Em formação

Pancretic Acinar Cell - ATP, dados de concentração de cálcio


Preciso encontrar uma fonte decente de dados para a concentração de ATP e cálcio na célula acinar pancreática.

Até agora, tudo que consegui encontrar é ATP ou 'níveis' de cálcio com base na fluorescência, que não são acompanhados por um valor de concentração em moles / molar.

É possível encontrar essas informações em um livro ou site específico, para evitar a pesca de arrasto em grande quantidade de literatura?


Neste estudo, embora tenham usado o método baseado em fluorescência, eles relataram concentrações.

Quando estudamos as concentrações basais de cálcio intracelular em ácinos de ratos controle, eles estavam na faixa nanomolar baixa (140 ± 5 nmol).

Para concentrações de ATP, você pode ver aqui.

É possível encontrar essas informações em um livro ou site específico, para evitar a pesca de arrasto em grande quantidade de literatura?

Existe o banco de dados do metaboloma humano. No entanto, ele não possui dados para todos os tipos de células. Mais estudos são necessários ou o banco de dados precisa ser atualizado.

Da mesma forma, há o banco de dados do metaboloma de levedura (você pode não exigi-lo para sua consulta, mas apenas mais uma informação que achei que valeria a pena adicionar).


Interações cálcio-magnésio em células acinares pancreáticas

Embora o papel do cálcio (Ca 2+) na transdução do sinal e na patobiologia do pâncreas exócrino esteja firmemente estabelecido, o papel do magnésio (Mg 2+) permanece obscuro. Nós caracterizamos a distribuição intracelular de Mg 2+ em resposta à estimulação hormonal em células acinares pancreáticas isoladas de camundongo e estudamos o papel do Mg 2+ na modulação da sinalização de Ca 2+ usando microespectrofluorometria e imagem digital de Ca 2+ -ouMg 2+ -corantes fluorescentes sensíveis, bem como microeletrodos intracelulares sensíveis ao Mg 2+. Nossos resultados indicam que um aumento nas concentrações intracelulares de Mg 2+ reduziu as oscilações de Ca 2+ induzidas por colecistocinina (CCK) ao inibir o influxo capacitivo de Ca 2+. Uma mobilização intracelular de Ca 2+, por outro lado, foi acompanhada por uma diminuição na [Mg 2+]eu, que foi reversível com a retirada do hormônio independente dos gradientes eletroquímicos para Mg 2+, Ca 2+, Na + e K +, e não causado por efluxo de Mg 2+ das células acinares. Em uma tentativa de caracterizar possíveis estoques de Mg 2+ que explicariam os movimentos intracelulares reversíveis de Mg 2+ induzidos por hormônios, descartamos mitocôndrias ou ATP como potenciais tampões de Mg 2+ e descobrimos que o [Mg 2+] induzido por CCKeu a redução foi iniciada na parte basolateral das células acinares, onde se localiza a maior parte do retículo endoplasmático (RE), e daí progrediu em direção ao pólo apical das células acinares de forma antiparalela às ondas de Ca 2+. Esses experimentos representam a primeira caracterização dos movimentos intracelulares de Mg 2+ no pâncreas exócrino, fornecem evidências para possíveis estoques de Mg 2+ no ER e indicam que a distribuição espacial e temporal das concentrações intracelulares de Mg afeta profundamente o Ca 2+ da célula acinar. signaling.— Mooren, FC, Turi, S., Günzel, D., Schlue, W.-R., Domschke, W., Singh, J., Lerch, MM Calcium-mag¬nesium interations in pancreatic acinar cells. FASEB J. 15, 659-672 (2001)

Em contraste com as rápidas mudanças de cálcio intracelular em resposta a estímulos externos, cujo papel em vários eventos de transdução de sinal está agora firmemente estabelecido (1–4), a importância das mudanças de magnésio intracelular é amplamente desconhecida. Embora Mg 2+ seja um cofator conhecido para múltiplas reações enzimáticas e sua concentração intracelular tenha mostrado responder a estímulos hormonais - embora de uma forma muito mais lenta do que as concentrações de Ca 2+ correspondentes - seu papel na regulação de processos fisiológicos ou fisiopatológicos tem permaneceu especulativo. Foram estabelecidas semelhanças e diferenças importantes em relação à fisiologia dos dois cátions divalentes cálcio e magnésio. As concentrações intracelulares de cálcio são geralmente mantidas em níveis muito baixos, e esses baixos níveis de cálcio intracelular (de

100 nM) não apenas requerem a manutenção ativa de um gradiente de cálcio de 10.000 vezes através da membrana plasmática, mas também são um pré-requisito para o papel mensageiro intracelular do cálcio (5). Por outro lado, enquanto o magnésio demonstrou estar envolvido na modulação de vários canais e transportadores iônicos (6, 7) e esse efeito modulador parece ser de grande relevância fisiopatológica e clínica (8), seu gradiente através da membrana plasmática é muito pequeno. Foi assumido que a concentração de magnésio intracelular é, análoga à concentração de cálcio intracelular, rigidamente controlada e regulada por eventos de sinalização dependentes de agonista. No entanto, apenas avanços recentes no desenvolvimento de métodos microanalíticos, como sondas fluorescentes sensíveis a Mg 2+ (9) e microeletrodos seletivos de Mg 2+ (10), tornaram possíveis investigações sobre a regulação intracelular de Mg 2+ (11-14) e possibilitou experimentos sobre mudanças de Mg 2+ em resposta a agonistas hormonais em sistemas de cultura de células (15, 16) ou isolados de células primárias (17-19).

Neste estudo, investigamos o papel biológico do Mg 2+ no pâncreas exócrino, um sistema orgânico no qual rápidas mudanças intracelulares de Ca 2+ determinam o início e o curso de eventos fisiológicos (1) e fisiopatológicos (20). Usando ácinos pancreáticos de camundongo isolados - unidades secretoras intactas de células exócrinas vivas - usamos indicadores fluorescentes sensíveis a Mg 2+, bem como microeletrodos seletivos de íons intracelulares para investigar as mudanças espaciais e temporais em [Mg 2+]eu em resposta a estímulos fisiológicos e patológicos. Determinamos ainda sua correlação e interferência com as alterações do cálcio intracelular nas células acinares pancreáticas. Nossos resultados indicam que as concentrações intracelulares de Mg 2+ no pâncreas exócrino são reguladas de forma controlada por estímulo. Além disso, eles podem neutralizar os efeitos na via de transdução do sinal de Ca 2+ - a captação e liberação 'mais lenta' de Mg 2+ do estoque intracelular, mais provavelmente associada ao ER, ocorre de uma maneira que é completamente antiparalela à 'rápida' Liberação e recaptação de Ca 2+ nas células acinares.


Agostini, B., Hasselbach, W. 1971. Electron cytochemistry of cálcio uptake in the fragmented sarcoplasmic reticulum.Histoquímica 28:55–67

Amsterdam, A., Jamieson, J.D. 1972. Structural and Functional Characterization of isolated pancreatic exocrine cells.Proc. Natl. Acad. Sci. EUA 69:3028–3032

Bruns, D.E., McDonald, J.M., e Jarett, L. 1976. Transporte de cálcio dependente de energia em retículo endoplasmático de adipócitos.J. Biol. Chem. 251:7191–7197

Case, R.M., Clausen, T. 1973. A relação entre a troca de cálcio e a secreção de enzima no pâncreas de rato isolado.J. Physiol. (Londres) 235:75–102

Chandler, D.E., Williams, J.A. 1978. Liberação de cátion divalente intracelular em células acinares pancreáticas durante o acoplamento estímulo-secreção. I. Uso de clorotetraciclina como sonda fluorescente.J. Cell Biol. 76:371–385

Chandler, D.E., Williams, J.A. 1978. Liberação de cátion divalente intracelular em células acinares pancreáticas durante o acoplamento estímulo-secreção. II. Localização subcelular da clorotetraciclina fluorescente.J. Cell Biol. 76:386–399

Chimoskey, J.E., Gergely, J. 1968. Effect of ion on sarcoplasmic reticulum fragments.Arco. Biochem. Biophys. 128:601–605

Chu, A., Bick, R.J., Tate, C.A., Van Winkle, W.B., Entman, M.L. 1983. Efeitos do ânion emem vitro função do retículo sarcoplasmático.J. Biol. Chem. 258:10543–10550

Chu, A., Tate, C.A., Bick, R.J., Van Winkle, W.B., Entman, M.L. 1983. Efeitos do ânion emem vitro função do retículo sarcoplasmático.j. Biol. Chem. 258:1656–1664

Clemente, F., Meldolesi, J. 1975. Cálcio e a secreção pancreática-dinâmica de pools de cálcio subcelular em células acinares em repouso e estimuladas.Br. J. Pharmacol. 55:369–379

Colca, J.R., McDonald, J.M., Kotagal, N., Patke, Ch., Fink, C.J., Greider, M.H., Lacy, P.E., McDaniel, M.L. 1982. Captação ativa de cálcio pelo retículo endoplasmático de células ilhotas.J. Biol. Chem. 257:7223–7228

Dormer, R.L., Williams, J.A. 1981. Mudanças induzidas por secretagogue na distribuição subcelular de Ca 2+ em ácinos pancreáticos isolados.Sou. J. Physiol. 240: G130-G140

Duggan, P.F. 1977. Cálcio uptake and associated adenosine trifhosphatase activity in fragmented sarcoplasmic reticulum.J. Biol. Chem. 252:1620–1627

Eimerl, S., Savion, N., Heichal, O., Selinger, Z. 1974. Indução da secreção enzimática em fatias pancreáticas de rato usando o ionóforo A-23187 e cálcio.J. Biol. Chem. 249:3991–3993

Gardner, J.D., Conlon, T.P., Klaeveman, H.L., Adams, T.D., Ondetti, M.A. 1975. Action of cholecystokinin and colinergic agents on cálcio transport in isolated pancreatic acinar cells.J. Clin. Investir. 56:366–375

Grover, A.K., Kwan, C.Y. 1983. Estimulação de oxalato de absorção de Ca dependente de ATP em membranas de músculo liso isoladas.Fed. Proc. 42:1278

Hasselbach, W. 1974. Sarcoplasmic ATPase.No: As enzimas. P.D. Boyer, editor. Vol. 10, pp. 431–467. Acadêmico, Nova York

Hatcher, D.W., Goldstein, G. 1969. Métodos melhorados para determinação de RNA e DNA.Anal. Biochem. 31:42–50

Heisler, S., Fast, D., Tenenhouse, A. 1972. Role of Ca 2+ e AMP cíclico na secreção de proteínas do pâncreas exócrino de rato.Biochim. Biophys. Acta 279:561–572

Henkart, P.H., Reese, T.S., Brinley, F.J., Jr. 1978. O retículo endoplasmático sequestra cálcio no axônio gigante de lula.Ciência 202:1300–1303

Hokin, L.E. 1966. Efeitos da omissão de cálcio na secreção de amilase estimulada pela acetilcolina e na síntese de fosfolipídios em fatias de pâncreas de pombo.Biochim. Biophys. Acta 115:219–221

Immelmann, A., Söling, H.-D. 1983. sequestro de cálcio dependente de ATP e estequiometria de cálcio / ATP em microssomas isolados de glândulas parótidas de cobaia.FEBS 162:406–410

Inesi, G., Maring, E., Murphy, A.J. e McFarland, B.H. 1970. Um estudo do intermediário fosforilado do retículo sarcoplasmático ATPase.Arco. Biochem. Biophys. 138:285–294

Iwatsuki, N., Petersen, O.H. 1977. Efeitos semelhantes à acetilcolina da aplicação de cálcio intracelular em células acinares pancreáticas.Nature (Londres) 268:147–149

Jones, L.R., Besch, H.R., Watanabe, A.M. 1977. Estimulação catiônica monovalente de captação de Ca 2+ por vesículas de membrana cardíaca.J. Biol. Chem. 252:3315–3323

Kanagasuntheram, P., Teo, T.S. 1982. Parotid microsomal Ca 2+ transport.Biochem. J. 208:789–794

Kanazawa, T., Boyer, P.D. 1973. Ocorrência e características de uma troca rápida de oxigênio de fosfato catalisada por vesículas de retículo sarcoplasmático.J. Biol. Chem. 248:3163–3172

Knight, D.E., Koh, E. 1983. Evidência direta de um papel do Ca 2+ eu na secreção de amilase de células acinares pancreáticas isoladas de rato.J. Physiol. (Londres) 345:107

Kondo, S., Schulz, I. 1976. Captação de íons de cálcio em células isoladas do pâncreas induzidas por secretagogos.Biochim. Biophys. Acta 419:76–92

Kribben, A., Tyrakowski, T., Schulz, I. 1983. Characterization of Mg-ATP-dependente Ca 2+ transport in cat pancreatic microsomes.Sou. J. Physiol. 244: G480-G490

Lambert, M., Christophe, J. 1978. Characterization of (Mg, Ca) -ATPase activity in rat pancreatic plasma membranes.EUR. J. Biochem. 91:485–492

Lowry, O.H., Rosebrough, N.T., Farr, A.L., Randall, R.J. 1951. Medição de proteína com o reagente de fenol de Folin.J. Biol. Chem. 193:265–275

Lucas, M., Galvan, A., Solano, P., Goberna, R. 1983. Compartmentation of cálcio in digitonin-disrupted guinea pig pancreatic acinar cells.Biochim. Biophys. Acta 731:129–136

Lucas, M., Schmid, G., Kromas, R., Löffler, G., 1978. Calcium metabolism and enzima secreion in guinea pig pancreas.EUR. J. Biochem. 85:609–619

McGraw, C.F., Somlyo, A.V., Blaustein, M.P. 1980. Localização de cálcio em terminais nervosos pré-sinápticos. Uma análise ultraestrutural e de microssonda eletrônica.J. Cell Biol. 85:228–241

Meissner, G. 1981. Transporte de cálcio e cátions monovalentes e fluxos de prótons em vesículas de retículo sarcoplasmático.J. Biol. Chem. 256:636–643

Meissner, G., McKinley, D. 1982. Permeability of canine heart sarcoplasmic reticulum vesicles to K +, Na +, H + e Cl-.J. Biol. Chem. 257:7704–7711

Mejbaum, W. 1939. Über die Bestimmung kleiner Pentosemengen insbesondere in Derivaten der Adenylsäure.Z. Physiol. Chem. 258:117–120

Moore, L., Chen, T.S., Knapp, H.R., Jr., Landon, E.J. 1975. Atividade de sequestro de cálcio dependente de energia em microssomas de fígado de rato.J. Biol. Chem. 250:4562–4568

Moore, L., Fitzpatrick, D.F., Chen, T.S., Landon, E.J. 1974. Atividade da bomba de cálcio da membrana plasmática renal e microssomas renais.Biochim. Biophys. Acta 345:405–418

O'Doherty, J., Stark, R.J. 1982. Estimulação da secreção acinar pancreática: Aumentos no cálcio e sódio citosólicos.Sou. J. Physiol. 242: G513-G521

Pertoft, H., Laurent, T.C., Seljelid, R. 1979. O uso de gradientes de densidade de Percoll para a separação de partículas biológicas.No: Separação de células e elementos subcelulares. H. Peeters, editor. pp. 67–72. Pergamon, Oxford e Nova York

Petersen, O.H., Iwatsuki, N. 1978. O papel do cálcio no acoplamento do estímulo-secreção das células acinares pancreáticas: Uma abordagem eletrofisiológica.Ann. N.Y. Acad. Sci. 307:599–617

Ponnappa, B.C., Dormer, R.L., Williams, J.A. 1981. Characterization of an ATP-dependente Ca 2+ uptake system in mouse pancreatic microsomes.Sou. J. Physiol. 240: G122-G129

Pozzan, T., Rink, T.J., Tsien, R.Y. 1981. Cytoplasmic pH and free Mg 2+ in pig mesenteric lymphocytes.J. Physiol. (Londres) 319:102

Preissler, M., Williams, J.A. 1983. Localization of ATP-dependente cálcio transport activity in mouse pancreatic microsomes.J. Membrane Biol. 73:137–144

Renckens, B.A.M., Schrijen, J.J., Swarts, H.G.P., De Pont, J.J.H.H.M., Bonting, S.L. 1978. Papel do cálcio na secreção pancreática exócrina. 4. Movimentos do cálcio em células acinares isoladas de pâncreas de coelho.Biochim. Biophys. Acta 544:338–350

Scharschmidt, B.F., Keeffe, E.B., Blankenship, N.M., Ockner, R.K. 1979. Validação de um método espectrofotométrico de registro para medição da atividade de Mg-e NaK-ATPase associada à membrana.J. Lab. Clin. Med. 93:790–799

Schulz, I. 1980. Papel de mensageiro de cálcio em função de células acinares pancreáticas.Sou. J. Physiol. 239: G335-G347

Schulz, I., Kimura, T., Wakasugi, H., Haase, W., Kribben, A. 1981. Analysis of Ca 2+ fluxes and Ca 2+ pools in pancreatic acini.Philos. Trans. R. Soc. Londres B 296:105–113

Schulz, I., Wakasugi, H., Stolze, H., Kribben, A., Haase, W. 1981. Analysis of Ca 2+ fluxes e sua relação com a secreção de enzima em células acinares pancreáticas dispersas.Fed. Proc. 40:2503–2510

Seals, J.R., McDonald, J.M., Bruns, D., Jarett, L. 1978. A sensitive and precise isotopic assay of ATPase activity.Anal. Biochem. 90:785–795

Sottocasa, G.L., Kuylenstierna, B., Ernster, L., Bergstrand, A. 1967. Um sistema de transporte de elétrons associado à membrana externa da mitocôndria hepática.J. Cell Biol. 32:415–436

Spurr, A.R. 1969. Um meio de incorporação de resina epóxi de baixa viscosidade para microscopia eletrônica.J. Ultrastruct. Res. 26:31–43

Stolze, H., Schulz, I. 1980. Effect of atropine, ouabaína, antimycin A, and A23187 on "trigger Ca 2+ pool" in exocrine pancreas.Sou. J. Physiol. 238: G338-G348

Streb, H., Irvine, R.F., Berridge, M.J., Schulz, I. 1983. Release of Ca 2+ from a nonmitocondrial intracelular store in pancreatic acinar cells by inositol-1,4,5-trisphosphate.Nature (Londres) 306:67–69

Streb, H., Schulz, I. 1983. Regulação da concentração de Ca 2+ livre citosólica em células acinares do pâncreas de rato.Sou. J. Physiol. 245: G347-G357

The, R., Hasselbach, W. 1972. The modificação of the reconstituted sarcoplasmic ATPase by monovalent catations.EUR. J. Biochem. 30:318–324

The, R., Hasselbach, W. 1975. A ação de ânions caotrópicos na bomba de cálcio sarcoplasmática.EUR. J. Biochem. 53:105–113

Udenfriend, S., Stein, S., Böhlen, P., Dairman, W., Lerngruber, W., Weigele, M. 1972. Fluorescamine: Um reagente para ensaio de aminoácidos, peptídeos, proteínas, aminas primárias no picomole faixa.Ciência 178:871–872

Wakasugi, H., Kimura, T., Haase, W., Kribben, A., Kaufmann, R., Schulz, I. 1982. Cálcium uptake into acini from rat pancreas: Evidence for intracelular ATP-Dependent cálcio sequestration.J. Membrane Biol. 65:205–220

Wibo, M., Morel, N., Godfraind, T. 1981. Diferenciação de bombas de Ca 2+ ligadas à membrana plasmática e retículo endoplasmático na fração microssomal do músculo liso intestinal.Biochim. Biophys. Acta 649:651–660


Afiliações

Departamento de Fisiologia Celular, Instituto Nacional de Ciências Fisiológicas, Okazaki, 444-8585, Japão

Tomomi Nemoto, Ryoichi Kimura e Haruo Kasai

Escola de Medicina da Universidade de Tóquio, Hongo, Bunkyo-ku, 113-0033, Tóquio, Japão

Tomomi Nemoto, Ryoichi Kimura, Koichi Ito, Akira Tachikawa, Yasushi Miyashita e amp Masamitsu Iino

CREST, Japan Science and Technology Corporation, Hongo, Bunkyo-ku, 113-0033, Tóquio, Japão

Tomomi Nemoto, Akira Tachikawa, Masamitsu Iino e amp Haruo Kasai

Você também pode pesquisar este autor no PubMed Google Scholar

Você também pode pesquisar este autor no PubMed Google Scholar

Você também pode pesquisar este autor no PubMed Google Scholar

Você também pode pesquisar este autor no PubMed Google Scholar

Você também pode pesquisar este autor no PubMed Google Scholar

Você também pode pesquisar este autor no PubMed Google Scholar

Você também pode pesquisar este autor no PubMed Google Scholar

Autor correspondente


DISCUSSÃO

O presente estudo demonstra claramente que H2O2 altera profundamente evocado por hormônio [Ca 2+]eu sinalização e repouso [Ca 2+]eu homeostase em células acinares pancreáticas. Essas mudanças foram devidas diretamente aos aumentos no estresse oxidativo intracelular, conforme avaliado pela fluorescência DCF e sensibilidade aos antioxidantes. Altos níveis de estresse oxidativo (1-3 mM H2O2) evocou um aumento grande, lento e irreversível na [Ca 2+]eu que após períodos prolongados (& gt20 min), em última análise, levou à lise celular, conforme indicado pela rápida perda de corante DCF. Além disso, e quase certamente mais importante, níveis mais baixos de estresse oxidativo (10-100 μM H2O2) também foram capazes de evocar aumentos irreversíveis semelhantes na [Ca 2+]eu em subpopulações de células. Essas observações são importantes porque a lise celular é uma característica comum da morte celular necrótica e pode ser a base da patologia da pancreatite. Além disso, um aumento irreversível na [Ca 2+]eu, ou sobrecarga de Ca 2+, também é considerada uma característica comum da pancreatite, qualquer que seja o agente causal (35).

A sobrecarga de Ca 2+ é um precursor patológico comum que medeia uma variedade de estados de doença, como a excitotoxicidade durante a neurodegeneração (1).Uma estratégia comum para compreender esta sobrecarga de Ca 2+, seja durante a excitotoxicidade ou durante a pancreatite, tem sido identificar as fontes de [Ca 2+]eu aumentar, incluindo mais notavelmente, as mitocôndrias (15, 34) e as vias de entrada de Ca 2+ (1, 37). No entanto, a natureza irreversível dessa sobrecarga de Ca 2+ sugere que talvez um mecanismo crítico subjacente a essa resposta seja o comprometimento da [Ca 2+]eu vias de eliminação. No presente estudo, demonstramos que uma concentração crítica de H2O2 (& gt100 μM) inibe ou inativa de forma dramática e irreversível o efluxo de Ca 2+. Curiosamente, isso corresponde ao H2O2 concentração que produziu uma sobrecarga irreversível de Ca 2+ na grande maioria das células.

A regulação de PMCA mediada por oxidantes foi diretamente demonstrada nas membranas neuronais e hepáticas (54) e foi sugerida a ocorrência em células acinares pancreáticas (34). O mecanismo poderia ser devido à modulação redox direta de grupos tiol críticos dentro do PMCA ou dentro da calmodulina (CaM) (54), ambos os quais poderiam inibir a ativação dependente de Ca 2+ / CaM do PMCA (13). Outra possibilidade é que o H2O2- aumento evocado em [Ca 2+]eu ativa proteases dependentes de Ca 2+, como caspases ou calpaína, que são conhecidas por clivar e, portanto, inativar o PMCA (40). Um mecanismo semelhante foi descrito em neurônios, por meio do qual a clivagem da caspase do trocador Na + / Ca 2+ demonstrou mediar a sobrecarga de Ca 2+ durante a excitotoxicidade associada à isquemia cerebral (2). Além disso, e de relevância direta para o presente estudo, dois grupos demonstraram que a ativação dependente de Ca 2+ da calpaína leva à ativação do fator de transcrição da citocina, NF-k B, e lesão das células acinares pancreáticas (47, 51). Além disso, a lesão celular associada à pancreatite induzida por cerúleo foi acentuadamente melhorada pelos inibidores da calpaína (47, 52). Finalmente, agora há evidências de que H2O2 pode ativar diretamente a calpaína, e isso leva a lesão celular semelhante à observada durante a pancreatite (51). No entanto, o período de tempo durante o qual a calpaína se tornou significativamente ativada (exposição de 60 min a 0,5 mM de H2O2) nestes experimentos (51) ocorreu muito mais tarde do que quando observamos a inativação de PMCA (10 min de exposição a 1 mM de H2O2).

Além disso, baixas concentrações de H2O2 (10–50 μM) linha de base aumentada transitoriamente [Ca 2+]eu em uma grande proporção de células, e também é importante notar que o pré-tratamento de concentrações semelhantes aumentou significativamente a atividade de PMCA de uma maneira dependente de Ca 2+ devido ao vazamento de Ca 2+ evocado por CPA / TBQ (ver Fig. 7). Tal Ca 2+ - e modulação dependente do tempo do PMCA foi observada anteriormente em outras células (3) e acredita-se que seja devido ao aumento da ligação de CaM (13). Esta modulação dependente de Ca 2+ do PMCA faz sentido fisiológico. Os oxidantes de baixo nível aumentam a atividade do PMCA em uma tentativa de restaurar o repouso baixo [Ca 2+]eu em face de outras vias de transporte de Ca 2+ prejudicadas, evitando assim a lesão celular. No entanto, conforme o estresse oxidativo aumenta ainda mais, o PMCA torna-se irreversivelmente inativado, deixando a célula incapaz de restaurar o repouso [Ca 2+]eu e, portanto, levando a “sobrecarga de Ca 2+” e, portanto, lesão celular substancial.

Não é surpreendente que as concentrações milimolares de H2O2 produziu tais respostas patologicamente claras. No entanto, a observação surpreendente foi que as concentrações mais baixas de H2O2 (10–100 μM) produziram respostas marcadamente heterogêneas, de modo que houve uma mudança na população em favor do mais grave [Ca 2+]eu resposta com concentrações crescentes de H2O2. Além disso, o grau de comprometimento de [Ca 2+]eu a sinalização em qualquer célula foi diretamente proporcional ao aumento do estresse oxidativo celular, sugerindo que a heterogeneidade era devida a diferenças na capacidade antioxidante celular. Isso sugere que a concentração de H2O2 que produz qualquer resposta dada é menos importante do que a proporção de células que exibem essa resposta. Isso tem implicações patológicas importantes, porque apenas uma fração das células com baixa capacidade antioxidante pode ser suficiente para causar dano significativo ao tecido em todo o órgão diante de um insulto oxidante. Isso ocorre porque essas células altamente sensíveis provavelmente sofreriam uma sobrecarga irreversível de Ca 2+ em resposta ao estresse oxidativo de baixo nível, causando lise celular e morte celular necrótica. Isso pode causar liberação de citocinas inflamatórias e infiltração de neutrófilos ativados que posteriormente liberam oxidantes (22, 50), culminando em uma espiral de danos ao tecido citotóxico autoperpetuante e, em última instância, falência de órgãos, as marcas da pancreatite aguda grave (38). É tentador levantar a hipótese de que oxidantes de baixo nível liberados de dentro das células acinares (7, 17, 42) poderiam possivelmente iniciar a pancreatite se a capacidade antioxidante dessas células ou células vizinhas for baixa. Também é interessante que uma capacidade antioxidante pancreática reduzida tenha sido sugerida como um fator predisponente para a pancreatite crônica (4).

A principal fonte de [Ca 2+] evocado por oxidanteeu O aumento no presente estudo é provavelmente devido ao vazamento de Ca 2+ dos estoques de Ca 2+ sensíveis aos agonistas, como o ER. Isso ocorre porque o pré-tratamento com H2O2 melhorou o CPA / TBQ-evocado [Ca 2+]eu aumentar e o H direto2O2-aumento evocado em [Ca 2+]eu foi completamente abolido sob condições em que ER Ca 2+ foi esgotado e o influxo de Ca 2+ foi evitado. No entanto, em condições semelhantes, se as células foram estimuladas pela primeira vez com CCK, que evoca [Ca 2+] oscilatórioeu sinais e, portanto, captação mitocondrial substancial de Ca 2+ (17), H2O2 causou a liberação mitocondrial de Ca 2+ que foi abolida pelo desacoplador mitocondrial, CCCP. Isso é consistente com outros estudos que mostraram despolarização mitocondrial evocada por oxidante e liberação de Ca 2+ mitocondrial através da abertura do poro de transição de permeabilidade (15, 16, 34). No entanto, em células em repouso não estimuladas ingênuas, onde a captação mitocondrial de Ca 2+ não ocorre, é improvável que as mitocôndrias sejam a principal fonte de [Ca 2+] evocado por oxidanteeu aumentar.

A natureza exata do H2O2A liberação de Ca 2+ evocada por ER em células acinares pancreáticas de rato não está clara no presente estudo. Observamos [Ca 2+]eu oscilações em resposta a outro oxidante, timerosal (Fig. 2, inserir), em células acinares pancreáticas de rato e também em resposta a baixas concentrações de H2O2 em células acinares pancreáticas de camundongo (3-30 μM, dados não mostrados), consistente com outros estudos (16, 44). No entanto, nunca observamos [Ca 2+]eu oscilações em resposta a H2O2 em qualquer uma das concentrações testadas (10 μM-1 mM) em células acinares pancreáticas de rato, sugerindo que a natureza da resposta aos oxidantes depende do tipo de oxidante e da espécie em que é testado. Na verdade, o curso de tempo do H2O2-aumento evocado em [Ca 2+]eu em células acinares pancreáticas de rato era mais uma reminiscência de um vazamento lento de Ca 2+ do ER, causado pela inibição de SERCA (26, 29), ou um efeito direto na via de vazamento passivo, provavelmente devido ao complexo translocon ( 27). No entanto, mais trabalho é necessário para verificar esse mecanismo e está além do escopo deste estudo.

O H2O2- aumento evocado em [Ca 2+]eu também era dependente do influxo de Ca 2+, uma vez que a resposta foi acentuadamente atenuada pela remoção do [Ca 2+] externo. No entanto, isso é provavelmente devido à depleção de ER Ca 2+ e uma ativação indireta de SOCE. Um efeito direto nos canais SOCE é improvável desde a adição de H2O2 não afetou a taxa de [Ca 2+]eu aumenta quando o Ca 2+ externo foi adicionado de volta às células depletadas de ER, um ensaio rotineiramente usado como uma medida indireta de SOCE (36). Não obstante, um efeito direto de H2O2 em vias de influxo de Ca 2+ não capacitativas não podem ser completamente descartadas.

Uma possibilidade alternativa é um efeito de depleção de ATP celular, que é classicamente visto como uma das primeiras alterações na lesão oxidativa (41). Foi relatado que a depleção de 90% do ATP celular aumenta a [Ca 2+] basaleu e inibir [Ca 2+]eu oscilações nas células acinares pancreáticas (45). No entanto, estudos em células epiteliais intestinais em cultura sugerem que mesmo altas concentrações milimolares de H2O2 não esgote o ATP celular significativamente nos primeiros minutos de exposição (49). Além disso, as medições de 31 P NMR mostraram que os níveis intracelulares de ATP no pâncreas de ratos mudam em não mais do que 20%, mesmo durante a estimulação agonista máxima, quando a demanda de energia metabólica é presumivelmente alta (28). Dado que H2O2 aumentou [Ca 2+]eu quase imediatamente, embora de forma relativamente lenta, parece improvável que a depleção global de ATP seja o mecanismo primário para o aumento da [Ca 2+]eu ou inibição do PMCA, embora as alterações locais no ATP não possam ser excluídas.

Baixas concentrações de H2O2 (10-100 μM) também alterou profundamente [Ca 2+] evocado por CCKeu oscilações. Conforme indicado acima, o esgotamento do estoque de ER e a inativação do PMCA também são explicações prováveis ​​para os casos mais graves de sobrecarga de Ca 2+ sob essas condições. Além disso, sob as condições desses experimentos, a função mitocondrial prejudicada provavelmente contribui para a deficiência evocada por CCK [Ca 2+]eu oscilações consistentes com outros estudos (16). Além disso, o oxidante, tert-butilidroperóxido, também demonstrou prejudicar [Ca 2+] evocado por carbacoleu oscilações, que se fundiram em uma resposta sustentada nas células acinares pancreáticas (43). Essas observações também corresponderam a um acentuado comprometimento do fluido evocado pelo agonista e da secreção de amilase do pâncreas perfundido (43).

Outra observação interessante do presente estudo foi que havia diferenças marcantes na proporção de células mostrando dano moderado a grave quando H2O2 foi aplicado durante evocado por CCK [Ca 2+]eu oscilações em comparação com quando H2O2 foi adicionado às células em repouso. Em particular, 50 μM H2O2 produziu uma resposta de sobrecarga de Ca 2+ em aproximadamente metade das células em repouso em comparação com nenhuma das células estimuladas. Essas observações podem ser importantes do ponto de vista patológico, pois sugerem que as células estão mais protegidas dos efeitos do H2O2 quando estimulado com CCK. Até onde sabemos, esta é uma nova descoberta que sugere que a CCK se acopla a ou aumenta uma via antioxidante dentro das células, ou que algum aspecto da maquinaria de sinalização de Ca 2+ confere proteção dependente do uso contra o ataque de oxidantes. No entanto, mais trabalho é necessário para elucidar completamente o mecanismo, que está claramente além do escopo deste estudo.

Em resumo, o presente estudo mostra que menores concentrações de H2O2 aumentado transitoriamente [Ca 2+]eu devido em grande parte à depleção de ER [Ca 2+] e ativação do influxo de Ca 2+ (SOCE). Além disso, H2O2 também alterou profundamente o padrão normal de [Ca 2+] evocado por CCKeu oscilações, reduzindo a amplitude e a frequência das oscilações que às vezes são sobrepostas a uma linha de base crescente. A interrupção do manuseio do Ca 2+ mitocondrial também pode contribuir para essas respostas. Da mesma forma, o aumento do vazamento de ER Ca 2+ evocado pelo pré-tratamento com essas baixas concentrações de H2O2 também aumentou indiretamente a atividade do PMCA, que é o último gatekeeper para o controle de baixo repouso [Ca 2+]eu. Durante o ataque do oxidante, sugerimos que o PMCA trabalhe duro para manter [Ca 2+]eu homeostase em face das vias de transporte desreguladas de Ca 2+. No entanto, em um H crítico2O2 concentração (dependendo da capacidade antioxidante da célula), a atividade do PMCA diminuiu rápida e irreversivelmente. Isso provavelmente converte a célula de uma célula levemente afetada, que pode manter [Ca 2+]eu homeostase em algum grau, para uma célula gravemente afetada, onde [Ca 2+]eu é descontrolado e, portanto, irreversivelmente elevado. Esse mecanismo pode, portanto, ser importante para facilitar a sobrecarga de Ca 2+, resultando assim em uma espiral de lesão celular autoperpetuada.

Finalmente, os efeitos de concentrações mais baixas de H2O2 deu origem a um grande grau de heterogeneidade celular, provavelmente devido a diferenças na capacidade antioxidante celular. Isso ilustra ainda mais que a transição de uma célula afetada "suavemente" para uma célula afetada "severamente" precisa ocorrer apenas em uma fração de células com baixa capacidade antioxidante para desencadear uma resposta inflamatória citotóxica. A inativação do PMCA pode ser um mecanismo crítico subjacente a esses eventos e pode muito bem ser importante durante a patologia da pancreatite.


Resultados

Medições SOCE em Ameloblastos Únicos

Como as necessidades de Ca 2+ são maiores durante a maturação do esmalte do que no estágio secretor anterior, um requisito primário era determinar se a SOCE também estava elevada durante a maturação. Em um estudo anterior, relatamos SOCE aumentado durante a maturação em uma população de células mistas de células EO primárias de rato analisadas em um leitor de placas (Nurbaeva et al., 2015a). Embora essas populações mistas sejam amplamente compostas por ameloblastos (Chen et al., 1998), a contaminação por fibroblastos é provável. No presente estudo, desenvolvemos um protocolo para obter [Ca 2+] de célula únicacyt gravações que nos permitiram discriminar ameloblastos usando o marcador de fibroblastos CD90 para eliminar essas células. A predominância esmagadora de ameloblastos foi posteriormente validada histologicamente usando duas proteínas marcadoras, amelogenina e ameloblastina (Figura Suplementar S1).

Ameloblastos em estágio de secreção e maturação foram carregados com Fura-2 conforme relatado (Nurbaeva et al., 2015a). Descobrimos que os ameloblastos secretores mostraram menor [Ca 2+] basalcyt do que aqueles em estágio de maturação (Figuras 1A, B). A estimulação de cada tipo de célula com tapsigargina para esgotar passivamente os estoques de ER / Ca 2+ revelou maior liberação de Ca 2+ das células de maturação (Figura 1C). A re-adição de Ca 2+ ao meio extracelular para estimular SOCE eliciou SOCE significativamente maior em ameloblastos de maturação (Figura 1D), validando nossos achados anteriores das populações de células mistas (Nurbaeva et al., 2015a).

FIGURA 1. Entrada de Ca 2+ operada em loja em ameloblastos. (UMA) Imagem de Ca 2+ ([Ca 2+]cyt) de ameloblastos secretores e de maturação individuais (verde e azul traçados, respectivamente). Onde indicado, a tapsigargina (TG, 1 & # x03BCM) foi adicionada à solução de banho livre de Ca 2+ para monitorar a liberação de Ca 2+ dos estoques de ER / Ca 2+. Aumentado [Ca 2+]cyt após a nova adição de Ca 2+ extracelular (2 mM Ca 2+) na presença contínua de TG reflete SOCE. (B) Dados agregados para basal [Ca 2+]cyt de ameloblastos secretores e de maturação (antes da adição de tapsigargina). (C) Dados agregados para pico [Ca 2+]cyt alcançado após a exposição inicial à tapsigargina (liberação de ER, por volta de 200 s). (D, E) Pico e declive subsequente de decaimento para [Ca 2+]cyt após a nova adição de 2 mM na presença contínua de tapsigargina. Todos os dados agregados (B & # x2013E) são médias & # x00B1 SEM, com n = 210 células (secretoras) e n = 163 células (maturação). & # x2217 & # x2217 & # x2217 P & # x003C 0,001, Aluno bicaudal não pareado & # x2019s t-teste.

Análise molecular de reguladores SOCE candidatos

Nossa análise anterior de todo o genoma das células do esmalte revelou uma regulação positiva & # x223C200 de Cck durante a maturação (Lacruz et al., 2012). Reconhecimento de que CCK é um agonista importante que pode estimular um aumento na [Ca 2+]cyt em células acinares pancreáticas (Yule et al., 1991 Yule e Williams, 1994) nos levaram a considerar um papel potencial da CCK no manuseio de Ca 2+ nas células do esmalte. Para abordar essa possibilidade, primeiro estendemos nossos dados de microarray anteriores realizando RT-PCR. Encontramos uma regulação positiva significativa de Cck durante a maturação, dando um nível de expressão que era cerca de um terço daquele no cérebro, um tecido enriquecido com CCK (Figura 2A). Para reforçar esses achados de expressão gênica, analisamos ameloblastos em estágio de maturação para Cck expressão por no local hibridização (Figura Suplementar S2). Usando o cérebro como um controle positivo, a CCK foi encontrada para ser expressa por ameloblastos de maturação, mas não pelas células circundantes do EO (Figura Suplementar S2). Essas descobertas nos levaram a considerar se os ameloblastos responderiam à estimulação de CCK por meio de seus GPCRs, CCKR-1 e CCKR-2 (Wank, 1998). RT-PCR mostrou que ambos os tipos de receptores foram expressos em células de esmalte, com CCKR-2 predominando cerca de três vezes sobre CCKR-1. Além disso, ambos CCKR-1 e CCKR-2 foram regulados positivamente durante a maturação (Figura 2B). Também investigamos a expressão de gastrina, um homólogo de CCK que também pode se ligar a CCKRs. No entanto, nenhum transcrito de gastrina foi detectado por RT-PCR em células de esmalte (dados não mostrados).

FIGURA 2. Perfil de transcrição de CCK e GPCRs para CCK, ACh e ATP em células de esmalte. (UMA) Níveis de expressão relativa do Cck gene em células secretoras e de maturação do esmalte versus cérebro, conforme determinado por RT-PCR. Cck O mRNA foi significativamente maior durante a maturação do que no estágio de secreção e atingiu cerca de um terço do nível de expressão no cérebro. (B) Níveis de expressão relativa do CCKR-1 e CCKR-2 genes, mostrando uma predominância de CCKR-2 e uma tendência de regulação positiva durante a maturação. (C) Níveis de expressão relativa de genes do receptor de ATP purinérgico, mostrando a detecção de P2ry1, P2ry2, P2ry4, e P2ry6. Ambos P2ry2 e P2ry6 foram significativamente regulados positivamente durante a maturação. (D) Níveis de expressão relativa de receptores ACh, mostrando detecção de CHRM1, CHRM3, e CHRM5 e com CHRM5 sendo significativamente regulado positivamente durante a maturação. Os dados (média & # x00B1 SEM) foram normalizados usando Actina como um gene de referência em todos os experimentos. & # x2217 & # x2217 P & # x003C 0.01 & # x2217 & # x2217 & # x2217 P & # x003C 0,001, Aluno bicaudal não pareado & # x2019s t-teste. Os valores representam um mínimo de três experimentos independentes, cada um agrupando células de dois ratos por experimento.

Dois outros agonistas fisiológicos bem conhecidos, acetilcolina (ACh) e ATP, também podem estimular um aumento na [Ca 2+]cyt agindo por meio de seus respectivos receptores de superfície celular. Receptores ACh muscarínicos (CHRM) são GPCRs com os subtipos CHRM1, CHRM3 e CHRM5 sendo ligados a IP3 produção e um consequente aumento de [Ca 2+]cyt (Caulfield, 1993, Horn et al., 2000). Usando RT-PCR para CHRM1, CHRM3, e CHRM5, nós achamos isso CHRM3 os níveis de expressão foram os mais elevados, embora nenhuma diferença significativa tenha sido detectada entre os estágios de secreção e maturação (Figura 2C).O ATP é conhecido como uma fonte de energia intracelular que também funciona como um mensageiro extracelular, ligando-se aos receptores purinérgicos da superfície da célula (Burnstock, 1997). Em rato, P2ry1, P2ry2, P2ry4, e P2ry6 são os GPCRs cuja ativação eleva [Ca 2+]cyt (Haanes e Edvinsson, 2014). As células secretoras e de maturação expressaram todos os 4 desses receptores de ATP com uma suprarregulação significativa de P2ry2 e P2ry6 durante a maturação (Figura 2D). Coletivamente, esses resultados sugerem que CCK, ACh e ATP podem contribuir para o manuseio de Ca 2+ nas células do esmalte, possivelmente via regulação de SOCE.

Evidência funcional da regulação SOCE por CCK, ACh e ATP em células de esmalte

Seguindo nossa observação de que os ameloblastos expressam CCK e seus receptores, bem como os receptores para ACh e ATP, perguntamos a seguir se esses agonistas participam da SOCE nas células do esmalte e se o fazem modulando o canal CRAC.

CCK8 compreende os 8 aminoácidos C-terminais de CCK e é uma de suas formas biologicamente mais potentes (Liddle, 1997). O CCK8 existe em formas moleculares sulfatadas e não sulfatadas com o primeiro (CCK8S) sendo freqüentemente usado em estudos de pesquisa (Brennan et al., 2008). Ameloblastos secretores e de estágio de maturação foram carregados com Fura-2 como acima e estimulados com várias concentrações de CCK8S (50 nM, 10 nM ou 10 pM). Na ausência de Ca 2+ extracelular, a estimulação com CCK8S levou a um aumento transitório da [Ca 2+]cyt representando liberação de ER / Ca 2+ (Figuras 3A, B). A reaplicação de Ca 2+ extracelular resultou em uma rápida elevação da [Ca 2+]cyt via ativação do SOCE, que foi significativamente maior na maturação (Figura 3C). Esses efeitos de CCK8S em SOCE eram dependentes da concentração em ambos os estágios de desenvolvimento. Para avaliar melhor se as alterações induzidas por CCK estavam diretamente associadas com SOCE e não com outras vias de cálcio, repetimos esses experimentos usando dois inibidores farmacológicos, Synta-66 e GSK-7975A, para bloquear os canais CRAC (Putney, 2010 Derler et al ., 2013, Gerasimenko et al., 2013). Ambos os inibidores foram encontrados para bloquear os efeitos de CCK8S em [Ca 2+]cyt (Figuras 3D, E). Estes resultados indicam que SOCE mediado por canais CRAC é responsivo a CCK em ameloblastos.

FIGURA 3. A colecistoquinina estimula a SOCE mediada pelo canal CRAC em ameloblastos. (UMA) Traçados celulares individuais representativos para ameloblastos secretores expostos a várias concentrações de CCK8S na ausência e presença de Ca 2+ extracelular, conforme indicado. CCK8S induziu liberação de ER / Ca 2+ e SOCE. (B) Experiência equivalente a A, mas usando ameloblastos de maturação, mostrando respostas mais altas para liberação de ER / Ca 2+ e SOCE. (C) Dados agregados (média & # x00B1 SEM) para valores de pico SOCE, mostrando respostas mais fortes para ameloblastos de maturação em todas as concentrações de CCK8S (50 nM, 10 nM e 10 pM). Os dados foram agregados a partir de vários traços da seguinte forma: ameloblastos de secreção, n = 120, 95 e 73 células para 50 nM, 10 nM e 10 pM de CCK8S, respectivamente ameloblastos de maturação, n = 56, 62 e 64 células para 50 nM, 10 nM e 10 pM de CCK8S, respectivamente. (D) Dados agregados para ameloblastos secretores expostos a bloqueadores de canal CRAC (3 & # x03BCM Synta-66, 10 & # x03BCM GSK-7975A) durante a SOCE induzida por CCK8S como indicado. Ambos os bloqueadores de canal provocaram uma redução substancial nos valores de pico SOCE (pico delta) em CCK8S 50 nM, consistente com SOCE mediado por canal CRAC. Os dados foram agregados da seguinte forma: controles, n = 120, 95 e 73 células Synta-66, n = 92, 64 e 54 células GSK-7975A, n = 37, 45 e 30 células para 50 nM, 10 nM e 10 pM de CCK8S, respectivamente. (E) Experiência equivalente a D mas usando ameloblastos de maturação, mostrando respostas relativamente fortes a ambos os bloqueadores de canal em todas as concentrações de CCK8S. Controles, n = 56, 62 e 64 células Synta-66, n = 56, 51 e 47 células GSK-7975A, n = 38, 33 e 36 para CCK8S 50 nM, 10 nM e 10 pM, respectivamente. & # x2217 & # x2217 P & # x003C 0.01, & # x2217 & # x2217 & # x2217 P & # x003C 0,001. Aluno bicaudal não pareado & # x2019s t-teste.

Em seguida, testamos de forma semelhante se a exposição a níveis fisiológicos de ACh e ATP poderia estimular um aumento na [Ca 2+]cyt. Verificou-se que, na presença de Ca 2+ externo, a aplicação de ATP (100 & # x03BCM) e ACh (10 & # x03BCM) elevou [Ca 2+]cyt com maior aumento na maturação (Figura Complementar S3). Para determinar se essas mudanças refletiram SOCE, ameloblastos foram expostos a ACh e ATP em meio livre de Ca 2+ antes da re-adição de Ca 2+. Tanto a ACh quanto o ATP produziram liberação de ER / Ca 2+ seguida por uma elevação significativa na [Ca 2+]cyt que foi significativamente maior nos ameloblastos de maturação (Figuras 4, 5). A adição de Synta-66 e GSK-7975A resultou em uma redução significativa do influxo de Ca 2+, sugerindo que os efeitos de ACh e ATP sobre [Ca 2+]cyt foram mediados por canais CRAC. Juntamente com aqueles obtidos com CCK, esses resultados fornecem a primeira evidência de um sistema regulador SOCE que é superexpresso em ameloblastos em estágio de maturação.

FIGURA 4. A acetilcolina estimula a SOCE mediada pelo canal CRAC em ameloblastos. (UMA) Traçados celulares individuais representativos para ameloblastos secretores (verde) e de maturação (azul) expostos a 10 & # x03BCM ACh na ausência e presença de Ca 2+ extracelular, conforme indicado. Pode-se observar que a ACh desencadeia respostas relativamente fortes para liberação de ER / Ca 2+ e SOCE em ameloblastos de maturação. (B, C) Dados agregados para liberação de pico de ER / Ca 2+ e valor de SOCE para secreção (n = 89) e ameloblastos de maturação (n = 64) como indicado, confirmando as respostas relativamente fortes durante a maturação. (D, E) Dados agregados para ameloblastos secretores e de maturação expostos aos bloqueadores do canal CRAC durante a SOCE induzida por ACh, conforme indicado. Ambos Synta-66 (3 & # x03BCM) e GSK-7975A (10 & # x03BCM) provocaram uma redução substancial nos valores de pico SOCE em células de maturação, consistente com o SOCE mediado pelo canal CRAC, enquanto as células secretoras não responderam. Os dados foram agregados da seguinte forma: Synta-66, n = 54 e 37 células GSK-7975A, n = 54 e 50 células para secreção e maturação, respectivamente. & # x2217 & # x2217 & # x2217 P & # x003C 0,001, Aluno bicaudal não pareado & # x2019s t-teste.

FIGURA 5. O ATP estimula a SOCE mediada pelo canal CRAC em ameloblastos. (UMA) Traçados celulares individuais representativos para ameloblastos secretores (verde) e de maturação (azul) expostos a 100 & # x03BCM ATP na ausência e presença de Ca 2+ extracelular conforme indicado. O ATP pode desencadear respostas relativamente fortes para liberação de ER / Ca 2+ e SOCE em ameloblastos de maturação. (B, C) Dados agregados para liberação de pico de ER / Ca 2+ e valor de SOCE para secreção (n = 60) e ameloblastos de maturação (n = 82) como indicado, confirmando as respostas relativamente fortes durante a maturação. (D, E) Dados agregados para ameloblastos secretores e de maturação expostos aos bloqueadores do canal CRAC durante a SOCE induzida por ATP, conforme indicado. Ambos Synta-66 (3 & # x03BCM) e GSK-7975A (10 & # x03BCM) provocaram uma redução substancial nos valores de pico SOCE em células de maturação, consistente com o SOCE mediado pelo canal CRAC, enquanto as células secretoras foram muito menos responsivas. Os dados foram agregados da seguinte forma: Synta-66, n = 55 e 40 células GSK-7975A, n = 55 e 40 células, para secreção e maturação, respectivamente. & # x2217 & # x2217 & # x2217 P & # x003C 0,001, Aluno bicaudal não pareado & # x2019s t-teste. & # x2217 P & # x003C 0.05, & # x2217 & # x2217 & # x2217 P & # x003C 0,001, Aluno bicaudal não pareado & # x2019s t-teste.


Discussão

H2O2 foi previamente empregado em vários estudos (Niederau et al., 1991 Krippeit-Drews et al., 2000 Pariente et al., 2001 Rosado et al., 2002) para investigar o efeito do estresse oxidativo na regulação celular. Este estudo empregou microscopia confocal de varredura a laser para monitorar o efeito que ROS apresentam nas alterações evocadas por CCK-8 na atividade mitocondrial em células acinares pancreáticas de camundongo. Para investigar isso, realizamos a monitoração das mudanças na [Ca 2+]c bem como em [Ca 2+]m, ψm e autofluorescência FAD. O manuseio do Ca 2+ pelas mitocôndrias regula a função celular e controla eventos que vão desde a respiração celular e a transdução de sinal até a morte celular.

Nossos resultados indicam claramente que H2O2 (em concentrações de 1 mM e 100 μM) é capaz de mobilizar Ca 2+ em células acinares pancreáticas cujos estoques de Ca 2+ sensíveis ao agonista foram previamente esgotados. Além disso, H2O2 o tratamento bloqueou o sinal típico induzido pelo agonista de mobilização de Ca 2+ CCK-8, bem como a liberação de Ca 2+ do ER por TPS. Isso aponta para o fato de que H2O2, pelo menos nessas concentrações, libera Ca 2+ de um pool de Ca 2+ insensível ao agonista. O efeito estimulador de H2O2 em repouso [Ca 2+]c e seu efeito inibitório na mobilização de Ca 2+ induzida por agonista pode ser devido a um efeito direto no processo de liberação de Ca 2+ e não como conseqüência da ação oposta na via do Ca 2+. Nossos resultados, demonstrando que H2O2 libera Ca 2+ das reservas intracelulares, sugere que a falha de CCK-8 e TPS em induzir a mobilização de Ca 2+ após H2O2 está relacionado ao esgotamento das lojas por este agente.

Semelhante às observações em [Ca 2+]c, H2O2 induz um aumento transitório em [Ca 2+]m, despolariza ψm e aumenta a oxidação do FAD, enquanto bloqueia as mudanças evocadas por CCK-8 nesses sinais.

A captação de Ca 2+ pelas mitocôndrias depende de ψm, que é estabelecido pela cadeia de transporte de elétrons (Duchen e Biscoe, 1992). Um aumento na [Ca 2+]m deve levar a uma despolarização de ψm devido ao ciclo de Ca 2+ através da membrana mitocondrial e / ou devido ao aumento do consumo de ATP pelas ATPases que transportam Ca 2+ para fora do citosol (Hansford, 1985 Duchen e Biscoe, 1992).

Hipoteticamente, pode-se pensar que o tratamento de células com H2O2 poderia afetar o próprio receptor CCK, em vez de agir a jusante como propomos. No entanto, até onde sabemos, não há nenhuma evidência de que o oxidante possa interferir estruturalmente com o receptor CCK. A estrutura típica do receptor CCK consiste em uma estrutura heptaelical com quatro domínios extracelulares e quatro intracelulares (Logsdon, 1994). Não há evidências da existência de grupos -SH onde o oxidante poderia atuar induzindo a oxidação. Além disso, há uma baixa probabilidade de que H2O2 pode atuar como um antagonista do receptor do hormônio, uma vez que estruturalmente as duas moléculas são diferentes. Assim, não é esperado que o receptor CCK-8 possa reconhecer o H2O2 molécula.

Com base nos resultados apresentados aqui, parece possível que os efeitos de H2O2 que foram observados dependem da mobilização de Ca 2+ dos estoques intracelulares. No entanto, a ausência de recuperação de ψm na presença de H2O2 aponta para a ideia de que um mecanismo diferente daquele do hormônio deve estar ocorrendo na presença de H2O2 e pode ser consistente com um dano permanente às mitocôndrias por ROS. A perda completa de ψm na presença de H2O2 pode levar a uma liberação de Ca 2+ acumulado pela organela, apesar do aumento constante de [Ca 2+]c observado.

Mudanças em [Ca 2+]c dentro de uma faixa fisiológica, têm consequências significativas na função celular e devem aparecer mudanças na energética mitocondrial. Uma vez que a atividade da cadeia de transporte de elétrons mitocondrial está associada à oxidação de NADH e FADH2, um aumento na [Ca 2+]ce, portanto, em [Ca 2+]m, deve levar a um aumento da produção de FAD.

O presente estudo mostra que, na presença de H2O2, as respostas à estimulação das células acinares pancreáticas com CCK-8 são completamente inibidas. O provável denominador comum para esta inibição das respostas evocadas por CCK-8 por H2O2 tratamento, e portanto a explicação para os efeitos observados, poderia ser a inibição da mobilização do Ca 2+ em resposta ao hormônio pela ação prévia do H2O2. Isso está de acordo com estudos anteriores que mostram que as ROS mobilizam Ca 2+ dos estoques intracelulares e inibem as respostas evocadas por CCK-8 em células acinares pancreáticas (González et al., 2001 Pariente et al., 2001 Rosado et al., 2002) . Além disso, não se pode excluir um efeito derivado de sua natureza oxidativa e não apenas pelo comprometimento da mobilização de Ca 2+. Chinopoulos et al. (1999) apontaram uma inibição da α-cetoglutarato desidrogenase por H2O2. Isso pode prejudicar a cadeia respiratória devido a uma quantidade reduzida de NADH e FADH2 disponível para os complexos I e II, respectivamente. Este efeito pode, portanto, contribuir para uma redução de ψm e isso pode ter um grande impacto nas mitocôndrias.

A despolarização irreversível de ψm induzido por H2O2 deve ser, além das mudanças no manuseio do Ca 2+ pelas mitocôndrias, uma ação adicional das ROS para modificar as respostas celulares aos agonistas fisiológicos. A despolarização das mitocôndrias causada por radicais livres e liberação local de cálcio foi proposta como a base para a lesão induzida por radicais livres nas células (Leyssens et al., 1995 Kruman e Mattson, 1999 Reynolds, 1999). Uma combinação de ROS e captação de Ca 2+ pela mitocôndria está relacionada à perda do potencial da membrana mitocondrial, abertura do poro de transição da permeabilidade mitocondrial e dano à célula que pode levar à ativação da apoptose e morte celular (Nicotera et al., 1992 Lorenz et al., 1998 Chakraborti et al., 1999 Duchen, 2000 Jacobson e Duchen, 2002 Mukherjee et al., 2002). Nesse sentido, foi demonstrada disfunção na secreção pancreática de amilase (Rosado et al., 2002) e insulina (Sakai et al., 2003) induzida por ROS.

Em conclusão, os resultados demonstram que CCK-8 pode induzir alterações na atividade mitocondrial em células acinares pancreáticas de camundongo que são prejudicadas por ROS. A estimulação das células com esse hormônio poderia ativar os mecanismos mitocondriais que correspondem ao suprimento de energia necessário para o funcionamento da célula durante a secreção. Na presença de H2O2, as mudanças em [Ca 2+]m, ψm e a autofluorescência FAD induzida por CCK-8 são completamente bloqueadas. Este efeito pode representar alguns dos mecanismos de ação das ROS para induzir dano celular levando à disfunção celular e geração de patologias.


RESULTADOS

Caracterização da sinalização de Ca 2+ em qPSC cultivado

PSC sofre mudanças morfológicas e fenotípicas na cultura (Apte et al., 1998). Para estabelecer a sequência temporal dessas alterações, a morfologia do PSC e a expressão dos marcadores de proteína estabelecidos foram monitorados após o isolamento. No dia 2 de cultura, as células exibiram estruturas perinucleares proeminentes, que apareceram em fase brilhante (Figura 1Aa) e coradas com o marcador lipídico AdipoRed (Figura 1Ab). As gotículas de lipídios também podem ser visualizadas após a excitação de MP em 810 nm de fluorescência intrínseca, consistente com a presença de vitamina A nas gotículas conhecidas por fluorescência quando excitadas neste comprimento de onda (Figura 1A, c e d) (Zipfel et al., 2003). Expressão abundante da proteína do filamento intermediário vimentina (Figura 1Ae), juntamente com baixos níveis de desmina e GFAP (dados não publicados) também foram observados em células fixadas com paraformaldeído e processadas para imunocitoquímica. Em contraste, neste ponto de tempo, as células não coraram para α-SMA, o marcador prototípico para aPSC (Figura 1Af). Os sinais intracelulares de Ca 2+ também foram monitorados em qPSC carregado com fura-2 usando imagens digitais no dia 2 na cultura após o isolamento. Um aumento na [Ca 2+]eu foi observada em qPSC em resposta a uma alta concentração do agonista muscarínico carbacol (CCh & gt1 μM), normalmente consistindo em mudanças oscilatórias na [Ca 2+]eu, mesmo em concentrações tão altas quanto 10 μM (Figura 1Ba). qPSC também respondeu à angiotensina II (& gt100 nM Figura 1Bb), bradicinina (& gt100 nM Figura 1Bc) e ATP (& gt1 μM Figura 1C). O pico inicial de Ca 2+ em resposta a esses agonistas foi amplamente independente do Ca 2+ extracelular e, portanto, é provavelmente o resultado do Gαqformação acoplada de InsP3 e liberação de Ca 2+ dos compartimentos intracelulares (Figura 1D). Sem elevação em [Ca 2+]eu foi evocado em qPSC quando exposto a KCl 50 mM, tripsina ou trombina, indicando que é improvável que qPSC expresse canais de Ca 2+ dependentes de voltagem ou a família de receptores ativados por protease (PAR) de Gαqreceptores de superfície celular acoplados (Figura 1E). Além disso, a estimulação de qPSC com PDGF ou colecistocinina (CCK) não resultou em uma elevação de [Ca 2+]eu (dados não publicados).

FIGURA 1: Caracterização de qPSC em cultura. Uma caracterização morfológica é mostrada em (A). (Aa) Imagens típicas de contraste de interferência diferencial (DIC) de qPSC no dia 2 em cultura. (Ab) As mesmas células coradas com o marcador lipídico Adipo Red, indicando grânulos perinucleares proeminentes. (Ad) Fluorescência intrínseca com excitação de MP a 810 nm, consistente com a presença de vitamina A nas gotículas lipídicas. (Ae) Coloração imunohistoquímica com vimentina. (Af) Ausência de coloração com α-SMA. (B – E) Dados de imagem representativos de Ca 2+ de qPSC no dia 2 na cultura. As células respondem a CCh (Ba), angiotensina (Bb) e bradicinina (Bc) e ATP (C). (D) O sinal inicial de Ca 2+ induzido por ATP é amplamente independente do Ca 2+ extracelular. (E) qPSC não respondem à tripsina, trombina ou despolarização da membrana com KCl.

Caracterização de aPSC em cultura

No dia 5 de cultura, as gotículas de lipídio de fase brilhante não eram visíveis e as células haviam adotado uma morfologia do tipo miofibroblastos mais achatada acompanhada pela expressão de α-SMA em uma fração de células (Figura 2Aa). Todas as células expressaram α-SMA no dia 7 (Figura 2Ab) juntamente com o aumento da expressão de vimentina (Figura 2Ac) e desmina (Figura 2Ad). As mudanças na morfologia e no perfil de expressão são típicas da transformação de qPSC para o fenótipo ativado. A sinalização de Ca 2+ também foi estudada após o dia 7 em cultura, quando todas as células expressam α-SMA e são assumidas como representativas de um fenótipo ativado. De maneira semelhante ao qPSC, aPSC exibiu um aumento na [Ca 2+]eu em resposta a angiotensina II (& gt100 nM Figura 2Ba) e bradicinina (& gt100 nM Figura 2Bb), mas não KCl 50 mM (Figura 2Bc) ou CCK até 50 nM (dados não publicados). A exposição de aPSC ao ATP também resultou em um aumento na [Ca 2+]eu (Figura 2C) no entanto, o limiar para eliciar uma resposta foi aproximadamente três vezes menor em aPSC quando comparado com qPSC (Figura 2D).Em contraste com qPSC, aPSC foram refratários à estimulação com CCh em concentrações tão altas quanto 10 μM (Figura 2Ea), mas provocou elevações robustas em Ca 2+ em resposta aos agonistas PAR trombina (Figura 2Eb) e tripsina (Figura 2Ec) e para PDGF (Figura 2Ed). De forma semelhante, as células estreladas humanas exibiram marcadores morfológicos de aPSC quando monitoradas no dia 7 em cultura, incluindo a expressão de α-SMA, GFAP proeminente e coloração de desmina e vimentina (Figura Suplementar 1A). Estas células responderam fortemente aos agonistas PAR-1 e PAR-2 ​​e bradicinina, mas também foram refratários à estimulação com CCK até 50 nM (Figura 1B suplementar). A ausência de sinais de Ca 2+ estimulados por CCK em PSCs de camundongos e humanos não é, no entanto, consistente com dois estudos recentes que indicaram que os receptores CCK-1 e CCK-2 são expressos em humanos (Phillips et al., 2010) e rato PSC (Berna et al., 2010). Deve-se notar que nenhum dos estudos monitorou eventos de sinalização de Ca 2+ estimulados por CCK, portanto, existe a possibilidade formal de que os receptores de CCK em PSC não sinalizam de maneira convencional. O estudo humano sugeriu que a estimulação de CCK resultou na liberação de acetilcolina sem afetar a proliferação de PSC ou o módulo de sinalização de proteína quinase ativada por mitogênio (MAPK). Em contraste, o último estudo demonstrou proliferação robusta em resposta a CCK que foi mediada pelas cascatas de sinalização de MAPK e fosfatidilinositol 3-quinase. Embora as razões para essas discrepâncias não sejam claras, é possível que as diferenças de espécies ou variações no estado fenotípico do PSC examinado possam contribuir para essa falta de acordo.

FIGURA 2: Caracterização de aPSC em cultura. Uma caracterização morfológica é mostrada em (A). (Aa) Imagens DIC típicas de aPSC no dia 7 em cultura. Coloração proeminente com α-SMA (Ab), vimentina (Ac) e desmina (Ad). (B – E) Dados de imagem representativos de Ca 2+ de aPSC no dia 7 em cultura. Aumentos em [Ca 2+]eu foram evocados por angiotensina (Ba) e bradicinina (Bb), mas não KCl (Bc). (C) As células responderam ao ATP. (D) Comparação da concentração vs. relação de resposta para a mudança evocada por ATP na altura do pico em aPSC vs. qPSC. Em contraste com qPSC, aPSC não aumentou Ca 2+ quando desafiado com CCh (Ea), mas trombina (Eb), tripsina (Ec) e PDGF (Ed) provocaram elevações robustas em [Ca 2+]eu.

As células periacinares em lóbulos pancreáticos têm características de qPSC

Para avaliar o fenótipo de PSC in situ em termos de características de sinalização de Ca 2+, lóbulos pancreáticos foram preparados a partir de animais de tipo selvagem (WT) e carregados com Fluo-4 AM e calceína AM. O último corante foi usado para visualizar a estrutura do lóbulo independentemente de [Ca 2+]eu. A Figura 3 mostra uma imagem de projeção máxima de um lóbulo (-120 μm de espessura) gerado usando microscopia MP de fluorescência de calceína nas ampliações indicadas (Figura 3A). Como os lóbulos foram preparados sem digestão enzimática e com intervenção preparativa mínima, o tecido reteve morfologia exócrina óbvia, exemplificada pela localização apical de fase escura dos grânulos de zimogênio nos agrupamentos acinares. Em lóbulos idênticos preparados para imunocitoquímica, as células acinares puderam ser facilmente visualizadas pela expressão de α-amilase enquanto a vimentina foi distribuída em células periacinares / ductais (Figura 3B). α-SMA foi expresso apenas em estruturas ductais, indicando a escassez / ausência de aPSC nesta preparação. As células não acinares também podem ser facilmente visualizadas nos lóbulos vivos, incluindo células com uma distribuição periacinar, que exibiram carregamento preferencial de ambos os corantes fluorescentes (Figura 3A, setas). As células periacinares também exibiram fluorescência intrínseca pontilhada proeminente quando excitadas a 810 nm, novamente consistente com a presença de vitamina A em gotículas de lipídios de qPSC (Figura 3A). A morfologia dessas células também pode ser claramente distinguida dos neurônios visualizados em lóbulos pancreáticos isolados de animais projetados para expressar proteína fluorescente verde especificamente em neurônios. Essas células eram relativamente raras nos campos selecionados e caracterizadas por longas projeções que se estendiam dos corpos celulares (Figura 2 suplementar). Nesta população de células periacinares, robusta [Ca 2+]eu alterações podem ser evocadas por ATP (& gt1 μM) (Figuras 4, A, imagens e B – F, cinética), bem como bradicinina (Figura 4C), angiotensina (Figura 4D) e altas concentrações de CCh (Figura 4E). Um aumento na [Ca 2+]eu nunca foi observada em células periacinares em lóbulos expostos a trombina (Figura 4E), tripsina (Figura 4F), CCK (Figura 4C) ou PDGF (dados não publicados). No entanto, células acinares nos mesmos campos podem ser claramente mostrados para aumentar [Ca 2+]eu em resposta a CCK (Figura 4C, traço vermelho), tripsina (Figura 4F, traço vermelho) e CCh (dados não publicados). Juntos, esses dados demonstram a utilidade de medir os sinais de Ca 2+ in situ em lóbulos pancreáticos e mostram de forma importante que as células localizadas periacinar de animais WT têm características de sinalização de Ca 2+ consistentes com as de qPSC em cultura.

FIGURA 3: Caracterização dos lóbulos pancreáticos. (A, topo) Imagens de luz laser transmitidas de um lóbulo pancreático com ampliação de 25 × (esquerda) e 50 × (meio). O painel esquerdo mostra a fluorescência intrínseca em células periacinares com excitação de MP em 810 nm. (A, inferior) Imagens de excitação MP correspondentes de fluorescência de calceína. As setas indicam células não acinares. (B) Coloração imunocitoquímica de lóbulos pancreáticos fixos. A coloração proeminente de células ductais de α-SMA (Ba), coloração periacinar para vimentina (Bb) e coloração acinar com sobreposição de α-amilase (Bc) de Bb / Bc é mostrada em Bd.

FIGURA 4: Imagens de MP de sinais de Ca 2+ em lóbulos pancreáticos. (A) Um típico experimento de imagem MP é mostrado. (Aa) Imagem MP de um lóbulo carregado com Fluo-4 AM. (A, bec) ΔF / F0 imagens antes e depois da exposição ATP, respectivamente. (B) Representante [Ca 2+]eu traço de uma célula periacinar respondendo à exposição de ATP. (C) Uma célula periacinar responde à bradicinina, mas não CCK (traço preto), enquanto uma célula acinar no mesmo campo responde a CCK (traço vermelho). (D) Resposta típica à angiotensina. (E) Uma célula periacinar responde à CCh, mas não à trombina. (F) Uma célula acinar (traço vermelho), mas não uma célula periacinar, responde à exposição à tripsina.

Caracterização de [Ca 2+] induzido por agonista PAReu sinais em aPSC

Devido ao provável significado fisiopatológico da sinalização ativada por protease no pâncreas (Namkung et al., 2004 Masamune et al., 2005 Laukkarinen et al., 2008), foram realizados experimentos para definir em detalhes as características da [Ca 2+] induzida por PAReu em aPSC. PAR são ativados como proteases atacam um local de clivagem em direção ao N-terminal do receptor, revelando um ligante de peptídeo previamente críptico (Soh et al., 2010). Os peptídeos sintéticos consistindo em seis aminoácidos a montante do local de clivagem podem ativar o receptor independentemente da clivagem da protease. A família PAR é codificada por quatro genes e, embora a seletividade não seja exclusiva, a trombina cliva preferencialmente PAR-1 e -3, enquanto a tripsina demonstrou agir em PAR-2 ​​e -4. PAR ativada pode acoplar a múltiplas subunidades α da proteína G heterotrimérica, incluindo Gα1, Gα12 / 13, e Gαq / 11. Assim, a ativação direta do PLC por Gαq ou Gβγ subunidades estão ligadas a eventos de sinalização de Ca 2+. As proteases podem ativar vários subtipos de PAR e, portanto, os peptídeos sintéticos modelados na sequência do ligante foram usados ​​a seguir para definir os subtipos de PAR expressos em aPSC. Uma elevação acentuada em [Ca 2+]eu foi evocado pelo ligante peptídico do receptor PAR-1 (Figura 5, Aa e B) com uma aparente Kd de ∼300 nM. O aumento do peptídeo PAR-1 resultou em um recrutamento de aPSC responsivo acima de 300 nM de peptídeo & gt 80% das células responderam (Figura 5C) e uma diminuição correspondente na latência entre a exposição ao ligante e a elevação em [Ca 2+]eu foi observada (Figura 5D). O ligante PAR-2 ​​evocou um aumento menor na [Ca 2+]eu e era menos potente (Figura 5Ab). Em contraste, os ligantes direcionados contra PAR-3 e PAR-4 não tiveram efeito (Figura 5, Ac e Ad, respectivamente).

FIGURA 5: Caracterização da sinalização PAR Ca 2+ em aPSC em cultura. (A) As elevações de Ca 2+ podem ser evocadas em aPSC após a exposição ao peptídeo PAR-1 ligante de peptídeo (SFLLRN-NH2) (Aa) e ligante peptídico PAR-2 ​​(SLIGRL-NH2) (Ab) mas não PAR-3 (SFNNGGP-NH2) (Ac) ou ligante PAR-4 (AYPGKF-NH2) (De Anúncios). (B) Relação concentração vs. resposta para o pico de resposta de Ca 2+ evocado pelo ligante PAR-1. (C) O aumento do ligante PAR-1 resulta no recrutamento progressivo de células para aumentar o Ca 2+ (aumento definido como mudança de unidades de razão & gt 0,02 do basal). (D) Dados médios mostrando a mudança na latência e altura do pico do sinal de Ca 2+ iniciado pelo aumento do ligante [PAR-1].

Durante a série anterior de experimentos, observou-se que as elevações de Ca 2+ estimuladas por ligantes PAR, ATP e PDGF não eram espacialmente homogêneas. As características espaciais do sinal de Ca 2+ foram, portanto, a seguir estudadas em aPSC carregado com Fluo-4. Após a exposição ao ligante PAR-1 (Figura 6, A e B), PDGF (Figura 6, C e D) ou ATP (Figura 6, E e F), o sinal de Ca 2+ foi iniciado perto do núcleo e propagado livremente no núcleo e citoplasma circundante. O sinal de fluorescência era invariavelmente maior dentro do núcleo quando comparado com o citoplasma e as margens da célula (Figura 6). Foi relatado que corantes sensíveis ao Ca 2+ se comportam de forma anômala no meio nuclear e frequentemente superestimam a magnitude dos sinais (Bootman et al., 2009). No entanto, esses dados mostram que o Ca 2+ parece ser prontamente liberado ou se difunde dos locais de liberação local para manter uma elevada [Ca 2+] no nucleoplasma de aPSC.

FIGURA 6: Características espaciais das mudanças de Ca 2+. A exposição ao agonista PAR evoca alterações de fluorescência proeminentes e sustentadas no núcleo de aPSC (A, traço preto) vs. uma região citoplasmática de interesse (A, traço vermelho). (B) Imagens correspondentes adquiridas em pontos de tempo correspondentes às setas em (A). (C, imagens D, cinética) A estimulação de PDGF resulta em sinais nucleares proeminentes de Ca 2+ semelhantes. (E, imagens F, cinética) A estimulação de ATP resulta em sinais nucleares de Ca 2+ proeminentes.

A organização espacial dos sinais de Ca 2+ foi ainda investigada usando a produção focal de InsP3 em regiões distintas e espacialmente separadas de aPSC (∼1,5 μm 3 de volume focal) usando fotólise a laser de uma forma permeável à célula de InsP enjaulado3 (ci-InsP3) (Ganhou et al., 2007). Quando a luz do laser foi focada no núcleo, baixos níveis de fotólise resultaram em sinais de fluorescência elevados que estavam em grande parte confinados a este compartimento (Figura 7A, pequena seta). O aumento da energia produziu sinais nucleares maiores que foram mantidos por um período de tempo estendido (& gt20 s). Os sinais também se propagaram para as regiões citoplasmáticas circundantes (Figura 7, A, seta grande B, imagens). O posicionamento do ponto de laser nas margens da célula ∼20 μm distante do núcleo resultou em um aumento inicial no sinal de Ca 2+ no local da fotólise seguido por um sinal robusto e mantido no núcleo (Figura 7, C e D). Juntos, esses dados novamente apoiam a ideia de que em aPSC, os sinais de Ca 2+ são comunicados livremente no compartimento nuclear e são consistentes com o InsP3- liberação induzida de Ca 2+ ocorrendo no núcleo ou em torno dele.

FIGURA 7: Características espaciais dos sinais de Ca 2+ em aPSC após o desencadeamento focal de ci-InsP3. (A e B) Resposta à produção focal de ci-InsP3 em uma região de ∼1,5 μm 3 localizada perto do núcleo. O traço cinético mostrando uma região de interesse localizada ∼20 μm do local de desencadeamento (traço vermelho) ou no núcleo (traço preto). As pontas de seta indicam o tempo / duração do desencadeamento (seta pequena, seta 25 ms maior, exposição de 50 ms à luz laser). As imagens em (B) correspondem aos tempos indicados após o segundo desencadeamento. Mudanças proeminentes e sustentadas na fluorescência são observadas no núcleo. (C e D) ci-InsP3 é produzida a cerca de 20 µm do núcleo (seta pequena, seta grande de 25 ms, seta maior de 50 ms, 75 ms). As imagens cinéticas e correspondentes após o desencadeamento final são mostradas em (C) e (D), respectivamente. Uma mudança robusta na fluorescência é evocada e mantida no núcleo.

Os sinais nucleares de Ca 2+ estimulam a proliferação de aPSC

Para investigar mais profundamente o mecanismo subjacente aos sinais compartimentados de Ca 2+ e para investigar seu papel fisiológico, utilizamos uma série de adenovírus que expressam buffers de Ca 2+ direcionados a compartimentos celulares específicos (Rodrigues et al., 2007). As construções consistem em parvalbumina (PV) ligada à proteína fluorescente vermelha DsRed, e uma sequência de localização nuclear (PV-NLS-DsRed) ou sinal de exclusão nuclear (PV-NES-DsRed). A Figura 8Aa mostra uma célula que expressa um construto PV-DsRed não direcionado após infecção por vírus e demonstra a expressão heterogênea da proteína quimérica em aPSC. Em contraste, PV-NES-DsRed foi expresso no citoplasma e excluído totalmente do núcleo (Figura 8Ab), enquanto PV-NLS-DsRed foi expresso exclusivamente apenas no núcleo de aPSC (Figura 8Ac). Essencialmente, 100% das células foram infectadas com cada adenovírus, conforme evidenciado pela presença de fluorescência vermelha uniforme. O impacto no sinal de Ca 2+ da expressão de PV compartimentada foi avaliado em aPSC carregado com Fluo-4 e estimulado com ligante PAR-1. A expressão de PV não direcionado resultou em um acentuado amortecimento dos sinais de Ca 2+ evocados por agonista em toda a célula, quando comparados com células não expressando construção de PV (Figura 8Ba). Em células que expressam PV-NES-DsRed, o sinal de Ca 2+ na região extranuclear foi amplamente abolido (Figura 8Bb). No entanto, um sinal nuclear robusto de Ca 2+ ainda foi observado. Por outro lado, a expressão de PV-NLS-DsRed resultou em um sinal nuclear de Ca 2+ marcadamente atenuado, embora o sinal citoplasmático tenha sido amplamente preservado (Figura 8Bc), indicando, não inesperadamente, que a liberação de Ca 2+ pode ocorrer a alguma distância do núcleo.

FIGURA 8: Expressão de construções de PV específicas do compartimento. (A) Localização de construções PV-DsRed (Aa), PV-NES-DsRed (Ab) e PV-NLS-DsRed (Ac) após infecção de aPSC com adenovírus correspondente. (B) Mudanças representativas de Ca 2+ em aPSC infectado com a construção indicada. (Ba) PV-DsRed amortece Ca 2+ alterações no núcleo (traço preto) e citoplasma (traço vermelho). (Bai) Localização da construção. (Baii) ΔF / F0 Imagem Fluo-4 antes e (Baiii) após a exposição ao ligante peptídico PAR-1. (Bb) PV-NES-DsRed atenua as mudanças de Ca 2+ no citoplasma (traço vermelho), mas não no núcleo (traço preto). (Bbi) Localização de PV-NES-DsRed. (Bbii) ΔF / F0 Imagem Fluo-4 antes e (Bbiii) após a exposição ao ligante peptídico PAR-1. (Bc) PV-NLS-DsRed amortece Ca 2+ alterações no núcleo (traço preto), mas não no citoplasma (traço vermelho). (Bci) Localização de PV-NLS-DsRed. (Bbii) ΔF / F0 Imagem Fluo-4 antes e (Bbiii) após a exposição ao ligante peptídico PAR-1.

APSC é altamente proliferativa e acredita-se que a expansão do número de células seguida pela secreção de ECM desempenhe um papel importante na progressão da doença na pancreatite crônica. Os experimentos foram subsequentemente realizados usando buffers direcionados para avaliar se os aumentos compartimentados proeminentes em [Ca 2+]eu desempenham qualquer papel na promoção da proliferação celular. aPSC foram privados de soro por 16 h antes da adição de meio repleto de soro fetal bovino a 1% (FBS). A proliferação foi avaliada monitorando a incorporação de 5-bromo-2′-desoxiuridina (BrdU) 24 horas depois. A adição de FBS resultou em um aumento significativo na incorporação de BrdU. A proliferação basal na ausência de FBS não foi afetada, independentemente da expressão e localização de PV direcionado, enquanto a incorporação de BrdU foi significativamente aumentada em células que não expressam construções de PV expostas a FBS (Figura 9). A expressão uniforme global de PV (PV-DsRed) ou o tamponamento de Ca 2+ citoplasmático especificamente com PV-NES-DsRed não alterou a proliferação de aPSC. Em contraste, a expressão de PV-NLS-DsRed e, assim, o tamponamento do Ca 2+ nuclear eliminou completamente a proliferação (Figura 9). Esses dados destacam a importância geral das mudanças nucleares de Ca 2+ para a proliferação e sugerem fortemente que os agentes que aumentam a [Ca 2+] nuclear, incluindo agonistas PAR, PDGF e ATP, provavelmente presentes na glândula ou ao redor da glândula após o insulto e desempenham um papel importante papel na proliferação de aPSC.

FIGURA 9: a proliferação de aPSC é atenuada por PV com alvo nuclear. A proliferação induzida por soro foi atenuada apenas por PV-NLS-DsRed.

PSC em um modelo animal de pancreatite crônica experimental

Os camundongos LSL-K-Ras G12D expressam uma mutação ativadora do oncogene K-Ras conduzida por seu promotor endógeno em células acinares e, portanto, exibem atividade Ras moderadamente elevada em células acinares (Ji et al., 2002 Guerra et al., 2007). Os animais desenvolvem fibrose pancreática extensa apenas após indução de pancreatite experimental com injeções intraperitoneais em série (IP) de ceruleína. Esses ratos, portanto, fornecem um excelente sistema modelo para estudar a sinalização de Ca 2+ em PSC durante o desenvolvimento de fibrose. Os estudos foram realizados em lóbulos preparados a partir de camundongos LSL-K-Ras G12D sob condições de controle e subsequentemente após a injeção de ceruleína conforme detalhado em Materiais e métodos. A morfologia dos lóbulos isolados de camundongos LSL-K-Ras G12D não foi dramaticamente alterada de animais WT sob essas condições de controle (Figura 10A). Estruturas acinares óbvias puderam ser prontamente identificadas, e a distribuição e o número de células periacinares não foram significativamente alterados. No entanto, a morfologia de algumas células não acinares parecia aumentada e mais achatada do que a típica das células WT (ponta de seta na Figura 10A em comparação com a Figura 3). As células periacinares responderam à angiotensina II (Figura 10E), e uma proporção dessas células também aumentou [Ca 2+] quando expostas à trombina (dados agrupados da Figura 10B na Figura 12G) ou tripsina (dados agrupados da Figura 10C na Figura 12H) e baixa concentrações de ATP (dados agrupados da Figura 10D na Figura 12I), sugerindo que algumas células exibem o fenótipo de aPSC. Consistente com essa ideia, em um número limitado de experimentos, as células também responderam ao PDGF. Além disso, quando as células estreladas foram isoladas desses animais, a coloração de α-SMA pode ser observada em 21% das células no dia 2 em cultura (Figura 10F, células 24/114 17 campos preparados a partir de dois camundongos), que foi muito mais cedo do que as células preparado a partir de animais WT (Figura 2), indicando a presença de aPSC no pâncreas de camundongos LSL-K-Ras G12D (Figura 10F).

FIGURA 10: Sinalização de Ca 2+ em lóbulos pancreáticos isolados de camundongos LSL-K-Ras G12D. (A) Morfologia de lóbulos isolados de camundongos LSL-K-Ras G12D.(Aa) Imagem de luz laser transmitida. (Ab) Imagem de fluorescência de lóbulo carregado com calceína AM em 50 × e (Ac) em ampliação de 100 ×. As setas destacam as células não acinares com morfologia achatada. (B – E) Sinais de Ca 2+ monitorados a partir dessas células. (B) Resposta representativa à trombina. (C) Resposta representativa à tripsina. (D) Resposta representativa ao ATP. (E) Resposta representativa à angiotensina II. (F, esquerda) Imagem DIC de células estreladas preparadas a partir de camundongos LSL-K-Ras G12D no dia 2 em cultura. (F, direita) Coloração proeminente de α-SMA em uma proporção dessas células.

Os lóbulos pancreáticos de animais WT e LSL-K-Ras G12D foram isolados 3 dias após a indução da pancreatite experimental, conforme detalhado em Materiais e métodos após a injeção IP do análogo de CCK ceruleína. A estrutura dos lóbulos de animais WT injetados com ceruleína novamente não foi marcadamente diferente dos animais WT não injetados, com localização esparsa de α-SMA confinada a estruturas ductais (Figura Suplementar 3). Estrutura acinar patente e células periacinares ocasionais foram claramente visualizadas por imagens MP de fluorescência de calceína (Figura 11A, topo). Em ∼50% desses lóbulos, as células responderam à trombina (9/20 lóbulos examinados) e tripsina (7/13) (Figura 12, dados agrupados A e B na Figura 12, G e H), indicativo da presença de aPSC após o tratamento. Este número foi semelhante aos lóbulos LSL-K-Ras G12D não injetados. Morfologia semelhante e falta de proliferação de células não acinares também foram observadas em animais nos quais o protocolo de injeção foi repetido e os animais mortos no dia 28 (Figura 11C). Em contraste, o tratamento idêntico de LSL-K-Ras G12D resultou em uma ruptura grave da estrutura pancreática exócrina, um aumento notável na expressão de α-SMA (Figura Suplementar 3) e um aumento acentuado em células não-acinares, presumivelmente PSC (Figura 11, A, parte inferior e C). Especificamente, em vários focos, houve uma perda da estrutura da célula acinar, com as células polarizadas substituídas por células com morfologia cuboidal (Figura 11A, parte inferior). Os focos foram rodeados por numerosas células alongadas que preferencialmente carregadas com calceína AM. Os lóbulos fixados com paraformaldeído destes animais mostraram extensa expressão de α-SMA em anéis de células circundantes de células que expressam amilase (Figura 11B). As células que cercam os remanescentes das células acinares são, portanto, provavelmente aPSC. Consistente com esta hipótese, em ∼95% desses lóbulos, as células estavam presentes que aumentaram [Ca 2+]eu em resposta à tripsina, trombina e baixas concentrações de ATP (Figura 12, dados agrupados D – F na Figura 12, G – I). Esta perda de estrutura acinar e aumento nos números de PSC, conforme monitorado pela fluorescência da calceína nas células ao redor dos focos, foram ainda mais marcadas após 28 d (Figura 11C). No entanto, os lóbulos preparados a partir desses animais carregaram muito mal com Fluo-4, impossibilitando a investigação extensiva de eventos de sinalização de Ca 2+.

FIGURA 11: Morfologia dos lóbulos após injeção de ceruleína. (A, topo) Imagem de luz laser transmitida (esquerda) de um lóbulo isolado de um animal WT injetado com ceruleína, conforme detalhado em Materiais e métodos. Os painéis do meio e da direita mostram imagens de excitação de MP da fluorescência da calceína com ampliação de 50 × e 100 ×, respectivamente, em lóbulos WT. (A, inferior) Imagem de luz laser transmitida (esquerda) de um lóbulo isolado de um animal LSL-K-Ras G12D tratado com ceruleína por 1 semana, conforme detalhado em Materiais e métodos. Os painéis do meio e da direita mostram imagens de excitação de MP de fluorescência de calceína com ampliação de 50 × e 100 ×, respectivamente, em lóbulos LSL-K-Ras G12D. Em contraste com os animais WT, há uma grave perturbação na morfologia das células acinares juntamente com um aumento nas células periacinares. (B) Coloração imunocitoquímica de lóbulos fixos de camundongos LSL-K-Ras G12D com anticorpos contra α-SMA e amilase para marcar células aPSC e acinares, respectivamente. As células que circundam os remanescentes das células acinares são coradas com α-SMA. (C) Análise do número de células periacinares para as condições estabelecidas. Os números representam o número de animais / número de lóbulos com uma ampliação de 50 × para cada condição.

FIGURA 12: Ca 2+ em lóbulos após injeção de ceruleína. (A – C) Sinais representativos de Ca 2+ evocados pelos agonistas indicados em células periacinares de animais WT tratados com ceruleína por 1 semana, conforme detalhado em Materiais e métodos. (D – F) Traços representativos de animais LSL-K-Ras G12D evocados pelos agonistas indicados após o tratamento com ceruleína por 1 semana. (G – I) Dados agrupados que representam a mudança na capacidade de resposta dos lóbulos à trombina, tripsina e ATP após o tratamento com ceruleína. Os números indicam o número de animais: número de lóbulos para os quais as respostas foram observadas / número total de lóbulos fotografados.


Emodin atenua a sobrecarga de cálcio e o estresse do retículo endoplasmático em células acinares pancreáticas de rato AR42J

A pancreatite aguda (PA) é uma doença comum de gravidade considerável. AP envolve uma cascata complicada de eventos iniciados pela lesão das células acinares pancreáticas (1), resultando em inflamação local e sistêmica (2). Embora o mecanismo exato subjacente à lesão das células acinares na AP seja complexo e deva ser definido, tem-se a hipótese de que a sobrecarga de cálcio é o gatilho da lesão das células acinares na AP (3). Estudos anteriores indicaram que o excesso de agentes agressores, incluindo sais biliares (4), metabólitos de etanol e ácidos graxos (5,6), induzem a liberação de cálcio global e marcada do retículo endoplasmático (ER) para o citoplasma, o que induz ainda mais digestivo intracelular prematuro ativação enzimática, vacuolização, bloqueio secretor, desorganização do citoesqueleto e necrose celular. Além disso, foi observado que a depleção de cálcio dos estoques de ER induz a ativação de respostas de estresse de ER, que está associada com lesão acinar e PA (7). Em ratos com AP induzido por arginina (8), sensores de estresse de ER chave específicos, incluindo proteína quinase ativada por RNA-ER quinase (PERK), fator de transcrição de ativação 6 (ATF6) e inositol que requer proteína 1 (IRE1), são altamente ativados e essas moléculas de sinalização levam a respostas complexas, incluindo atenuação de tradução, respostas inflamatórias e imunes e indução de apoptose. Da mesma forma, no modelo de ceruleína de pancreatite aguda, as respostas ao estresse do RE são observadas precocemente, em paralelo com a ativação do tripsinogênio (9,10). Também foi observado que a estimulação de ácinos pancreáticos isolados por secretagogos gera respostas distintas ao estresse de ER e, eventualmente, morte celular (11). Além disso, a redução do estresse no RE pelo ácido tauroursodesoxicólico, uma chaperona química ou pela manipulação genética da proteína chaperona de ligação à imunoglobulina (Bip) da chaperona do RE, induz efeitos protetores contra a pancreatite aguda (12,13). Todas essas observações indicam que o estresse ER é um dos mecanismos subjacentes à lesão das células acinares pancreáticas e pode ser um alvo potencial para prevenir e tratar esta doença.

Emodin (6-metil-1,3,8-tantragalol), o componente eficaz predominante do ruibarbo, tem sido usado clinicamente para tratar AP por vários anos na China (14). Várias investigações in vivo também mostraram que a emodina tem efeitos terapêuticos significativos sobre a PA em ratos, corrigindo distúrbios da flora intestinal, promovendo o peristaltismo intestinal (15) e inibindo a liberação de citocinas inflamatórias e a atividade pancreatina (16). Além disso, estudos demonstraram que a emodina melhora a lesão das células acinares pancreáticas ao suprimir a expressão do receptor toll-like 4, inibindo a atividade da pancreatina, eliminando os radicais livres de oxigênio, aumentando a expressão da occludina e promovendo a apoptose na patogênese da AP. Nossos estudos anteriores mostraram que a emodina melhora acentuadamente a lesão pancreática por meio da atenuação das respostas ao estresse do ER no pâncreas de ratos com AP induzida por taurocolato de sódio (17). No presente estudo, os efeitos da emodina na ativação de proteínas sensoras de estresse ER foram avaliados posteriormente usando um modelo in vitro de AP.

Materiais e métodos

Materiais

Células AR42J acinares pancreáticas de rato (CRL 1492) foram obtidas na American Type Culture Collection (Manassas, VA, EUA). O Emodin foi adquirido dos Institutos Nacionais da China para o Controle de Alimentos e Medicamentos (Pequim, China). O meio F12 de Ham, ceruleína, lipoplysaccharide (LPS) e dexametasona foram adquiridos de Sigma-Aldrich, (St. Louis, MO, EUA). Soro fetal bovino (FBS), glutamina, penicilina / estreptomicina, fluo-3 acetoximetil éster foram obtidos de Invitrogen Life Technologies (Carlsbad, CA, EUA). O kit de ensaio de amilase foi adquirido no Nanjing Jiancheng Bioengineering Institute (Nanjing, China). O conjunto de DNase livre de RNase e o seguro para RNA foram adquiridos na Tiangen Biotech. Co. Ltd. (Pequim, China). Um kit de extração de RNA, Oligo (dT) 15 e dNTP foram obtidos da Servier Pharmaceutical Research & amp Development Co. Ltd. (Pequim, China). A transcriptase reversa M-MLV foi adquirida na Promega Corporation (Madison, WI, EUA). Os primers foram projetados e sintetizados pela Invitrogen Life Technologies.

Cultura de células

AR42J é a única linha celular que exibe inúmeras características das células acinares pancreáticas normais e tem sido usada para estudar a secreção, o crescimento e a proliferação de células pancreáticas exócrinas (18). No presente estudo, esta linhagem celular foi usada como um modelo in vitro para avaliar os efeitos da emodina contra a lesão de células acinares pancreáticas e a ativação de proteínas sensoras de estresse do ER. As células AR42J foram cultivadas em meio F12 de Ham suplementado com 2 mM de glutamina, 20% de FBS e antibióticos (100 U / ml de penicilina e 100 μg / ml de estreptomicina) a 37 ° C em uma atmosfera umidificada de 5% de CO 2 e 95% de ar. Foi observado que o tratamento com dexametasona converte essas células em células exócrinas (19). As células AR42J foram semeadas a uma densidade de 2 × 10 4 células / cm 2 em placas de cultura de 6 poços, incubadas por 48 h com 100 nM de dexametasona e lavadas com solução salina tamponada com fosfato (PBS) antes da incubação em meio fresco.

Protocolo de tratamento com Emodin

Em experimentos preliminares, os efeitos tóxicos da emodina nas células AR42J foram detectados examinando a viabilidade celular e a atividade da amilase em meios de cultura. As células AR42J foram incubadas na ausência de estímulo ou na presença de emodina 5, 10, 20, 40 e 80 μM. Após incubação por 3, 6, 12, 24 e 48 h, a viabilidade celular e a atividade da amilase nos meios de cultura foram avaliadas. Os resultados mostraram que a viabilidade celular e a atividade da amilase nos meios de cultura não variaram na incubação com emodina 5–40 μM por 48 h, no entanto, a viabilidade das células AR42J foi reduzida quando tratadas com emodina a 40 μM por 24 ou 48 h ( P & lt0,01) (dados não mostrados). Portanto, neste estudo, as células foram tratadas com emodina a 10 e 20 μM.

As células AR42J foram divididas em grupos de controle, modelo (tratado com ceruleína mais LPS) e tratamento com emodina (tratado com ceruleína, LPS e emodina a 10 ou 20 μM). Para os grupos de tratamento, as células foram pré-tratadas com emodina em várias concentrações por 10 min antes da adição de ceruleína e LPS. Após 3 h, o meio de cultura e as células foram colhidos para análise posterior.

Medição da atividade da amilase

O meio de cultura foi coletado e as células foram lavadas duas vezes com tampão Krebs-HEPES [NaCl 140 mM, KCl 5,9 mM, MgCl 2 1,2 mM, HEPES 15 mM, glicose 10 mM, CaCl 2 2,5 mM, PMSF 0,1 mM e aprotinina 2,5 mM ( pH 7,4)]. As células foram então lisadas sendo forçadas a passar por uma seringa 26G seguida por uma breve sonicação. A atividade da amilase nos meios de cultura e lisados ​​celulares foi medida usando um kit de ensaio enzimático (Nanjing Jiancheng Bioengineering Institute, Nanjing, China). A liberação de amilase foi determinada como a porcentagem da amilase total secretada no meio de cultura.

Medição de cálcio citosólico

Imagens de fluorescência foram realizadas para avaliar a concentração de cálcio citosólico. As células AR42J foram semeadas a uma densidade de 2 × 10 4 células / cm 2 em placas de fundo de vidro de 35 mm. As células foram carregadas com 5 μM de indicador de cálcio permeável à membrana, Fluo-3AM éster, por 30 min a 37 ° C em tampão de Hank. Após o carregamento com o corante fluo-3, as células foram lavadas com solução de D-Hank que carecia de cálcio e continha 5 mM de EGTA. As medições de fluorescência foram realizadas usando um sistema confocal Olympus Fluoview-500 equipado com uma objetiva de 40 × (Olympus Corporations, Tóquio, Japão). Fluo-3 foi excitado por luz de laser de argônio em comprimento de onda de 488 nm e fluorescência foi observada em comprimento de onda de 515 nm. O processamento e a análise das imagens foram realizados com o software Olympus Fluoview. O cálcio intracelular foi expresso como intensidade média de fluorescência (FI).

Reação em cadeia da polimerase de transcrição reversa (RT-PCR)

A expressão gênica de Bip, PERK, ATF6 e IRE1α em células AR42J foi avaliada usando RT-PCR padronizado por co-amplificação com GAPDH, que serviu como controle interno. Os RNAs totais isolados das células foram transcritos reversamente em cDNAs e usados ​​para PCR com iniciadores específicos de rato para Bip, PERK, ATF6, IRE1α e GAPDH. As sequências dos iniciadores utilizados na PCR foram como se segue: Para a frente: ATTCCTGCGTC GGTGTATT e reverso: TCGGCAGTTTCCTTCATTT para Bip para a frente: TACAGTGGACGGCGATGATGAG e reverso: CTTAGGGTGGTTGGCCTGGTAG para PERK para a frente: TCCCTCCACCTCCATGTCA e reverso: CTTCCAGGCGAAGCGTAAT para ATF6 para a frente: GCTGTGGAGACCCTACGCTAT e reverso: TCGATGTTTGGGAAGATTGTTAG para IRE1α e para a frente, AAGGTCGGTGTGAACGGATTT e reversa, AGATGATGACCCTTTTGGCCC para GAPDH. Os tamanhos previstos dos produtos de PCR foram: Bip, PERK de 358 pb, ATF6 de 270 pb, IRE1α 265 pb, 426 pb e GAPDH, 352 pb. Após a co-amplificação com 32-35 ciclos, os produtos de PCR foram separados em géis de agarose 1,5% e visualizados por transiluminação UV.

Citometria de fluxo

As células AR42J foram coletadas para detectar apoptose e necrose usando a coloração com isotiocianato de fluoresceína V-Anexina (FITC) / iodeto de propídio (PI) de acordo com as instruções do fabricante. Resumidamente, 1 × 10 5 células foram digeridas, lavadas duas vezes com PBS frio e ressuspensas em 500 μl de tampão de ligação 1X. Em seguida, foram adicionados 5 μl de anexina V e 10 μl de PI. As células foram agitadas suavemente em vórtice e incubadas por 15 min a 25 ° C no escuro seguido por análise por citometria de fluxo dentro de 1 h.

Análise estatística

Os dados são apresentados como média ± DP. As comparações entre dois grupos foram realizadas por um teste de análise de variância unilateral. Todas as análises estatísticas foram realizadas no SPSS 15.0 (SPSS, Inc., Chicago, IL, EUA). P & lt 0,05 foi considerado para indicar uma diferença estatisticamente significativa.

Resultados

Efeitos da emodina na expressão e liberação de amilase em células AR42J tratadas com ceruleína e LPS

Os efeitos da emodina na expressão e liberação da amilase são mostrados na Fig. 1. Em comparação com as células de controle, os níveis de amilase nos lisados ​​celulares e nos meios de cultura foram significativamente elevados no grupo modelo (P & lt0,01). O pré-tratamento com emodina diminuiu significativamente a atividade da amilase em lisados ​​de células AR42J e ​​meios de cultura.

Figura 1

Efeitos da emodina na expressão e liberação de amilase em células AR42J tratadas com ceruleína mais LPS. Os dados são de três experiências independentes e expressos como a média ± DP. # P & lt0.01, vs. grupo de controle * P & lt0.05 e ** P & lt0.01, vs. grupo de modelo. LPS, lipoplysaccharide.

Efeitos da emodina na concentração de cálcio citosólico em células AR42J tratadas com ceruleína e LPS

As concentrações de cálcio citosólico de células AR42J são mostradas na Fig. 2. A estimulação de células AR42J com ceruleína mais LPS por 3 h levou à sobrecarga de cálcio no citoplasma (Fig. 2B) e o FI médio foi maior do que o do grupo de controle ( Fig. 2E P & lt0.01). O pré-tratamento com emodina a 10 ou 20 μM aliviou significativamente a sobrecarga de cálcio nas células AR42J (Fig. 2C e D) e também diminuiu o valor médio de FI (Fig. 2F P & lt0,01).

Figura 2

Efeitos da emodina na concentração de cálcio citosólico em células AR42J tratadas com ceruleína. Os dados são de três experiências independentes e expressos como a média ± desvio padrão. # P & lt0.01, vs. grupo de controle * P & lt0.05 e ** P & lt0.01, vs. grupo modelo.

Efeitos da emodina na expressão de mRNA de Bip, PERK, ATF6 e IRE1 em células AR42J tratadas com ceruleína mais LPS

UPR é uma resposta celular associada ao estresse ER. A expressão de mRNA de transdutores UPR, incluindo Bip, PERK, ATF6 e IRE1 em células AR42J é mostrada na Fig. 3. No grupo modelo, vários transdutores UPR foram ativados, como mostrado pela expressão de mRNA significativamente aumentada de Bip, PERK, IRE1 e ATF6 em comparação com as células de controle (P & lt0,01). O pré-tratamento com emodina a 10 μM reduziu significativamente a expressão de mRNA de PERK (P & lt0,05) e IRE1 (P & lt0,01) e no grupo de 20 μM, a emodina atenuou significativamente os níveis de mRNA regulados positivamente de transdutores de estresse ER, Bip (P & lt0,05) , PERK (P & lt0,01), IRE1 (P & lt0,01) e ATF6 (P & lt0,05).

Figura 3

Efeitos da emodina na expressão de mRNA de Bip, PERK, ATF6 e IRE1 em células AR42J tratadas com ceruleína mais LPS. Quantidades iguais de lisados ​​celulares foram submetidos ao ensaio de RT-PCR. GAPDH foi usado como um controle interno. Foram calculadas as alterações nos níveis de mRNA de genes alvo associados ao controle invariante GAPDH. Os dados são de três experiências independentes e expressos como média ± desvio padrão. # P & lt0.01, vs. o grupo de controle * P & lt0.05 e ** P & lt0.01, vs. o grupo modelo. Bip, proteína chaperona de ligação à imunoglobulina PERK, proteína quinase ER semelhante à quinase ATF6, fator de transcrição de ativação 6 IRE1, proteína 1 exigindo inositol.

Efeitos da emodina na apoptose e necrose de células AR42J tratadas com ceruleína mais LPS

A ocorrência de apoptose e necrose de células AR42J é mostrada na Fig. 4. Em comparação com o grupo de controle, ceruleína mais LPS causou um aumento significativo na apoptose e necrose de células AR42J (Fig. 4A e B). Os índices apoptóticos (P & lt0,05) e necróticos (P & lt0,01) estavam marcadamente aumentados (Fig. 4E). Além disso, a razão necrose / apoptose no grupo ceruleína mais LPS foi 5 vezes maior do que no grupo controle (Fig. 4F). No entanto, o pré-tratamento com emodina a 10 ou 20 μM atenuou significativamente os índices necróticos (Fig. 4C – E P & lt0,01) e no grupo de dose de 20 μM, os índices apoptóticos aumentaram (Fig. 4D e E P & lt0,05). Consequentemente, a razão de necrose / apoptose em células AR42J tratadas com emodina foi significativamente menor do que no grupo modelo (Fig. 4F P & lt0,01).

Figura 4

Efeitos da emodina na necrose e apoptose de células AR42J tratadas com ceruleína mais LPS. Análise de citometria de fluxo de células AR42J coradas com Anexina V-FITC e PI. As células apoptóticas são apresentadas no quadrante inferior direito (B4) e superior direito (B2) dos gráficos de células necróticas no quadrante superior direito (B1) células vivas no quadrante inferior esquerdo (B3).Os dados são de 3 experiências independentes e expressos como a média ± desvio padrão. # P & lt0.05 e ## P & lt0.01, vs. o grupo de controle * P & lt0.05 e ** P & lt0.01, vs. o grupo modelo. LPS, lipoplysaccharide FITC, fluoresceína isotiocianato PI, iodeto de propídio.

Discussão

A célula acinar pancreática é a unidade funcional do pâncreas exócrino e sintetiza, armazena e secreta enzimas digestivas. Em condições fisiológicas, as substâncias secretagogas, incluindo a colecistocinina e a acetilcolina, induzem aumentos instantâneos na concentração de cálcio citosólico, que passa pela membrana plasmática e é liberado do RE, nas células acinares. Esses processos são rigidamente controlados de forma espaço-temporal e acoplados à dose fisiológica de expressão do zimogênio (20). No entanto, em condições patológicas, a homeostase do cálcio citosólico é interrompida, à medida que os estoques de cálcio (RE e apicais) se esgotam e o nível de cálcio no citoplasma permanece elevado. Até o momento, a sobrecarga de cálcio citosólico foi hipotetizada como sendo fundamental na indução de lesão das células acinares pancreáticas (21), que demonstrou prejudicar os mecanismos de defesa celular e iniciar a ativação de enzimas digestivas prematuras dentro da célula. Esses processos levaram à morte das células acinares (22,23) com derramamento de enzimas ativadas no espaço intersticial, afetando as células acinares circundantes e iniciando um círculo vicioso que termina em PA e síndrome da resposta inflamatória sistêmica. Assim, a inibição da sobrecarga de cálcio nos estágios iniciais da doença é uma via válida de intervenção terapêutica para lesão de células acinares e pancreatite.

Como um laxante eficaz, antiflogístico e homeostático da medicina tradicional chinesa, o ruibarbo é amplamente utilizado no tratamento de doenças do sistema digestivo, incluindo constipação, diarreia, icterícia, pancreatite e colite (24). Emodin, um ingrediente principal isolado do ruibarbo, mostrou-se promessa terapêutica para a pancreatite in vivo e in vitro, já que suprimiu a inflamação, promoveu a apoptose, inibiu a atividade da pancreatina e eliminou os radicais livres de oxigênio. No entanto, até o momento, poucos estudos determinaram se a emodina afeta a homeostase do cálcio intracelular nas células acinares pancreáticas durante o desenvolvimento da pancreatite, embora estudos específicos tenham demonstrado que as atividades antiinflamatórias e analgésicas da emodina estão associadas à regulação da homeostase do cálcio intracelular.

Kuo et al (25) mostraram que a emodina reduz a resposta inflamatória local ao bloquear a mobilização do cálcio e diminuir a ativação de células T inflamatórias e a produção de citocinas inflamatórias em ratos com artrite. Sui et al (26) relataram que a emodina inibe a hiperalgesia inflamatória ao diminuir significativamente a intensidade da fluorescência do cálcio intracelular nos neurônios do gânglio da raiz dorsal e a expressão do mRNA do TRPV1. No presente estudo, os efeitos da emodina na sobrecarga de cálcio foram avaliados em células AR42J tratadas com ceruleína mais LPS, um modelo in vitro que mimetiza PA grave (27). Os resultados mostraram que os níveis de cálcio no citoplasma permaneceram elevados, acompanhados de acentuada apoptose e necrose. No entanto, o pré-tratamento com emodina foi encontrado para aliviar significativamente a sobrecarga de cálcio nas células AR42J. Além disso, a emodina melhorou significativamente a lesão das células pancreáticas ao induzir a apoptose e diminuir a necrose.

A associação entre sobrecarga de cálcio e disfunção organela está sendo cada vez mais estudada. Como o mais importante reservatório de cálcio, o ER participa da sobrecarga de cálcio durante a lesão celular. Estímulos patológicos, incluindo ésteres etílicos de ácidos graxos, colecistocinina e ceruleína, mostraram induzir a liberação maciça de cálcio via receptores de trifosfato de inositol dos estoques de cálcio do ER, que é sustentado pela entrada de cálcio resultando em despolarização mitocondrial, falha na produção de ATP e necrose celular (28 ) Em contraste, a depleção de cálcio do ER pode induzir a perturbação da homeostase do ER, levando à ativação da UPR que está associada à lesão da célula acinar, bem como à morte. Como parte das respostas ao estresse do ER, a resposta da proteína desdobrada contém pelo menos três componentes de sinalização distintos que são ativados, PERK, ATF6 e IRE1. Esses sensores de estresse e seus parceiros de sinalização a jusante participam da apoptose e da reação inflamatória quando ocorre estresse severo de RE (29). O estresse severo também induz a liberação de cálcio do RE, o que pode estimular a geração mitocondrial de espécies reativas de oxigênio e levar à ativação do fator nuclear-κB, subsequentemente induzindo respostas inflamatórias. Assim, a sobrecarga de cálcio sustentada e as respostas de estresse severo de ER levam a um ciclo vicioso de lesão celular e morte.

No presente estudo, os efeitos da emodina na expressão do mRNA dos principais sensores de estresse foram investigados em células AR42J usando RT-PCR. A lesão de células AR42J induzida por ceruleína mais LPS foi acompanhada por um aumento significativo na expressão de mRNA de Bip, PERK, ATF6 e IRE1. O pré-tratamento com emodina reduziu a expressão de mRNA dessas moléculas, particularmente IRE1, cujo nível de mRNA foi reduzido significativamente pela emodina em 10 e 20 μM em comparação com as células modelo, indicando que a emodina atenua as respostas de estresse ER em células AR42J. A hipótese IRE1 é ser uma proteína do sensor de estresse do ER e é importante para a transdução de sinais de estresse do ER para o citoplasma e o núcleo (30). Foi demonstrado que o IRE1α ativado na membrana ER recruta o fator 2 associado ao receptor do fator de necrose tumoral (TRAF2) e a cinase 1 reguladora do sinal de apoptose (31). Além disso, a ativação do complexo IRE1α / TRAF2 pode resultar na fosforilação de c-Jun N-terminal quinase e proteína quinases ativadas por mitogênio p38 e promover a ativação de citocinas pró-inflamatórias, subsequentemente induzindo respostas inflamatórias, lesão celular e morte (32 , 33).

Em conclusão, os resultados do presente estudo mostraram que a sobrecarga de cálcio e o estresse do RE são eventos moleculares precoces de formas específicas de lesão celular, apoptose e necrose em células AR42J. Emodin pode aliviar a lesão celular e diminuir o número de células apoptóticas e de necrose acompanhadas por aumento da apoptose e diminuição da necrose. É provável que esses efeitos estejam associados à redução da sobrecarga de cálcio e à supressão das respostas ao estresse do RE.

Reconhecimentos

Este trabalho foi apoiado pelo Desenvolvimento do Programa Acadêmico Prioritário de Instituições de Ensino Superior de Jiangsu (ysxk-2010), Programa de Projeto Aberto da Disciplina Chave Nacional de Primeira Classe para Medicina Tradicional Chinesa da Universidade de Medicina Chinesa de Nanjing (2011ZYX4-006), Fundação Nacional de Ciências Naturais da China (81073022), Fundação de Ciência e Tecnologia da Administração de Medicina Tradicional Chinesa de Jiangsu (LZ11190).

Referências

Talukdar R e Swaroop Vege S: tratamento precoce da pancreatite aguda grave. Curr Gastroenterol Rep. 13: 123-130. 2011. Ver artigo: Google Scholar: PubMed / NCBI

Kylänpää ML, Repo H e Puolakkainen PA: Inflamação e imunossupressão na pancreatite aguda grave. World J Gastroenterol. 16: 2867–2872. 2010.

Gorelick FS e Thrower E: As células acinares e as respostas iniciais da pancreatite. Clin Gastroenterol Hepatol. 7 (11 Suplemento): S10 – S14. 2009. Ver Artigo: Google Scholar

Kim JY, Kim KH, Lee JA, Namkung W, Sun AQ, Ananthanarayanan M, Suchy FJ, Shin DM, Muallem S e Lee MG: A absorção de ácido biliar mediada por transportador causa morte celular dependente de Ca 2+ em células acinares pancreáticas de rato. Gastroenterology. 122: 1941–1953. 2002. Ver artigo: Google Scholar

Criddle DN, Raraty MG, Neoptolemos JP, Tepikin AV, Petersen OH e Sutton R: Toxicidade do etanol em células acinares pancreáticas: mediação por metabólitos de ácidos graxos não oxidativos. Proc Natl Acad Sei USA. 101: 10738–10743. 2004. Ver artigo: Google Scholar: PubMed / NCBI

Criddle DN, Murphy J, Fistetto G, Barrow S, Tepikin AV, Neoptolemos JP, Sutton R e Petersen OH: Ésteres etílicos de ácidos graxos causam toxicidade do cálcio pancreático por meio de receptores de trifosfato de inositol e perda da síntese de ATP. Gastroenterology. 130: 781–793. 2006. Ver artigo: Google Scholar: PubMed / NCBI

Kubisch CH e Logsdon CD: Estresse do retículo endoplasmático e a célula acinar pancreática. Expert Rev Gastroenterol Hepatol. 2: 249–260. 2008. Ver Artigo: Google Scholar: PubMed / NCBI

Kubisch CH, Sans MD, Arumugam T, Ernst SA, Williams JA e Logsdon CD: A ativação precoce do estresse do retículo endoplasmático está associada à pancreatite aguda induzida por arginina. Am J Physiol Gastrointest Liver Physiol. 291: G238 – G245. 2006. Ver artigo: Google Scholar: PubMed / NCBI

Kubisch CH e Logsdon CD: Os secretagogos ativam diferencialmente as respostas ao estresse do retículo endoplasmático em células acinares pancreáticas. Am J Physiol Gastrointest Liver Physiol. 292: G1804 – G1812. 2007. Ver artigo: Google Scholar: PubMed / NCBI

Seyhun E, Malo A, Schäfer C, Moskaluk CA, Hoffmann RT, Göke B e Kubisch CH: O ácido tauroursodeoxicólico reduz o estresse do retículo endoplasmático, dano às células acinares e inflamação sistêmica na pancreatite aguda. Am J Physiol Gastrointest Liver Physiol. 301: G773 – G782. 2011. Ver artigo: Google Scholar: PubMed / NCBI

Szmola R e Sahin-Tóth M: O mutante do quimiotripsinogênio C associado à pancreatite (CTRC) provoca estresse no retículo endoplasmático em células acinares pancreáticas. Intestino. 59: 365–372. 2010. Ver artigo: Google Scholar

Malo A, Krüger B, Seyhun E, Schäfer C, Hoffmann RT, Göke B e Kubisch CH: O ácido tauroursodesoxicólico reduz o estresse do retículo endoplasmático, a ativação da tripsina e a apoptose das células acinares enquanto aumenta a secreção em ácinos pancreáticos de ratos. Am J Physiol Gastrointest Liver Physiol. 299: G877 – G886. 2010. Ver artigo: Google Scholar

Ye R, Mareninova OA, Barron E, Wang M, Hinton DR, Pandol SJ e Lee AS: A heterozigosidade Grp78 regula o equilíbrio das chaperonas no pâncreas exócrino com resposta diferencial à pancreatite aguda induzida pela ceruleína. Am J Pathol. 177: 2827–2836. 2010. Ver Artigo: Google Scholar: PubMed / NCBI

Wang G, Sun B, Gao Y, Meng QH e Jiang HC: O efeito da nutrição enteral precoce assistida por emodina na pancreatite aguda grave e lesão hepática secundária. Mediators Inflamm. 2007: 296382007. Ver artigo: Google Scholar: PubMed / NCBI

Li Z, Xia X, Zhang S, Zhang A, Bo W e Zhou R: A regulação positiva do receptor 4 semelhante a Toll foi suprimida pela emodina e baicalina no cenário de pancreatite aguda. Biomed Pharmacother. 63: 120–128. 2009. Ver Artigo: Google Scholar: PubMed / NCBI

Xia XM, Li BK, Xing SM e Ruan HL: Emodin promoveu claudina-5 pancreática e expressão de oclusão em ratos experimentais com pancreatite aguda. World J Gastroenterol. 18: 2132–2139. 2012. Ver artigo: Google Scholar: PubMed / NCBI

Yu JH, Lim JW, Kim KH, Morio T e Kim H: NADPH oxidase e apoptose em células acinares pancreáticas estimuladas por ceruleína AR42J. Free Radic Biol Med. 39: 590–602. 2005. Ver artigo: Google Scholar

Wu L, Cai B, Zheng S, Liu X, Cai H e Li H: Efeito da emodina no estresse do retículo endoplasmático em ratos com pancreatite aguda grave. Inflamação. 36: 1020–1029. 2013. Ver artigo: Google Scholar: PubMed / NCBI

Eum WS, Li MZ, Sin GS, Choi SY, Park JB, Lee JY e Kwon HY: A diferenciação induzida por dexametasona de células AR42J pancreáticas envolve p21 (waf1 / cip1) e via da quinase MAP. Exp Mol Med. 35: 379–384. 2003. Ver artigo: Google Scholar: PubMed / NCBI

Low JT, Shukla A e Thorn P: Célula acinar pancreática: novos insights sobre o controle da secreção. Int J Biochem Cell Biol. 42: 1586–1589. 2010. Ver Artigo: Google Scholar: PubMed / NCBI

Frick TW: O papel do cálcio na pancreatite aguda. Cirurgia. 152 (Suplemento 1): S157 – S163. 2012. Ver artigo: Google Scholar: PubMed / NCBI

Criddle DN, Gerasimenko JV, Baumgartner HK, Jaffar M, Voronina S, Sutton R, Petersen OH e Gerasimenko OV: Sinalização de cálcio e morte celular pancreática: apoptose ou necrose? A morte celular é diferente. 14: 1285–1294. 2007. Ver artigo: Google Scholar: PubMed / NCBI

Criddle DN, Sutton R e Petersen OH: Papel do Ca 2+ na morte celular pancreática induzida por metabólitos do álcool. J Gastroenterol Hepatol. 21 (Suplemento 3): S14 – S17. 2006.

Chen DC e Wang L: Mecanismos dos efeitos terapêuticos do ruibarbo na sepse de origem intestinal. Chin J Traumatol. 12: 365–369. 2009.PubMed / NCBI

Kuo YC, Meng HC e Tsai WJ: Regulação da proliferação celular, produção de citocinas inflamatórias e mobilização de cálcio em linfócitos T humanos primários por emodina de Polygonum hypoleucum Ohwi. Inflamm Res. 50: 73–82. 2001. Ver artigo: Google Scholar: PubMed / NCBI

Sui F, Huo HR, Zhang CB, Yang N, Guo JY, Du XL, Zhao BS, Liu HB, Li LF, Guo SY e Jiang TL: a emodina regula negativamente a expressão do mRNA de TRPV1 e sua função em neurônios DRG in vitro. Am J Chin Med. 38: 789–800. 2010. Ver Artigo: Google Scholar: PubMed / NCBI

Liu Y, Zhou ZG, Chen KL, Zhou B, Yang L, Yan H e Li Y: O chaperone ER GRP78 está associado à gravidade da inflamação pancreática induzida pela ceruleína por meio da regulação da apoptose das células acinares pancreáticas. Hepatogastroenterology. 59: 1670–1676. 2012.PubMed / NCBI

Petersen OH e Sutton R: Sinalização de Ca 2+ e pancreatite: efeitos do álcool, bile e café. Trends Pharmacol Sei. 27: 113-120. 2006.

Kubisch CH e Logsdon CD: Os secretagogos ativam diferencialmente as respostas ao estresse do retículo endoplasmático em células acinares pancreáticas. Am J Physiol Gastrointest Liver Physiol. 292: G1804 – G1812. 2007. Ver Artigo: Google Scholar

Pavitt GD e Ron D: Novos insights sobre a regulação translacional na resposta da proteína desdobrada do retículo endoplasmático. Cold Spring Harb Perspect Biol. 4: a0122782012. Ver artigo: Google Scholar: PubMed / NCBI

Sendler M, Dummer A, Weiss FU, Krüger B, Wartmann T, Scharffetter-Kochanek K, van Rooijen N, Malla SR, Aghdassi A, Halangk W, Lerch MM e Mayerle J: A secreção de fator de necrose tumoral α induz ativação de protease e célula acinar necrose na pancreatite experimental aguda em camundongos. Intestino. 62: 430–439. 2013

Maguire JA, Mulugeta S e Beers MF: O estresse do retículo endoplasmático induzido por surfactante proteína C Brichos mutantes promove a sinalização pró-inflamatória por células epiteliais. Am J Respir Cell Mol Biol. 44: 404–414. 2011. Ver artigo: Google Scholar

Kim SM, Chung MJ, Ha TJ, Choi HN, Jang SJ, Kim SO, Chun MH, Do SI, Choo YK e Park YI: efeitos neuroprotetores de antocianinas de soja negra via inativação de vias ASK1-JNK / p38 e mobilização de siálico celular ácidos. Ciências da Vida. 90: 874–882. 2012. Ver artigo: Google Scholar: PubMed / NCBI


Resultados

Testando protocolos de carregamento diferentes para sondas NO fluorescentes

A fim de otimizar a medição de NO, testamos diferentes protocolos de carregamento de células com corantes sensíveis a NO. Usamos duas sondas fluorescentes sensíveis ao NO, DAF-2 DA e DAF-FM. Os experimentos iniciais foram conduzidos usando o corante permeável à membrana DAF-2 DA, que sofre desesterificação para DAF-2 no interior das células. Os experimentos foram realizados em células isoladas ou pequenos grupos de geralmente 2-3 células (Figura 1). A amplitude das mudanças de fluorescência em resposta a 500 μM de complexo espermina-NO (sp / NO) nesses experimentos foi pequena (traços azuis na Figura 1A e C, n= 13). É importante notar que os fluoróforos sensíveis ao NO existentes reagem com os produtos da oxidação do NO pelo oxigênio molecular ao invés do próprio NO (Kojima et al, 1999 Espey et al, 2001). Essas espécies reativas de nitrogênio (RNS), ao contrário do radical NO, são capazes de reagir com uma série de constituintes celulares, incluindo ascorbato (Espey et al, 2001), grupos sulfidrila de proteínas e glutationa (Espey et al, 2001 Hess et al, 2005). Essas reações são conhecidas por comprometer a sensibilidade de detecção de NO por corantes sensíveis a NO, especialmente se a concentração de corante cair para substancialmente menos de 1 mM (Rodriguez et al, 2005). Portanto, espera-se que a perfusão do citosol, no modo de patch clamp de células inteiras, e a remoção de necrófagos de baixo peso molecular resultem em um aumento na sensibilidade de detecção de NO. Na verdade, a amplitude das alterações de fluorescência foi maior nas células que, após o carregamento DAF-2 DA, foram dialisadas por meio de uma pipeta patch (compare os traços azuis e vermelhos nas Figuras 1A e C) (n= 4). Nessas experiências, uma proporção substancial de DAF-2 foi perdida do citoplasma, mas algum indicador permaneceu, presumivelmente devido à compartimentação ou ligação a constituintes celulares. Para verificar se os tióis reduzidos endógenos são responsáveis ​​pela diminuição observada na eficiência da detecção de NO em células intactas (não corrigidas), esgotamos quimicamente o pool –SH nas células. Isso foi conseguido incubando células com 200 μM N-etilmaleimida por 10 min. As respostas a sp / NO nessas células foram significativamente aumentadas em comparação com as respostas registradas em células intactas (Figura 1C, triângulos verdes, n= 8), mas não foram significativamente diferentes daqueles detectados nas células dialisadas através da pipeta patch. Estes resultados indicam que em células acinares pancreáticas, tióis reduzidos móveis endógenos diminuem a sensibilidade de detecção de NO por indicadores DAF.

Nossas tentativas de usar outra sonda fluorescente NO DAF-FM DA (forma permeável à membrana) para carregar células acinares pancreáticas não tiveram sucesso. Uma proporção substancial de células morreu ou foi danificada. No entanto, descobrimos que o DAF-FM, quando carregado por meio da pipeta patch, é muito sensível a sp / NO (Figura 1A-C, n= 4) e bem tolerado pelas células. Em nossos experimentos posteriores, usamos DAF-2 e DAF-FM, no entanto, DAF-FM foi nossa principal sonda por causa de sua alta sensibilidade (Figura 1) e relatou dependência de pH inferior (Kojima et al, 1999 ).

Produção de NO por estimulação do receptor muscarínico supramáximo

Em seguida, investigamos se a estimulação das células acinares pancreáticas por uma concentração supramáxima do secretagogo liberador de cálcio acetilcolina (ACh) pode desencadear a liberação de NO. Os experimentos iniciais foram conduzidos em células carregadas com DAF-2 DA, e ACh foi encontrado para aumentar a fluorescência celular (Figura 2A e B), mas como com a aplicação de sp / NO (ver traços azuis versus vermelhos na Figura 1), o as alterações da fluorescência foram mais claras nas células submetidas à diálise intracelular por meio de uma pipeta patch (traços azuis versus vermelhos na Figura 2E). ACh a 10 μM produz mudanças significativas (& gt3 sd) de fluorescência em 28% (cinco de 18) das células intactas (dados de uma célula respondente são mostrados na Figura 2A) em comparação com 67% (seis de oito) células corrigidas (exemplo mostrado na Figura 2B).Uma porcentagem ligeiramente maior de respostas à ACh (79% = 30 de 38) foi observada quando as células foram carregadas com DAF-FM por meio da pipeta patch (ver Figura 2C, a resposta média é mostrada como um traço preto na Figura 2E). O modo patch clamp de célula inteira também nos permitiu medir a corrente dependente de cálcio, que pode servir como um indicador de [Ca 2+]c aumento neste tipo de célula (Petersen, 1992). A estimulação de ACh desencadeou uma corrente Cl - dependente de Ca 2+, que se desenvolveu mais rapidamente do que as mudanças na fluorescência DAF-FM (o tempo calculado entre o pico da corrente e o pico da primeira derivada da fluorescência normalizada (dFnorma/ dt) foi de 123 ± 31 s). Em alguns casos, após 5 a 10 minutos de carregamento com DAF-FM, a pipeta do patch foi retirada e a célula foi selada novamente antes da estimulação. Em cinco das 14 células (36%), a ACh produziu respostas resolvíveis (Figura 2D). A proporção reduzida de células respondentes pode ser explicada pelo efeito traumático da retirada da pipeta. É importante ressaltar que nossa capacidade de detectar respostas claras de DAF-FM, pelo menos em algumas dessas células, sugere que as alterações de fluorescência refletem as respostas de NO e não apenas a redistribuição do indicador entre o citosol e a pipeta do patch.

BAPTA inibe respostas induzidas por ACh de DAF-FM

O forte tamponamento da concentração intracelular de Ca 2+ (substituindo 0,2 mM de EGTA por 10 mM de BAPTA mais 2 mM de Ca) eliminou as correntes de Cl - dependentes de Ca 2+ induzidas por ACh em nove entre 12 células, enquanto nas células restantes muito respostas de cálcio menores foram registradas em comparação com as células dialisadas com o tampão Ca 2+ fraco. Tal buffer de Ca 2+ apertado inibiu dramaticamente as mudanças de fluorescência induzidas por ACh (10 μM) (Figura 3A), indicando que o [Ca 2+]c o aumento é essencial para a produção de NO estimulada por ACh.

Glutationa reduzida e necrófagos de NO suprimem a [NO] induzida por ACheu subir

As respostas de DAF-FM à estimulação colinérgica supramáxima foram significativamente inibidas quando 25 mM de glutationa reduzida (GSH) - um tiol citosólico endógeno conhecido por reagir com um elétron oxidado ou produtos reduzidos de NO (nitrosônio e nitroxil) - foi adicionado à pipeta de patch solução (Figura 3A, traço azul, n= 14). Um eliminador de NO exógeno Fe 2+ -DTCS (DTCS, ditiocarboxissarcosina) (10 μM), quando adicionado à pipeta de patch, suprimiu efetivamente os aumentos de NO induzidos por ACh (Figura 3B, traço verde, n= 14). Outros eliminadores de NO estruturalmente não relacionados, hemoglobina (10 mg / ml, n= 6 Figura Suplementar S1A) e C-PTIO (30 μM, n= 4, não mostrado), também inibiu efetivamente as respostas de NO induzidas por ACh, confirmando a especificidade das medições de NO com DAF-FM. Finalmente, uma sonda inativa, DAF-FM T, que foi produzida por saturação anterior de DAF FM com espécies nitrosantes, não respondeu essencialmente quando carregada na célula através da pipeta patch (Figura 3B, traço vermelho, n= 11). É importante notar que em alguns experimentos de controle negativo, a estimulação supramáxima de ACh ainda causou um pequeno aumento na fluorescência (menos de 10% em média em comparação com aproximadamente 40% em células não tratadas). Eletrodifusão de DAF-FM entre a pipeta patch e a célula patcheada ou entre a célula patcheada e as células adjacentes no cluster poderia ser a possível explicação para este pequeno artefato (ver Mathias et al, 1990). Em seguida, verificamos diretamente a contribuição dos efeitos da eletrodifusão na mudança induzida por ACh da fluorescência celular.

Um grupo de células foi estimulado com ACh 10 μM sob condições que minimizam esses dois efeitos de eletrodifusão. As células foram incubadas em 1-octanol em concentrações de 0,5 ou 1 mM, o que bloqueia as junções de lacuna nessas células (Stauffer et al, 1993 Deutsch et al, 1995), e mantido em potencial de retenção de + 5mV em vez de -30 mV em outros grupos (n= 14) para reverter e diminuir a corrente de cloreto (eucl -. As alterações médias de fluorescência induzida por ACh nessas células foram ligeiramente menores do que no grupo de controle (por exemplo, em 10% para os últimos pontos de tempo de gravações), mas a diferença não foi estatisticamente significativa (n= 14, não mostrado). Este resultado sugere que as respostas de fluorescência aos agonistas liberadores de cálcio refletem mudanças genuínas na [NO]eu em vez dos artefatos de eletrodifusão.

Como o ânion superóxido demonstrou produzir um aumento extra na fluorescência dos indicadores DAF na presença de doadores de NO (Jourd'heuil, 2002), verificamos se as respostas à ACh podem ser explicadas pelo superóxido. Nestes experimentos, os sequestrantes de superóxido específicos TEMPOL 1 mM e superóxido dismutase 3700 U / ml foram adicionados na solução de patch de pipeta, enquanto o TEMPOL permeável à membrana também estava presente na solução extracelular. Essas modificações falharam em inibir as mudanças induzidas por ACh na fluorescência (Figura 3B, traço violeta, n= 11), descartando superóxido como a substância subjacente às respostas FAD-FM observadas.

Papel secundário do NOS no componente inicial da liberação de NO induzida por ACh

Para verificar o papel da NOS na liberação de NO induzida por ACh, incubamos as células com os antagonistas NOS constitutivos L -NAME (100 μM) e 100 μM de 7-nitroindasol (7-NI). Os inibidores foram adicionados à solução extracelular pelo menos 30 minutos antes dos experimentos e estavam presentes em soluções extra e intracelulares ao longo dos experimentos. Esta inibição de NOS suprimiu efetivamente o componente tardio (após aproximadamente 600 s compare os traços roxos e pretos na Figura 3C), sugerindo alguma contribuição de NOS atrasada para as respostas de NO induzidas por ACh, mas o componente inicial da resposta (primeiras centenas de segundos) não foi afetado (n= 19). É plausível que o declínio da fluorescência celular, que ocorre na presença de bloqueadores de NOS após 1000 s (Figura 3C, traço roxo), seja devido à difusão da forma ligada a NO do indicador (DAF-FM T) no remendar a pipeta a uma taxa tal que a perda de DAF-FM T exceda sua produção.

Os resultados dos experimentos de fluorescência foram confirmados usando um eletrodo sensível ao NO em uma suspensão de células acinares pancreáticas isoladas (aproximadamente 25 × 10 6 células em um volume total de 5 ml). Em seis de 10 preparações, ACh (10 μM) induziu um aumento na concentração de NO na presença de L -NAME e 7-NI (Figura Suplementar S1B), e essas respostas foram semelhantes às observadas quando L -NAME e 7- NI foram omitidos.

Também tentamos facilitar a atividade do NOS. Nestes experimentos, L -arginina e os cofatores NOS FAD, FMN, BH4 e NADPH foram adicionados à solução de patch pipeta. Nesses experimentos, usamos a configuração de patch clamp perfurado de β-escina (Fan e Palade, 1998), que deve preservar em grande parte a composição proteica das células, ao mesmo tempo que permite o fácil acesso de pequenas moléculas ao citosol. Tais modificações não aumentaram a produção de NO induzida por ACh (n= 12, compare os traços laranja e preto na Figura 3C), mostrando que as condições de diálise de 'célula inteira' não causaram efeitos adversos no NOS. Essas descobertas, em conjunto, implicam pouca importância da NOS no componente rápido inicial da liberação de NO induzida por ACh.

Evidências para o papel dos S-nitrosotióis intracelulares na liberação de NO induzida por ACh

O pool de NO ligado intracelular, que inclui S-nitrosotióis, produtos heme-NO, complexos de dinitrosil ferro e N-nitrosaminas, é uma possível fonte de NO liberado pela estimulação de ACh. Portanto, verificamos se o aumento do intracelular SO conteúdo de -nitrosotiol afetaria as respostas de NO induzidas por ACh. Nesses experimentos, as células foram pré-incubadas por 30 min com o doador de NO sp / NO 100 ou 200 μM (que foi removido logo antes do patch). Tal tratamento aumentou a quantidade de S-nitrosotióis (ver próximo parágrafo) e aumentou substancialmente a magnitude dos sinais de NO induzidos por estimulação ACh supramáxima (n= 23, compare o traço ciano e o traço preto na Figura 3C). Notavelmente, esses experimentos foram conduzidos na presença dos bloqueadores de NOS L -NAME e 7-NI. Este resultado sugere que a amplitude do sinal de NO induzido por ACh se correlaciona com o tamanho do intracelular S- pool de nitrosotiol.

Para investigar se o peso molecular pesado S-nitrosotióis estavam presentes dentro das células dialisadas em uma quantidade suficiente para explicar a liberação de NO induzida por ACh, expusemos as células acinares pancreáticas ao HgCl2 (10 mM) fornecido com ionomicina (10 μM). Hg 2+ é conhecido por catalisar a clivagem da ligação S – NO (Saville, 1958) e tem sido usado para quantificação de S-nitrosotióis. O tratamento deu origem a um forte aumento (mais de cinco vezes) na fluorescência nas células carregadas com DAF-FM (Figura 4A). Em variação com a interação relatada de Hg 2+ com o corante DAF-2 (Rodriguez et al, 2005), HgCl2 não teve efeito na fluorescência de DAF-FM (Figura 4B, linha sólida). No entanto, HgCl2 adicionado à mistura de DAF-FM e S-nitrosotiol glyco-SNAP (II) (que por si só é resistente à decomposição espontânea) produziu um forte aumento de fluorescência (Figura 4B). A quantidade de intracelular S-nitrosotióis sensíveis ao Hg 2+ aumentaram após o pré-tratamento das células com doadores de NO (Figura 4, inserção). A amplitude das respostas de fluorescência DAF-FM típicas à estimulação ACh supramáxima (10 μM) foi inferior a 10% daquela causada por HgCl2 (Figuras 3 e 4A).

Produção de NO causada por [Ca 2+] induzido por agonista ou não-agonistac elevação

Semelhante a 10 μM de ACh, a estimulação supramáxima com colecistocinina (CCK, 10 nM) induziu a [NO]eu aumento revelado pelo DAF-FM carregado através da pipeta patch (Figura 5A, três de quatro células). As concentrações fisiológicas de CCK (5–10 pM) e uma baixa concentração de ACh (50 nM) também foram capazes de evocar a produção mensurável de NO (Figura 5B e C) em quatro de 12 e duas de seis células, respectivamente. Descobrimos que a tapsigargina (Tg), um inibidor da ER Ca-ATPase, causou um [NO] detectáveleu aumento em 11 de 14 células. Esses experimentos mostram que um secretagogo-independente [Ca 2+]c aumento é suficiente para desencadear uma resposta NÃO. É importante notar que um [NÃO]eu o aumento pode ser produzido tanto pela liberação de cálcio induzida por Tg do ER quanto pelo influxo de Ca 2+ através da membrana plasmática (Figura 5D). Assim, os secretagogos liberadores de Ca podem induzir um aumento mensurável no nível de NO, ao atuar em concentrações supramáximas e fisiológicas e a [Ca 2+]c o aumento em si é suficiente para acionar a liberação de NO.

As respostas do NO são independentes da calmodulina, proteína quinase C e metais de transição, mas são inibidas por antagonistas da calpaína

Várias cascatas a jusante do aumento de [Ca 2+] foram verificadas em busca de possíveis mecanismos para a liberação de NO observada. A incubação de células com os antagonistas da calmodulina W-7 (20 μM) e calmidazólio (1 μM) ou com o antagonista da proteína quinase C (PKC) estaurosporina (1 μM) não conseguiu inibir as alterações induzidas por ACh (10 μM) no DAF-FM fluorescência (Figura 6A).

As respostas de NO também foram insensíveis a um quelante de metal pesado permeável à membrana específico TPEN (N,N,N-tetraquis (2-piridilmetil) etilenodiamina 10 μM). Em contraste, o tratamento celular com o inibidor de calpaína PD150606 (100 μM), mas não seu análogo ineficaz PD145305, inibiu substancialmente as respostas de NO (Figura 6B). A mesma inibição também foi observada na presença de substâncias quimicamente não relacionadas aos inibidores da calpaína PD150606 (aplicados como uma mistura) - inibidor da calpaína I (20 μM), loxistatina (30 μM) e inibidor da calpaína III (100 μM).

A adição de μ- ou m-calpaína purificada à fração de alto peso molecular de lisado de células acinares pancreáticas em bruto, que foi pré-incubado com S-nitrosoglutationa (GSNO) ou tetrafluoroborato de nitrosônio, aumentou a taxa de Sdecomposição de nitrosotiol (Figura 6C). Esses dados sugerem que as calpaínas podem estar envolvidas na redistribuição intracelular de NO.

Liberação de NO independente de NOS em outros tipos de células

O carregamento de patch de pipeta com DAF-FM foi aplicado a neurônios de gânglios da raiz dorsal de camundongo (DRG) isolados de forma aguda, células cromafins adrenais bovinas e células da linha endotelial aórtica bovina (BAE-1). Na presença contínua de inibidores de NO nas soluções extracelulares e intracelulares, as células cromafins adrenais, desafiadas com ACh 100 μM, desenvolveram respostas de fluorescência apenas em quatro de 22 experimentos (Figura Suplementar S2A). A estimulação da entrada de Ca 2+ com KCl 50 mM resultou em um aumento da fluorescência celular em uma pequena proporção (três em 12) das células cromafins adrenais (Figura Suplementar S2B), no entanto, a maioria (cinco em sete) dos neurônios DRG respondeu a KCl 50 mM (Figura Suplementar S2C). Em células BAE-l corrigidas pré-tratadas com 7-NI e L -NAME, a estimulação com 100 μM ATP evocou aumento de fluorescência resolvível em três de quatro células (Figura Suplementar S2D). Esses experimentos indicam que a liberação de NO dependente de cálcio a partir de S-nitrosotióis não se restringe às células acinares pancreáticas e pode ser um fenômeno mais geral.


Materiais e métodos

Preparação de células

Células acinares pancreáticas de camundongo isoladas isoladas foram preparadas usando colagenase (Worthington, 200 U / ml, 20 min, 37 ° C) na presença de inibidor de tripsina (Sigma, 3 mg / ml) como descrito anteriormente (Osipchuk et al., 1990 ).

Soluções

A solução extracelular (banho) continha (mM): NaCl 140, KCl 4,7, CaCl2 1,0, MgCl2 1,13, glicose 10 e HEPES – NaOH 10 (pH 7,2). Em alguns experimentos, quando especificamente indicado, CaCl2 não foi incluído (solução livre de Ca 2+). A solução de pipeta continha (mM): KCl 140, MgCl2 1,13, ATP (Na) 2,0 e HEPES – KOH 10 (pH 7,2). O Ca 2+ foi tamponado com 100 μM de EGTA. As células, colocadas em uma lamela de vidro revestida com polilisina (0,2%) fixada a uma câmara de perifusão aberta, foram perifusadas continuamente a partir de um sistema alimentado por gravidade. As mudanças da solução de banho na célula ocorreram após & lt7 s neste sistema. Todos os experimentos foram realizados em temperatura ambiente.

Microscopia confocal de varredura a laser

As células acinares foram carregadas com 200 nM de MitoTracker Green AM por 15 min ou 1 μM de Rodamina 123 (Molecular Probes) por 20 min em temperatura ambiente. Os sinais fluorescentes foram registrados usando um microscópio confocal Noran Odyssey (Noran Instruments, EUA) com um comprimento de onda de excitação de 488 nm e um filtro de barreira de passagem longa de 515 nm.

Gravação de corrente de célula inteira patch-clamp

Gravação de corrente de célula inteira patch-clamp padrão foi usada (Hamill et al., 1981 Osipchuk et al., 1990, Thorn e Petersen, 1992). O registro eletrofisiológico do Cl sensível ao Ca 2+ e das correntes catiônicas não seletivas é uma medida muito sensível de [Ca 2+]eu mudanças (Osipchuk et al., 1990 Thorn et al., 1993, 1996). Registramos as correntes sensíveis ao Ca 2+ quando o potencial de membrana foi fixado em −30 mV. Em nossas condições experimentais, os potenciais de equilíbrio tanto para a corrente catiônica sensível ao Ca 2+ quanto para a corrente do Cl eram próximos a 0.

Medições de Ca 2+ citosólico

Para as medições de Ca 2+ citosólico, a solução de patch pipeta continha 50 μM de ácido livre de Fura 2 (Sigma). EGTA foi excluído desta solução. A concentração de Ca 2+ foi estimada por meio de um sistema de imagem de fluorescência de razão (PTI, Wedel, Alemanha) baseado em um microscópio invertido (Zeiss, Oberkochen, Alemanha) equipado com uma objetiva de imersão em óleo Zeiss Fluar × 40. As configurações do monocromador, a frequência do chopper e a aquisição completa dos dados foram controlados por software para um sistema de microcomputador (PTI). A emissão de fluorescência das células foi registrada com uma câmera ICCD (Hamamatsu Photonics, Japão) usando um filtro de banda larga de 510 nm (Omega Optical, Brattleboro, VT, EUA). As imagens foram racionadas (340: 380) pixel por pixel e a proporção resultante foi proporcional à concentração intracelular de Ca 2+ livre. A fluorescência de Fura 2 foi calibrada usando células carregadas com o corante e expostas a 5 mM de EGTA ou 10 mM de Ca 2+ na presença de 20 μM de ionomicina (Sigma) usando uma constante de dissociação para Ca 2+ -Fura 2 à temperatura ambiente de 150 nM.

Medição de pH intracelular

O pH intracelular foi monitorado pelo uso do corante fluorescente BCECF (Molecular Probes, Inc., Eugene, OR, EUA). As células foram expostas à sonda em sua forma de éster acetoximetílico a uma concentração final de 1 μM por 15 min. A fluorescência celular foi estimulada pelo uso da banda de 488 nm de um laser de íon argônio e da banda de 442 nm de um laser de hélio-cádmio em uma unidade de varredura a laser confocal (MRC-600, Bio-Rad, Hemel Hempstead, Reino Unido). Este dispositivo foi acoplado a um microscópio Nikon Diaphot com lente Nikon × 20. As imagens foram adquiridas a cada 60 s. O pH da célula foi determinado como a razão de fluorescência de ambos os comprimentos de onda de excitação. Para calibração no final de cada experimento, as células foram expostas a 140 mM de KCl e 10 μM de nigericina (Sigma) em soluções tamponadas com HEPES na faixa de pH 6,4-7,8.

Análise estatística

Os valores médios ± SE são apresentados, com n denotando o número de experimentos. Emparelhados t-testes foram aplicados. P & lt0,05 foi considerado significativo.


Assista o vídeo: Pancreatic Acinar Cell Lab (Dezembro 2021).