer at pH 7.0 at 4.0°C and perform a reaction in that same buffer at 37°C, the pH will drop to 5.95.
    If you have a Tris buffer prepared at 20°C with a pKuma of 8.3, it would be an effective buffer for many biochemical reactions (pH 7.3&ndash9.3), but the same Tris buffer used at 4°C becomes a poor buffer at pH 7.3 because its pKuma shifts to 8.8.
    So the take-home message: Make the buffer at the temperature you plan to use it, and if your experiment involves a temperature shift, select a buffer with a range that can accommodate any shift in dissociation as a result.
  • Minimal interactions between buffer components and critical reaction components. If a complex forms between the buffer and a required cofactor, say a metal cation like zinc or magnesium, your reaction also might be compromised. For example calcium precipitates as calcium phosphate in phosphate buffers. Not only would any Ca 2+ -requiring reactions be compromised, but the buffering capacity of the phosphate buffer also is affected.
    Having excessive amounts of a chelating agent in the buffer for an enzymatically driven reaction could cause problems (e.g., a high concentration of EDTA in a PCR amplification). Citrate is a calcium chelator, so avoid citrate buffers in situations where calcium concentrations are critical.
    Tris buffers again give us problems because Tris contains a reactive amine group. If you are trying to make Tris buffer that is RNase-free, the amine group on the Tris molecule will react with diethylpyrocarbonate (DEPC), the chemical typically used to pretreat aqueous solutions used for RNA work. So, do not DEPC-treat Tris-containing solutions. HEPES is another buffer that reacts with DEPC. (Remember too, that MOPS is a much better buffer for most RNA work!)
    Take-home message: Buffers are not inert. Be careful which ones you chose.
  • Chemical stability. The buffer should be stable and not break down under working conditions. It should not oxidize or be affected by the system in which it is being used. Try to avoid buffers that contain participants in reactions (e.g., metabolites).
    Some buffers, such as MOPS, must be protected from light, but when they are stored properly they are still extremely useful buffers in biochemical reactions and laboratory protocols like RNA electrophoresis.
  • Light absorption. The buffer should not absorb UV light at wavelengths that may be used for readouts in photometric experiments.
  • Ease of Use. The buffer components should be easy to obtain and prepare.

Boa et al. defined several characteristics of buffers for biochemical reactions. No matter what buffer you choose, you need to consider effects of temperature and environment on the buffer and ensure that the buffer is compatible with your system.


Introduction to Single-Cell RNA Sequencing

During the last decade, high-throughput sequencing methods have revolutionized the entire field of biology. The opportunity to study entire transcriptomes in great detail using RNA sequencing (RNA-seq) has fueled many important discoveries and is now a routine method in biomedical research. However, RNA-seq is typically performed in "bulk," and the data represent an average of gene expression patterns across thousands to millions of cells this might obscure biologically relevant differences between cells. Single-cell RNA-seq (scRNA-seq) represents an approach to overcome this problem. By isolating single cells, capturing their transcripts, and generating sequencing libraries in which the transcripts are mapped to individual cells, scRNA-seq allows assessment of fundamental biological properties of cell populations and biological systems at unprecedented resolution. Here, we present the most common scRNA-seq protocols in use today and the basics of data analysis and discuss factors that are important to consider before planning and designing an scRNA-seq project. © 2018 by John Wiley & Sons, Inc.

Palavras-chave: RNA sequencing gene expression profiling single-cell analysis.


Assista o vídeo: Micro RNA e Interferência de RNA (Dezembro 2021).