Em formação

Biossíntese de carotenóides em leveduras


O Budding Yeast Sacchromyces cerevisiae produz uma quantidade significativa de carotenóides? Alguém estimou a proporção do fluxo que vai nas ramificações 1. Síntese de colesterol (via esqualeno) 2. Coenzima Q6 e 3. Dolichols Glicoproteína e outras do ponto de ramificação do difosfato de farnesila.

Aqui está o caminho do kegg

http://www.genome.jp/kegg-bin/show_pathway?map00900 Também tenho o caminho formatado, mas não consegui fazer upload.


A enzima fitoeno sintase é a primeira etapa comprometida na biossíntese de carotenóides. Saccharomyces cerevisiae não tem essa enzima, nem o resto da via relevante. Outras leveduras como Rhodotorula spp e Phaffia rhodozyma pode produzir carotenóides.

No entanto, a biossíntese de carotenóides foi projetada em S. cerevisiae.


Phaffia Rhodozyma

Phaffia rhodozyma é uma levedura fermentativa produtora de carotenóides da Deuteromicotina (Blastomicetos). Sua capacidade de sintetizar carotenóides, a composição de base de seu DNA, certas propriedades metabólicas, como capacidade de usar uréia, estrutura da parede celular e modo de formação de botões, e a natureza dos polissacarídeos que compõem a cápsula indicam uma origem basidiomiceto (Miller et al., 1976). As células vegetativas são elipsoidais e podem ocorrer individualmente, em pares e ocasionalmente em cadeias curtas. O micélio verdadeiro está ausente, mas um pseudomélio rudimentar pode estar presente. Phaffia rhodozyma pode produzir clamidósporos e formar uma película em meio líquido (Miller, 1984). Phaffia rhodozyma foi isolado no início dos anos 1970 por Phaff et al. (1972) dos exsudatos de árvores decíduas em áreas montanhosas do Japão e do Alasca. Originalmente designado Rhodozyma montanae, mais tarde foi renomeado Phaffia rhodozyma, após seu descobridor Herman Jan Pfaff (Miller et al., 1976). O gênero Phaffia tem apenas uma espécie, em que todas as 10 cepas isoladas por Phaff et al. (1972) foram incorporados. As tentativas de acasalar essas cepas na esperança de observar a formação subsequente de micélio dicariótico e teliosporos nunca tiveram sucesso. O tipo de cepa é UCD (FS & ampT) 67–210 (= ATCC 24202 = CBS 5905).

Phaffia rhodozyma difere notavelmente de outras leveduras pigmentadas de duas maneiras: fermenta a glicose e outros açúcares e sintetiza a astaxantina como seu principal carotenóide. Outras leveduras pigmentadas dos gêneros Cryptococcus, Rhodotorula, Rhodosporidium, Sporidiobolus e Sporobolomyces são estritamente aeróbicos e sintetizam β-caroteno, γ-caroteno, toruleno ou torularhodina como seu pigmento principal (Simpson et al., 1971 ).


Resumo

Os opioides são os principais medicamentos usados ​​na medicina ocidental para o controle da dor e cuidados paliativos. A cultura da papoula do ópio continua sendo a única fonte desses medicamentos essenciais, apesar das diversas demandas do mercado e da incerteza na produtividade das safras devido ao clima, às mudanças climáticas e às pragas. Nós projetamos a levedura para produzir os compostos opióides selecionados tebaina e hidrocodona a partir do açúcar. Todo o trabalho foi realizado em um laboratório autorizado e seguro para o trabalho com substâncias controladas. Combinamos a descoberta de enzimas, engenharia de enzimas e otimização de vias e cepas para realizar a biossíntese completa de opiáceos em leveduras. As cepas de biossíntese de opióides resultantes exigiram a expressão das atividades das enzimas 21 (tebaina) e 23 (hidrocodona) de plantas, mamíferos, bactérias e a própria levedura. Esta é uma prova de princípio, e os principais obstáculos permanecem antes que a otimização e o aumento de escala possam ser alcançados. Discussões abertas de opções para controlar essa tecnologia também são necessárias para realizar de forma responsável suprimentos alternativos para esses compostos clinicamente relevantes.

Os opioides são uma classe importante de medicamentos que incluem o analgésico morfina e o antitússico codeína. A Organização Mundial da Saúde (OMS) classifica esses compostos como medicamentos essenciais devido à sua utilidade no tratamento da dor intensa, no controle da dor e em cuidados paliativos (1) No mundo em desenvolvimento, há escassez de analgésicos. A OMS estimou que 5,5 bilhões de pessoas têm "acesso baixo a inexistente ao tratamento para dor moderada ou intensa" (2).

Todos os opiáceos naturais (por exemplo, morfina e codeína) e opioides semissintéticos (por exemplo, oxicodona, hidrocodona e hidromorfona) são atualmente derivados da papoula do ópio (Papaver somniferum) Aproximadamente 100.000 ha de papoula do ópio são cultivados anualmente para produzir palha de papoula contendo mais de 800 toneladas de opiáceos, principalmente morfina e tebaína, para atender à demanda médica e científica lícita (3) A maior parte da morfina derivada da papoula e da tebaina é quimicamente convertida em compostos de alto valor, incluindo codeína, oxicodona e hidrocodona. A produção industrial de papoula é suscetível a fatores ambientais, como pragas, doenças e clima, que podem introduzir instabilidade e variabilidade nesta cadeia de abastecimento geograficamente concentrada, resultando em pressão para diversificar o abastecimento (4) Apesar das diversas demandas de mercado e dos crescentes riscos de abastecimento, a cultura da papoula continua sendo a única fonte de opióides, em parte porque a síntese química dessas moléculas complexas não é comercialmente competitiva. Aproximadamente 30 sínteses químicas de morfina e derivados foram relatadas (5), mas nenhum é viável para produção em grande escala.

Um processo de fabricação de base microbiana para opioides ou precursores de opioides, que fazem parte da classe maior de alcalóides de benzilisoquinolina (BIAs), tem o potencial de enfrentar muitos dos desafios associados à cadeia de suprimentos à base de papoula. Cultivo industrial de microorganismos, como o fermento de padeiro Saccharomyces cerevisiae, ocorre ao longo de dias, enquanto as papoulas são anuais. Além disso, como os micróbios são cultivados em tanques de fermentação fechados, o processo de produção não é suscetível a fatores ambientais externos e pode fornecer maior consistência na composição do produto e perfis de impureza entre os lotes.

Nos últimos anos, os pesquisadores desenvolveram a levedura para produzir uma variedade de produtos naturais à base de plantas (6), mais notavelmente o ácido artemisínico, um precursor do medicamento antimalárico artemisinina (7) A produção semissintética de artemisinina já chegou ao mercado, atendendo a até um terço da necessidade global (8, 9) A produção de ácido artemisínico à base de levedura exigiu a introdução de três a seis genes de plantas heterólogas e numerosas modificações genéticas para aumentar a produtividade (7, 9) Embora os avanços na biologia sintética tenham aumentado a complexidade das vias das plantas que podem ser reconstruídas (6), todos os esforços para projetar levedura para produzir BIAs a jusante de (S) -reticulina, incluindo morfinanos, dependem de um suprimento externo de precursores de BIA (1015). Escherichia coli (16) e, muito recentemente, fermento (17, 18) foram projetados para produzir intermediários BIA iniciais de novo, essas realizações sugerem que a levedura pode ser capaz de sintetizar opióides a partir de fontes simples de carbono e nitrogênio. Nós e outros projetamos a primeira parte da via biossintética, da tirosina para (S) -reticulina (17, 18) Separadamente, projetamos uma segunda parte do caminho, de thebaine para morfina (13) outros, mais tarde, criaram um caminho de (R) -reticulina para codeína (15) No entanto, expressar funcionalmente os mais de 20 genes heterólogos necessários para a biossíntese completa dessas moléculas complexas tem sido um desafio devido às diminuições no título observadas com cada etapa enzimática adicional. Além disso, a enzima chave que epimeriza o (S) -benzilisoquinolina andaime para o (R) -enantiômero, que é o precursor biossintético dos andaimes de promorfina e morfinana, permaneceu desconhecido mesmo após décadas de estudo até recentemente identificado por dois grupos (19, 20) e por nossa equipe, conforme descrito a seguir.

Uma década atrás, quando começamos a trabalhar para realizar a biossíntese total de opioides na levedura, estávamos motivados pelos muitos benefícios previsíveis, mas cientes dos potenciais impactos negativos. Especificamente, estávamos e continuamos preocupados que um suprimento de opioide à base de levedura possa contribuir para o abuso de opioide (21, 22) Portanto, antes de iniciar este projeto, buscamos e recebemos permissão para realizá-lo por meio do registro de pesquisa institucional da Universidade de Stanford na Agência Antidrogas dos EUA (DEA). É necessário obter a permissão (i) triagem de fundo para pesquisadores que lidam com compostos do Cronograma II ou cepas de levedura capazes de fazer tais compostos (ii) protocolos detalhados que limitam os volumes de fermentação e concentrações de compostos e incluindo disposições para cultura e destruição de produto e descarte imediatamente após os experimentos (iii) aumentados contenção física para as cepas e compostos controlados (iv) maior segurança do laboratório e (v) gerenciamento e relatórios explícitos. Juntos, esses requisitos reduzem a chance de que quaisquer compostos ou cepas gerados em nossa pesquisa habilitem diretamente os indivíduos a abusar de opioides.

Primeiro construímos uma cepa de levedura para produzir (S) -reticulina, um intermediário biossintético chave para muitos BIAs a jusante, incluindo os morfinanos. Esta cepa foi construída com um novo projeto genético modular que incorporou modificações projetadas para desviar um maior fluxo de carbono através da tirosina para (S) -reticulina. A via biossintética da reticulina foi dividida em quatro módulos genéticos que contêm as sequências de codificação para 17 enzimas biossintéticas (Fig. 1A, figs. S1 e S2 e tabela S1). Selecionamos regiões cromossômicas das quais não esperávamos nenhum defeito de crescimento e expressão ativa como loci de integração (2325) Um módulo de superprodução de precursor (I) projetado para aumentar o acúmulo de l-tirosina e 4-hidroxifenilacetaldeído (4-HPAA) codificou a superexpressão de três ou quatro proteínas de levedura - mutantes de 3-desoxi-d -arabino2-ácido heptulosônico 7-fosfato (DAHP) sintase e corismato mutase (Aro4p Q166K, Aro7p T226I) que são menos inibidos por l-tirosina e transcetolase (Tkl1p), além disso, fenilpiruvato descarboxilase (Aro10p) foi incluído em uma segunda versão de este módulo (fig. S2). Uma tetrahidrobiopterina (BH4) módulo (II) projetado para sintetizar e reciclar este cofator redox de mamífero que codifica a expressão de quatro proteínas de Rattus norvegicus: sepiapterina redutase (SepR), 6-piruvoil tetrahidrobiopterina sintase (PTPS), quinonoide dihidropteridina redutase (QDHPR) e pterina carbinolamina desidratase (PCD). Um (S) -módulo de norcoclaurina (III) projetado para sintetizar a primeira molécula de estrutura BIA que codifica a expressão de quatro proteínas: um mutante de tirosina hidroxilase (mutações TyrH WR R37E, R38E, W166Y) que é menos inibido por l-tirosina e catecolaminas, de R. norvegicus o BH4 enzima de resgate dihidrofolato redutase (DHFR), também de R. norvegicus DOPA descarboxilase (DoDC) das bactérias Pseudomonas putida e norcoclaurina sintase (NCS) da planta Coptis japonica. Um (S) -módulo reticulina (IV) projetado para sintetizar a molécula de branchpoint chave BIA que codifica a expressão de cinco proteínas vegetais, quatro de P. somniferum—Norcoclaurina 6-O-metiltransferase (6OMT), coclaurina-N-metiltransferase (CNMT), 4′-O-metiltransferase (4′OMT) e citocromo P450 redutase (CPR) - bem como N-metilcoclaurina hidroxilase (NMCH) de Eschscholzia californica. As variantes enzimáticas foram selecionadas com base nas atividades examinadas em leveduras manipuladas (11, 18) e incorporou a adição de várias novas atividades (ou seja, Aro10p, DHFR) para aumentar o fluxo para a biossíntese de reticulina.

(UMA) Esquema biossintético para produção de tebaína e hidrocodona a partir do açúcar. Thebaine é um material de partida para muitos medicamentos opioides por meio de rotas biossintéticas e semissintéticas. Setas em bloco indicam etapas catalisadas por enzima. Setas cinza claro, enzimas de levedura não modificadas, setas cinza escuro, enzimas de levedura modificadas e superexpressas, setas roxas, mamíferos (Rattus norvegicus) enzimas setas laranja, bacterianas (Pseudomonas putida) enzimas setas verdes, planta (Papaver somniferum, P. bracteatum, Coptis japonica, Eschscholzia californica) enzimas. O contorno amarelo destaca o contorno vermelho DRS-DRR destaca o SalSyn projetado. E4P, eritrose 4-fosfato PEP, fosfoenolpiruvato DAHP, 3-desoxi- d -arabinoÁcido -2-heptulosônico 7-fosfato 4-HPP, 4-hidroxifenilpiruvato 4-HPAA, 4-hidroxifenilacetaldeído BH4, 5,6,7,8-tetrahidrobiopterina Tkl1p, transcetolase CPR, citocromo P450 redutase Aro4p Q166K, DAHP sintase Aro1p, pentafuncional Arom enzima Aro2p, corismato sintase bifuncional e redutase de flavina Aro7p T226I, mutase de corismato Tyr1p, pré-fenato desidrogenase Aro8p, aminotransferase I Aro9p aromática, aminotransferase aromática II Aro10p, inibição da fenil tpiruvato descarboxilase R16E-W37, inibição da fenil tpiruvato descarboxilase R16E-W37, inibição de R-W38 e descarboxilase R16-R16E-WDC resistente a fenil-tyruvato-R-36, fenil-Tyruvato descarboxilase. , l -DOPA descarboxilase NCS, (S) -norcoclaurina sintase 6OMT, norcoclaurina 6-O-metiltransferase CNMT, coclaurina N-metiltransferase NMCH, N-metilcoclaurina hidroxilase 4′OMT, 3′-hidroxi-N-metilcoclaurina 4′-O-metiltransferase DRS-DRR, 1,2-desidroreticulina sintase-1,2-desidroreticulina redutase SalSyn, salutaridina sintase SalR, salutaridina redutase SalAT, salutaridinol 7-O-acetiltransferase T6ODM, tebaína 6-O-demetilase morB, morfinona redutase. Veja as figs. S1 e S2 para detalhes do BH4 biossíntese, reciclagem e via de recuperação, conversão de (S) -norcoclaurina para (S) -reticulina e módulos de vias genéticas. (B) Otimização da cepa da plataforma produtora de reticulina por meio da engenharia de vias e cepas. A reticulina no meio de crescimento foi analisada por LC-MS / MS monitoramento de reações múltiplas (MRM) e quantificada com uma curva padrão externa. As barras de erro representam SD de três réplicas biológicas. (C) Análise quiral de reticulina produzida pela cepa plataforma. A reticulina foi isolada do meio de crescimento da cepa CSY1061 e separada em uma coluna quiral. Este cromatograma é um dos dois traços semelhantes de culturas de levedura replicadas e foi suavizado usando uma média móvel de vagão de 7 pontos.

Os módulos BIA foram integrados em uma cepa CEN.PK2 haplóide de tipo selvagem. Testamos a produção de reticulina pelo crescimento de cepas de levedura em meio completo sintético mínimo suplementado com ácido ascórbico sem sulfato de amônio por 72 horas (fig. S3) e analisamos o meio de crescimento para moléculas de BIA por cromatografia líquida acoplada a espectrometria de massa em tandem (LC-MS / MS ) (tabela S2). Uma cepa produtora de reticulina mínima (CSY1057 tabela S3), que incorporou módulos II a IV, produziu reticulina com um título de 12,3 μg / litro (Fig. 1B, fig. S4A e tabela S4). A adição do módulo I à cepa, aumentando o suprimento do precursor de BIA, resultou em um fator de 1,6 melhora no acúmulo de reticulina, com ou sem Aro10p (CSY1059, 20,0 μg / litro CSY1058, 20,7 μg / litro). Observamos o consumo quase completo de l-DOPA (90 μg / litro fig. S4B e tabela S4), acúmulo substancial de dopamina (10 mg / litro fig. S4C) e acúmulo de 3′-hidroxi-N-metilcoclaurina (fig. S4, D e E) por LC-MS / MS para a cepa contendo módulos I a IV (CSY1059). Nossa hipótese é que (i) o aumento da expressão de NCS aumentaria a conversão de dopamina e o metabólito de levedura nativo 4-HPAA em norcoclaurina e produtos a jusante, (ii) o aumento da expressão de TyrH WR iria repor o fornecimento de dopamina e (iii) o aumento da expressão de 4′OMT reduziria o acúmulo de 3′-hidroxi-N-metilcoclaurina e aumentar o fluxo para reticulina. Assim, projetamos um módulo de gargalo (V), que codifica a superexpressão de três proteínas - TyrH WR, 4′OMT e NCS - por incorporação de cópias de genes adicionais. O módulo foi integrado ao CSY1059 e projetado para derrubar o nativo ZWF1 gene (zwf1Δ CSY1061) ou para integrar em um local separado (CSY1060). Uma cepa de plataforma de levedura com a adição de módulo V ao zwf1 locus resultou em um fator adicional de 4 de melhoria no acúmulo de reticulina (82 μg / litro Fig. 1B e tabela S4) e um fator correspondente de 2 diminuição no 3′-hidroxi- acumuladoN-metilcoclaurina em relação a CSY1059 (fig. S4D).

A reticulina produzida pela cepa de plataforma de levedura CSY1061 foi isolada por cromatografia líquida de alta eficiência de fase reversa e analisada por LC-MS quiral. A análise quiral indicou que a maioria da reticulina produzida é o (S) -enantiômero (Fig. 1C), como era esperado devido à estereoespecificidade da condensação catalisada por NCS. A produção principalmente de (S) -enantiômero em nossa cepa de plataforma corrobora observações semelhantes de outras bactérias e leveduras projetadas com as três enzimas metiltransferases, mesmo quando alimentadas com substratos racêmicos (10, 1517) A papoula do ópio tem a capacidade única de converter (S) -reticulina para (R) -reticulina, da qual os alcalóides morfinanos são derivados (26, 27) Embora a alimentação de isótopos extensos e estudos bioquímicos tenham indicado que a atividade da epimerase prossegue via oxidação para um intermediário de base de Schiff e redução estereoespecífica (Fig. 2A), a 1,2-desidroreticulina sintase (DRS) e 1,2-desidroreticulina redutase (DRR) enzima (s) não haviam sido isoladas e sequenciadas quando começamos nosso estudo (2729) Enquanto preparávamos este manuscrito para apresentação, um grupo relatou a descoberta desta enzima em P. somniferum ao caracterizar alelos mutantes de plantas de papoula do ópio quimicamente mutagenizadas (19) Enquanto nosso manuscrito estava sendo revisado, outro grupo relatou o uso de bancos de dados de transcriptomas de plantas para identificar candidatos e, em seguida, clonou o gene de P. somniferum cDNA (20) Nossa abordagem, em vez disso, aproveitou os bancos de dados de transcriptomas de plantas, a síntese de DNA e a engenharia (S) cepas de leveduras produtoras de reticulina, não exigindo, portanto, acesso a material vegetal físico.

(UMA) Esquema biossintético para a reação catalisada por DRS-DRR Me, metil. (B) Identificação de DRS-DRR via análise bioinformática de sequências semelhantes a COR. A consulta bioinformática foi a sequência COR VIGS. As sequências de assuntos eram as P. bracteatum Transcriptoma PhytoMetaSyn P. bracteatum, P. setigerum, P. somniferum, e P. rhoeas transcriptomas do Projeto 1000 Plantas e todas as sequências depositadas no GenBank pertencentes ao Papaveraceae. A barra de escala indica a quantidade de mudança genética nas substituições de aminoácidos por local. Ramificações destacadas em vermelho indicam sequências contendo domínios CYP e semelhantes a COR. A árvore filogenética foi gerada usando a árvore de união de vizinhos de bootstrap ClustalX com 1000 tentativas. (C) Análise quiral de reticulina produzida por cepas de levedura que expressam e não expressam a enzima DRS-DRR. A análise quiral da reticulina acumulada no meio de crescimento da cepa CSY1071 com vetor vazio ou DRS-DRR (pCS3301) foi realizada como descrito na Fig. 1C. Este cromatograma é um dos dois traços semelhantes de culturas de leveduras replicadas e foi suavizado usando uma média móvel de vagão de 7 pontos.

Mais especificamente, observamos que dois estudos independentes de silenciamento de genes de plantas descobriram que o knockdown da codeinona redutase (COR) resulta no acúmulo de reticulina, e em um caso especificamente (S) -acumulação de reticulina (30, 31) Nós hipotetizamos que uma enzima semelhante a COR pode catalisar a redução estereoespecífica e usamos a sequência de silenciamento de gene induzido por vírus publicada (VIGS) como uma consulta BLAST contra Papaver espécies no Projeto 1000 Plantas (32) e PhytoMetaSyn (33, 34) bancos de dados de transcriptoma. A identidade de acerto foi determinada por uma pesquisa BLAST reversa contra sequências depositadas no GenBank. Das 38 sequências semelhantes a COR identificadas que também eram maiores do que 300 nucleotídeos de comprimento, quatro tinham um domínio semelhante ao citocromo P450 oxidase (CYP) 82Y1 e um domínio semelhante a COR em um único quadro de leitura aberto (DRS-DRR Fig. 2B ) Consideramos que esta proteína de fusão natural poderia catalisar a oxidação e a redução necessárias para (S) -reticulina epimerização. Propomos que a oxidação a 1,2-desidroreticulina pode ocorrer por meio de um intermediário de carbinolamina ou enamina, e que 1,2-desidroreticulina é então estereoespecificamente reduzida a (R) -reticulina pelo domínio DRR semelhante a COR (fig. S5).

Para identificar variantes adicionais desta sequência de codificação e determinar o quão difundida é na natureza, usamos a sequência de aminoácidos de P. bracteatum DRS-DRR (Pbr.89405) para pesquisar ambas as bases de dados por nucleotídeos BLAST traduzidos (tBLASTn). Uma pesquisa de todas as sequências no banco de dados PhytoMetaSyn (67 espécies de plantas) e no banco de dados de transcriptoma do Projeto 1000 Plantas (1328 conjuntos derivados de algumas centenas de espécies de plantas) identificou um total de cinco sequências aparentes de comprimento total e 10 sequências únicas parciais que abrigavam ambos os domínios (fig. S6), que se originou de P. somniferum (Papoula do ópio), P. setigerum (papoula de Tróia), P. bracteatum (Papoula iraniana), ou Chelidonium majus (maior celidônia). A partir desta pesquisa secundária (fig. S6), identificamos um P. somniferum Sequência DRS-DRR de interesse, Pso.2062398, que era uma sequência de comprimento total que tinha consenso com várias ocorrências de transcriptoma individuais.

Para determinar se a enzima DRS-DRR identificada possui atividade de epimerase, caracterizamos a enzima DRS-DRR no contexto de uma cepa de levedura projetada para produzir (S) -reticulina de alimentação rac-norlaudanosolina (CSY1071 fig. S1C) (11) Em experimentos preliminares, selecionamos as três variantes de P. bracteatum que se agruparam na pesquisa inicial - Pbr.89405, Pbr.12180 e Pbr.4328 - na cepa CSY1071 com plasmídeos de baixa cópia que abrigam cassetes de expressão para DRS-DRR otimizado por códon de levedura e otimizado por códon de levedura P. somniferum salutaridina sintase (yPsSalSyn). A otimização de códons de todos os genes sintéticos foi realizada pela Life Technologies (35) Quando alimentado com norlaudanosolina 1 mM, apenas a cepa que codifica a variante DRS-DRR Pbr.89405 produziu salutaridina substancial. Nós cultivamos a cepa CSY1071 contendo o plasmídeo de baixa cópia que abriga este DRS-DRR (Pbr.89405, pCS3301) com 1 mM rac-norlaudanosolina por 72 horas e reticulina isolada do meio de crescimento para análise de LC-MS quiral. Em cepas que expressam o DRS-DRR, mais da metade da reticulina produzida foi o (R) -enantiômero, enquanto exclusivamente (S) -reticulina foi detectada em cepas sem o gene DRS-DRR (Fig. 2C).

Em seguida, examinamos a atividade das variantes da enzima DRS-DRR no contexto das etapas de conversão a jusante para tebaína, o primeiro alcalóide morfinano na biossíntese de opiáceos. Em experimentos preliminares, variantes da salutaridina redutase (SalR) otimizadas por códons de levedura de P. bracteatum e P. somniferum e mutantes dirigidos ao local que foram relatados para reduzir a inibição do substrato e aumentar a taxa máxima de reação Vmax (36, 37) foram examinados quanto à sua capacidade de catalisar a conversão de salutaridina em tebaína com variantes de salutaridinol acetiltransferase (SalAT) otimizadas por códons de levedura de P. somniferum, P. bracteatum, e P. orientale. o P. bracteatum SalR (PbSalR) e P. somniferum As enzimas SalAT (PsSalAT) exibiram as maiores atividades em leveduras (fig. S7, A e B). Um cromossomo artificial de levedura (YAC, pCS3308) que codifica cassetes de expressão para yPsSalSyn, PbSalR e PsSalAT foi montado na cepa CSY1071 e as variantes DRS-DRR foram expressas a partir de plasmídeos de baixa cópia (pCS3300-3305). As cepas resultantes foram testadas alimentando 1 mM rac-norlaudanosolina por 72 horas, e o meio de crescimento foi analisado quanto à produção de tebaína. P. bracteatum e P. somniferum As enzimas DRS-DRR (Pbr.89405, Pso.2062398) resultaram na produção de tebaína semelhante (fig. S7C), e a P. bracteatum DRS-DRR (PbDRS-DRR) foi usado em experimentos subsequentes. Cassetes de expressão para os quatro genes foram montados em um YAC (pCS3309) na cepa CSY1071, e a cepa resultante foi testada quanto à produção de tebaína a partir da alimentação rac-norlaudanosoline. Esta cepa produziu tebaína a uma concentração de 17 μg / litro quando cultivada com 1 mM rac-norlaudanosolina por 96 horas (Fig. 3C e tabela S5). No entanto, o acúmulo substancial da reticulina intermediária (

(UMA) Esquema da estratégia de engenharia quimérica SalSyn para tratar de processamento e glicosilação incorretos do SalSyn de tipo selvagem em levedura. Os diamantes laranja representam glicosilação. (B) Comparação de salutaridina produzida a partir de variantes de SalSyn, mutantes de glicosilação dirigida ao local e fusões projetadas em levedura. As cepas de levedura que expressam a variante SalSyn indicada foram alimentadas com 10 μM (R) -reticulina, e o meio de crescimento foi analisado por LC-MS / MS MRM. As áreas dos picos foram normalizadas para SalSyn de tipo selvagem (preto). (C) Comparação da tebaína produzida a partir de variantes SalSyn em levedura. As cepas de levedura foram alimentadas com 1 mM rac-norlaudanosolina e tebaína no meio de crescimento foi quantificada por LC-MS / MS MRM com uma curva padrão externa. Barras delineadas em preto denotam o tipo selvagem e a variante de melhor engenharia. As barras de erro são SD de pelo menos três réplicas biológicas.

Porque DRS-DRR é bastante eficiente na conversão de (S)- para (R) -reticulina (Fig. 2C), o acúmulo de reticulina indicou que a conversão de (R) -reticulina em salutaridina, catalisada por SalSyn, garantiu maior otimização. A análise de Western blot indicou que a proteína SalSyn expressa por levedura estava presente como três formas que poderiam ser distinguidas pelo peso molecular aparente, enquanto SalSyn expressa transitoriamente em Nicotiana benthamiana (tabaco) estava presente principalmente no mais baixo destes três pesos moleculares aparentes (fig. S8A). A mutagênese dirigida ao local de três locais potenciais de glicosilação ligada a N [Asn-X-Thr / Ser (N-X-T / S)] indicou que as três bandas surgiram da glicosilação da proteína em dois locais, Asn 105 e Asn 331. A glicosilação ligada a N em levedura é indicativa de classificação incorreta do terminal N do polipeptídeo SalSyn nascente para o lúmen do retículo endoplasmático (ER), onde é N-glicosilado em vez de ancorar o terminal N na membrana ER externa e manter o domínio catalítico no citosol, como é típico de CYPs microssomais (Fig. 3A e fig. S8B) (38, 39) Nossa hipótese é que esse processamento incorreto reduziu a atividade SalSyn na levedura. No entanto, a modificação do padrão de glicosilação de SalSyn pela mutação dos locais de glicosilação reduziu a conversão de (R) -reticulina para salutaridina em relação à enzima otimizada por códons de levedura de tipo selvagem (Fig. 3B).

Realizamos engenharia de proteínas para corrigir a classificação N-terminal do polipeptídeo SalSyn nascente, prevenir a glicosilação ligada a N e melhorar a atividade da enzima na levedura. A cheilantifolina sintase (CFS) é um citocromo P450 de planta que é 61 a 68% idêntico ao SalSyn, exibe alta atividade quando expresso em levedura (14), e não é glicosilado em levedura, apesar de ter um local N-X-T / S idêntico à sequência SalSyn (fig. S8C). Projetamos sequências de codificação otimizadas por códons de levedura para proteínas quiméricas com uma ou mais hélices α N-terminais de CFS substituindo aquelas de variantes SalSyn de P. somniferum e P. bracteatum, com pontos de junção para as fusões selecionadas com base em alinhamentos de aminoácidos e / ou motivos de estrutura secundária de proteína. A análise de Western blot das proteínas quiméricas indicou que várias das enzimas SalSyn projetadas estavam presentes como uma única banda na levedura, semelhante ao padrão de expressão observado para a enzima parental expressa em planta (fig. S8D). Os dados indicaram que o processamento incorreto da proteína nascente na levedura que resultou na glicosilação ligada a N foi reparado pelas fusões projetadas. Como estratégia alternativa, a sequência de codificação para o domínio SalSyn CYP foi clonada no lugar do domínio CYP no citosólico Bacillus megaterium P450 monooxigenase CYP102A1 (BM3), resultando em uma proteína quimérica com CYP fundido e domínios da redutase do citocromo P450. As proteínas SalSyn quiméricas foram expressas a partir de um plasmídeo de baixa cópia em CSY1071 e testadas quanto à produção de salutaridina da alimentação (R) -reticulina. Várias das variantes SalSyn projetadas exibiram atividade melhorada em relação às enzimas de tipo selvagem e com códon otimizado, com as enzimas projetadas P. bracteatum variante yEcCFS 1-83 -yPbSalSyn 92-504 exibindo maior conversão de (R) -reticulina para salutaridina por um fator de

6 (Fig. 3B) e maior conversão de rac-norlaudanosolina para tebaína por um fator de & gt3 (55 μg / litro Fig. 3C e tabela S5) em relação ao PsSalSyn de tipo selvagem.

Para criar uma cepa de levedura que produza thebaine a partir de fontes simples de carbono e nitrogênio, projetamos um módulo thebaine (VI) que codifica a expressão das melhores variantes enzimáticas identificadas em nosso trabalho - PbDRS-DRR, yEcCFS 1-83 -yPbSalSyn 92-504 , PbSalR e PsSalAT - para converter (S) -reticulina para o alcalóide morfinano tebaína. A tebaína é extraída da papoula do ópio para uso na semissíntese de vários opioides. Este módulo foi adicionado à cepa de plataforma produtora de reticulina (CSY1060) como uma integração cromossômica (CSY1064). As cepas resultantes foram cultivadas em meio mínimo por 120 horas e o meio de crescimento testado para tebaína (Fig. 4, A e B). Essas cepas - contendo 24 cassetes de expressão heteróloga, 21 novas atividades enzimáticas, superexpressão de duas enzimas nativas e inativação de uma enzima nativa - produziram tebaína em concentrações de 6,4 ± 0,3 μg / litro (tabela S6). Nós estendemos ainda mais a via biossintética reconstruída para um medicamento opioide downstream, hidrocodona (Fig. 1A), que é um componente principal do segundo medicamento de prescrição mais dispensado nos Estados Unidos (40) Um módulo de hidrocodona (VII), que codifica a expressão da tebaína 6-O-demetilase (T6ODM) de P. somniferum e morfina redutase (morB) de P. putida M10 (13), foi introduzido como um YAC (pCS2765) na cepa produtora de tebaine CSY1064. A cepa resultante foi cultivada em meio mínimo com 2-oxoglutarato 50 mM para suportar a atividade de T6ODM por 120 horas e o meio de crescimento testado para compostos opióides (Fig. 4, C e D, e tabela S6). A levedura modificada foi capaz de produzir baixos níveis de hidrocodona,

0,3 μg / litro. Assim, demonstramos a viabilidade de estender a via para compostos de interesse por meio de uma rota biossintética que não está presente na papoula nativa do ópio sem ter que incorporar a síntese química a jusante.

(UMA) Cromatogramas de tebaína detectados em meio CSY1064 e em um padrão de tebaína (7,8 μg / litro, 25 nM). (B) Espectros de oito transições MRM da tebaína produzida por levedura projetada e o padrão tebaína. (C) Cromatogramas de hidrocodona detectados em meio CSY1064 + pCS2765 e em um padrão de hidrocodona (0,3 μg / litro, 1 nM). (D) Espectros de quatro transições MRM de hidrocodona produzida por levedura projetada e o padrão de hidrocodona. O meio de crescimento foi analisado para opióides por LC-MS / MS MRM. Os traços são representativos de quatro réplicas biológicas.

Este trabalho representa a biossíntese completa de opiáceos em um hospedeiro heterólogo a partir do metabolismo central. Através de nossa abordagem sintética, validamos a capacidade das variantes DRS-DDR de diferentes plantas para catalisar o (S)- para (R) -epimerização da reticulina no contexto da via biossintética de opiáceos heterólogos. A engenharia de levedura capaz de converter metabólitos centrais no complexo arcabouço de morfinano pentacíclico exigiu engenharia enzimática para corrigir o processamento e aumentar a atividade da via principal do citocromo P450 levando ao arcabouço de promorfinano (SalSyn), bem como a otimização da via e da cepa, incluindo a expressão de 21 enzimas heterólogas de plantas, mamíferos, bactérias e leveduras, superexpressão de duas enzimas de levedura nativas e deleção de um gene de levedura nativo. O relatório atual representa uma prova de princípio para a geração de andaimes de morfinana de novo em leveduras e abre a possibilidade de derivatizar essas e outras moléculas por novas rotas biossintéticas ou semissintéticas para melhorar suas propriedades terapêuticas.

5 g / litro seriam necessários para que a produção de opioides à base de levedura fosse uma alternativa viável à cultura da papoula para a produção comercial. Como isso representa um aumento de rendimento de mais de cinco ordens de magnitude, as cepas relatadas aqui não seriam adequadas para aumento comercial. Esforços de engenharia futuros podem tirar vantagem do papel da via como um reservatório de elétrons para a produção fermentativa para direcionar maior fluxo de elétrons e carbono para os opiáceos, em vez de etanol ou outros produtos de fermentação. Em produtividades comerciais,

5 ml de levedura cultivada ao longo de vários dias forneceria uma dose de analgésico, que atualmente é proveniente de 0,2 m 2 de campos de papoula ao longo de um ano, a obtenção de opiáceos de açúcar e levedura em vez de papoula poderia diminuir a área total da terra necessário para a produção por um fator de & gt500.

Há alguma preocupação de que a biossíntese de opioides na levedura possa em breve levar a opiáceos "caseiros" (41) Os níveis de produção alcançados aqui em condições de fermentação controlada não permitem a fermentação caseira dessas drogas e também não são economicamente competitivos com a cultura da papoula para o abastecimento de mercados lícitos ou ilícitos. Especificamente, nos títulos relatados aqui (& lt1 μg / litro), uma única dose de hidrocodona, como usada no Vicodin (5 mg), exigiria milhares de litros de caldo de fermentação, o que nenhum cervejeiro doméstico poderia razoavelmente buscar. Essas melhorias não são meramente uma questão de aumento de escala da fermentação e exigiriam pesquisas adicionais para alcançar a tensão necessária e as melhorias de caminho. Assim, o trabalho aqui relatado não fornece uma “receita” para a fabricação de opioides de forma que comprometa diretamente a saúde ou segurança pública. No entanto, como uma salvaguarda da saúde pública futura, nossas cepas de levedura produzem apenas opioides (por exemplo, hidrocodona, tebaína) com potencial reduzido de desvio para mercados ilícitos devido às etapas adicionais e ao custo de converter quimicamente esses compostos específicos em heroína. Embora tais cepas pudessem ser potencialmente modificadas para produzir morfina diretamente, o trabalho anterior para converter tebaina em morfina obteve apenas 1,5% de rendimento (13) Assim, como uma estimativa grosseira, uma cepa que converte açúcar em morfina exigiria uma melhoria no rendimento geral por um fator de

7 × 10 6 em relação ao trabalho aqui relatado.

Apesar dessa precaução, a produção substancialmente melhorada de opioides via levedura deve ser esperada nos próximos anos. De forma mais ampla, nosso trabalho destaca o potencial da levedura como base para a produção de base biológica de muitos produtos químicos e materiais complexos. A biologia sintética está pronta para substituir ou complementar muitas cadeias de suprimentos com fabricação avançada de base biológica. Uma capacidade muito expandida para construir com biologia contribuirá para mudanças no uso da terra e dos recursos naturais, emprego e políticas. Estratégias práticas que atendam às preocupações e ao mesmo tempo possibilitem a inovação e a realização de benefícios devem ser desenvolvidas agora para garantir nossa bioeconomia futura. Dada a complexidade e diversidade das preocupações potenciais e possíveis benefícios, endossaríamos fortemente um processo deliberativo aberto que desenvolva opções para a governança (42) da biossíntese de compostos medicinais antes que os processos economicamente competitivos sejam realizados.


Carotenóides na Natureza

Este livro abrangente e editado explora carotenóides e seus importantes papéis funcionais em leveduras, bactérias e plantas e uma exposição profunda sobre as estruturas das moléculas de carotenóides, com foco na primeira das três partes na biossíntese de carotenóides. A regulação da biossíntese de carotenóides na fotossíntese, bem como na planta, frutos, raízes de reserva e algas é central para a segunda parte, e descobertas sobre a função dos carotenóides na saúde humana aparecem na terceira e última parte. Muitas ilustrações, explicações, visões gerais e exemplos úteis ajudam a atualizar os leitores sobre temas relevantes, incluindo genes carotenogênicos, carotenóides em frutas e engenharia metabólica.

O livro explora onde os carotenóides são sintetizados na natureza, inclusive em cenouras e algas. Autores especialistas contribuintes examinam funções enzimáticas e modelos de plantas e analisam a estrutura das moléculas de carotenóides. A função dos carotenóides na fotossíntese e nos órgãos fotossintéticos, bem como durante o amadurecimento dos frutos, são então explorados. Um capítulo inteiro é dedicado às pesquisas mais recentes sobre apocarotenóides e outros capítulos cobrem temas interessantes e novos sobre o desenvolvimento de plastídios e a regulação epigenética que afeta a síntese de carotenóides em plantas. A engenharia metabólica dos carotenóides que vem sendo feita em frutas, plantas e sementes é outra área que os leitores podem explorar, juntamente com evidências sobre a função dos carotenóides na nutrição humana, como antioxidantes, como no controle do metabolismo lipídico e na absorção. de carotenóides.

Trata-se de um trabalho altamente informativo e abrangente que irá atualizar pesquisadores da área, bem como apoiar alunos de fisiologia vegetal e biotecnologia, como leitura complementar.


Akhter, S., Aziz, R. K. e Edwards, R. A., 2012. Phispy: Um novo algoritmo para encontrar profagos em genomas bacterianos que combina estratégias baseadas em similaridade e composição. Pesquisa de ácidos nucléicos, 40. (16): 329–334.

Arrach, N., Fernandez-Martin, R., Cerda-Olmedo, E., e Ava-los, J., 2001. Um único gene para licopeno ciclase, fitoeno sintase e regulação da biossíntese de caroteno em Phyco-myces. Anais da Academia Nacional de Ciências dos Estados Unidos da América, 98. (4): 1687–1692.

Buzzini, P., Innocenti, M., Turchetti, B., Libkind, D., van Broock, M., e Mulinacci, N., 2007. Perfis carotenóides de leveduras pertencentes aos gêneros Rhodotorula, Rhodosporidium, Sporobolomyces, e Sporidiobolus. Canadian Journal of Microbiologia, 53. (8): 1024–1031.

Chin, CS, Peluso, P., Sedlazeck, FJ, Nattestad, M., Conception, GT, Clum, A., Dunn, C, O'Malley, R., Figueroa-Balderas, R., e Morales-Cruz, A., 2016.Montagem do genoma diplóide em fases com sequenciamento em tempo real de uma única molécula. Métodos da Natureza, 13. (12): 1050–1054.

Dasgupta, D., Sharma, T., Bhatt, A., Bandhu, S., e Ghosh, D., 2017. Cultivation of oleaginous yeast Rhodotorula mucilaginos. IIPL32 em reator de transporte aéreo de coluna dividida e sua influência nas propriedades do combustível. Biocatálise e Biotecnologia Agrícola, 10: 308–316.

Deligios, M., Fraumene, C., Abbondio, M., Mannazzu, I., Tanca, A., Addis, M. F., e Uzzau, S., 2015. Draft genome sequence of Rhodotorula mucilaginosa, um patógeno oportunista emergente. Anúncios do Genoma, 3 (2): 1–2.

Frengova, G. I., e Beshkova, D. M., 2009. Carotenóides de Rodotorul. e Phaffia. Leveduras de importância biotecnológica. Journal of Industrial Microbiology & amp Biotechnology, 36 (2): 163–180.

Gan, H. M., Thomas, B. N., Cavanaugh, N. T., Morales, G. H., Mayers, A. N., Savka, M. A. e Hudson, A. O., 2017. Sequenciamento do genoma inteiro de Rhodotorula mucilaginos. isolado do pau de mascar (Distemonanthus bentha-mianus): Insights sobre Filogenia de rodotórula, dinâmica mitogenômica e biossíntese de carotenóides. PeerJ, 5 (1): e4030.

Hawksworth, D. L., Kirk, P. M., Sutton, B. C., e Pegler, D. N., 1996. Ainsworth & amp Bisby’s dictionary of the fungi. Revista do Instituto de Medicina Tropical de São Paulo, 38. (4): 17–19.

Hernandez-Almanza, A., Montanez, J. C., Aguilar-Gonzalez, M. A., Martinez-Avila, C, Rodriguez-Herrera, R., e Aguilar, C. N., 2014. Rhodotorula glutini. como fonte de pigmentos e metabólitos para a indústria alimentícia. Biociência alimentar, 5. (Completo): 64–72.

Huerta-Cepas, J., Szklarczyk, D., Forslund, K., Cook, H., Heller, D., Walter, MC, Rattei, T., Mende, DR, Sunagawa, S., e Kuhn, M. , 2016. eggNOG 4.5: Uma estrutura de ortologia hierárquica com anotações funcionais melhoradas para sequências eucarióticas, procarióticas e virais. Pesquisa de ácidos nucléicos, 44: D286-D293.

Ignatova, L. V., Brazhnikova, Y. V., Berzhanova, R. Z., e Mukasheva, T. D., 2015. Promoção do crescimento de plantas e atividade antifúngica de leveduras de solo de castanha escura. Pesquisa Microbiológica, 175: 78–83.

Koonin, EV, Fedorova, ND, Jackson, JD, Jacobs, AR, Krylov, DM, Makarova, KS, Mazumder, R., Mekhe-dov, SL, Nikolskaya, AN, e Rao, BS, 2004. Uma classificação evolutiva abrangente de proteínas codificadas em genomas eucarióticos completos. Biologia Genômica, 5 (2): R7-R7.

Kot, A. M., Blazejak, S., Gientka, I., Kieliszek, M., e Brys, J., 2018. Torulene and torularhodin: “New” fungal carotenids for industry? Fábricas de células microbianas, 17. (1): 49.

Landolfo, S., Ianiri, G., Camiolo, S., Porceddu, A., Mulas, G., Chessa, R., Zara, G., e Mannazzu, I., 2018. Grupo de genes CAR e níveis de transcrição de genes carotenogênicos em Rhodotorula mucilaginosa. Microbiologia, 164. (1): 78–87.

Li, C., Zhang, N., Li, B., Xu, Q., Song, J., Wei, N., Wang, W. e Zou, H., 2017. Maior acúmulo de toruleno na levedura vermelha Sporidiobolus pararoseu. NGR como resposta ao estresse em condições de alto teor de sal. Química Alimentar, 237: 1041–1047.

Lomsadze, A., Terhovhannisyan, V., Chernoff, Y. O., e Bo-rodovsky, M., 2005. Identificação de genes em novos genomas eucariotos por algoritmo de autotreinamento. Pesquisa de ácidos nucléicos, 30. (20): 6494–6506.

Ma, W., Chen, X., Wang, B., Lou, W., Chen, X., Hua, J., Sun, YJ, Zhao, Y., e Peng, T., 2017. Caracterização, antioxidante -atividade e atividade anti-carcinoma do extrato de exopolissacarídeo de Rhodotorula mucilaginos. CICC 33014. Polímeros de carboidratos, 181: 768.

Mata-Gomez, L. C., Montanez, J. C., Mendez-Zavala, A., e Aguilar, C. N., 2014. Produção biotecnológica de carotenóides por leveduras: Uma visão geral. Fábricas de células microbianas, 13. (1): 12.p.

Medema, MH, Blin, K., Cimermancic, P., De Jager, V., Zakrzewski, P., Fischbach, MA, Weber, T., Takano, E., Breitling, R., 2011. AntiSMASH: Identificação rápida , anotação e análise de clusters de genes de biossíntese de metabólitos secundários em sequências genômicas de bactérias e fungos. Pesquisa de ácidos nucléicos, 39. (problema com o servidor da web): W339.

Minora, K., Goto, S., Kawashima, S., Okuno, Y. e Hattori, M., 2004. O recurso KEGG para decifrar o genoma. Pesquisa de ácidos nucléicos, 32: 277–280.

Akhtyamova, N., e Sattarova, R. K., 2013. Endophytic levedura Rubr de rodotórula. cepa TG-1: Atividades antagônicas e fitossanitárias. Bioquímica e Risiologia, 2. (1): 1000104. DOI: 10.4172 / 2168-9652.1000104.

Prado-Cabrero, A., Scherzinger, D., Avalos, J., e Al-Babili, S., 2007. Biossíntese retinal em fungos: Caracterização do carotenóide oxigenase CarX de Fusarium fujikuroi. Célula eucariótica, 6 (4): 650–657.

Rodriguez-Saiz, M., de la Fuente, J. L. e Barredo, J. L., 2010. Xanthophyllomyces dendrorhou. para a produção industrial de astaxantina. Microbiologia Aplicada e Biotecnologia, 88: 645–658.

Saha, C., and Seal, A., 2015. Mudanças iniciais na transcrição do caule do arroz em resposta a Rhodotorula mucilaginos. JGTA-S1. Dados Genomics, 6: 237–240.

Salvadori, M. R., Ando, ​​R. A., Oiler do Nascimento, C. A., e Correa, B., 2014. Biossíntese intracelular e remoção de nanopartículas de cobre por biomassa morta de levedura isolada do efluente de uma mina na Amazônia brasileira. Plos One, 9(1): e87968.

Sanz, C., Velayos, A., Alvarez, M. I., Benito, E. R. e Eslava, A. P., 2011. Functional analysis of the Phycomyces carR. gene que codifica as enzimas fitoenossintase e licopeno ciclase. PloS One, 6. (8): e23102.

Singh, P., Tsuji, M., Singh, S. M., Roy, U., e Hoshino, T., 2013. Caracterização taxonômica, estratégias de adaptação e potencial biotecnológico de leveduras criofílicas de núcleos de gelo da geleira Midre Lovenbreen, Svalbard, Ártico. Criobiologia, 66. (2): 167–175.

Tamura, K., Nei, M. e Kumar, S., 2004. Perspectivas para inferir filogenias muito grandes usando o método de união de vizinhos. Anais da Academia Nacional de Ciências dos Estados Unidos da América, 101. (30): 11030–11035.

Wirth, F., e Goldani, L. Z., 2012. Epidemiologia de Rhodotorula. Um patógeno emergente. Perspectivas interdisciplinares sobre doenças infecciosas, 7.p, DOI: 10.1155 / 2012/465717.

Wozniak, A., Lozano, C., Barahona, S., Niklitschek, M., Marcoleta, A., Alcaino, J., Sepulveda, D., Baeza, M., and Cifuentes, V, 2011. Produção diferencial de carotenóides e expressão gênica em Xanthophyllomyces dendrorhou. cultivado em uma fonte de carbono não fermentável. Pesquisa de fermento de samambaias, 11. (3): 252–262.

Zhang, H., Ge, L., Chen, K., Zhao, L. N., e Zhang, X. Y., 2014. Enhanced biocontrol activity of Rhodotorula mucilaginosa, cultivadas em meio contendo quitosana contra doenças pós-colheita em morangos: Possíveis mecanismos subjacentes ao efeito. Journal of Agricultural and Food Chemistry, 62. (18): 4214–4224.


Materiais e métodos

Clonagem e mutagênese dirigida ao local de crtI e crtYB

Os cDNAs correspondentes a crtI (Acesso GenBank no. AY177424.1) e crtYB (Acesso GenBank no. AY177204.1) foram isolados de X. dendrorhous por RT-PCR, e clonado no vetor pMD18-T para obter os construtos pMD18-T-crtI e pMD18-T-crtYB, respectivamente, para sequenciamento de DNA. Para determinar os locais de nucleotídeos cuja frequência de utilização é & lt 15% em S. cerevisiae, as sequências de cDNA de comprimento total de crtI e crtYB foram analisados ​​usando um analisador gráfico de uso de códons (GCUA Fuhrmann et al., 2004) com a tabela de uso de códons de S. cerevisiae. Posteriormente, cinco nucleotídeos de crtI e oito nucleotídeos de crtYB foram identificados como sites ruins (frequência de uso de & lt 15%) no que diz respeito à eficiência da tradução em S. cerevisiae. Com base nesses resultados, os locais de códon pobres de crtI e crtYB foram submetidos a mutação para melhorar sua frequência de uso de códons. Todos os processos de mutagênese dirigida ao local foram realizados por PCR de extensão sobreposta com primers 5-30, usando o plasmídeo pMD18-T-crtI ou pMD18-T-crtYB como o modelo (Kanoksilapatham et al., 2007). O mutante crtI e crtYB foram designados como McrtI e McrtYB, respectivamente. Todos os primers usados ​​para a PCR neste estudo estão listados na Tabela 1.

Os iniciadores utilizados neste estudo

Primer no. Descrição Sequência (5 ′ a 3 ′)
1 crtI-F GGCGGATCCATGGGAAAAGAACAAGATCAG
2 crtI-R AAAGCGGCCGCTCAGAAAGCAAGAACACCA
3 crtYB-F GCGGGATCCATGACGGCTCTCGCATATTAC
4 crtYB-R AAAGCGGCCGCTTACTGCCCTTCCCATCCG
5 crtI-116-F CAACCGACATGGCGTTGCTCAAGAGAGAAGTCGAGCG
6 crtI-116-R CGCTCGACTTCTCTCTTGAGCAACGCCATGTCGGTTG
7 crtI-129-F GGCAAAGATGGATTTGATAGATTCTTGTCGTTTATCCAAGAAGCCCAC
8 crtI-129-R GTGGGCTTCTTGGATAAACGACAAGAATCTATCAAATCCATCTTTGCC
9 crtI-161-F CCCTGGCTTCGCAGCATTCTTAAGACTACAGTTCATTGGCC
10 crtI-161-R GGCCAATGAACTGTAGTCTTAAGAATGCTGCGAAGCCAGGG
11 crtI-244-F CCTAATACTCTTCTTCAGATCGTCAAGAGAAACAATCCCTCAGCC
12 crtI-244-R GGCTGAGGGATTGTTTCTCTTGACGATCTGAAGAAGAGTATTAGG
13 crtI-420-F GCTTGTTGCTAGAGCAAGGAAGTTTGTGATCCACACGCTTTCC
14 crtI-420-R GGAAAGCGTGTGGATCACAAACTTCCTTGCTCTAGCAACAAGC
15 crtYB-155-F CTACTTCTACATGAGAGCACTCTCCTTACTCATCACCCCACC
16 crtYB-155-R GGTGGGGTGATGAGTAAGGAGAGTGCTCTCATGTAGAAGTAG
17 crtYB-310-F GTTGGAGGAAAAGAGCAGAAGCTTTTTTGTTGCCTCGGCTGG
18 crtYB-310-R CCAGCCGAGGCAACAAAAAAGCTTCTGCTCTTTTCCTCCAAC
19 crtYB-335-F GGCTGGTTGGACTATACGCATTCTGCAGAGTGACTGATGATC
20 crtYB-335-R GATCATCAGTCACTCTGCAGAATGCGTATAGTCCAACCAGCC
21 crtYB-462-F CGACAGAGGCAGTCCAGGCTAGAAAGACGCCTATCG
22 crtYB-462-R CGATAGGCGTCTTTCTAGCCTGGACTGCCTCTGTCG
23 crtYB-548-F CTCTCATTCTTTGGTCTTAGAGATGAATCAAAGCTTGCGATCCCG
24 crtYB-548-R CGGGATCGCAAGCTTTGATTCATCTCTAAGACCAAAGAATGAGAG
25 crtYB-563-F CCCGACTGATTGGACGGAACCTAGACCTCAAGATTTCGAC
26 crtYB-563-R GTCGAAATCTTGAGGTCTAGGTTCCGTCCAATCAGTCGGG
27 crtYB-589-F CGCCTCAGAAAGCTTCAGATTCGAATGGAAGACGTACTCGC
28 crtYB-589-R GCGAGTACGTCTTCCATTCGAATCTGAAGCTTTCTGAGGCG
29 crtYB-660-F GGATGGAGGAGAGTAAGAAAAGTCTTGAGTGTGGTCATGAGCG
30 crtYB-660-R CGCTCATGACCACACTCAAGACTTTTCTTACTCTCCTCCATCC
31 TDH3p-F GCGCTCGAGACTAGTCAGTTCGAGTTTATCA
32 TDH3p-R GCCGGATCCTTTGTTTGTTTATGTG
33 CYC1t-F TTTGCGGCCGCATCCGCTCTAACCGAAA
34 CYC1t-R GCCGGATCCTTTGTTTGTTTATGTG
35 Pr-crtI-Tr-F GCGCTCGAGACTAGTCAGTTCGAGTTTATCA
36 Pr-crtI-Tr-R GCCGGATCCTTTGTTTGTTTATGTG
37 Pr-crtYB-Tr-F GCGCTCGAGACTAGTCAGTTCGAGTTTATCA
38 Pr-crtYB-Tr-R GCCGGATCCTTTGTTTGTTTATGTG
39 tHMG1-F CACATAAACAAACAAAATGGACCAATTGGTGAAAACTGAAG
40 tHMG1-R GGCGGATCCTTAGGATTTAATGCAGGTGACG
41 mva-F CACATAAACAAACAAAATGCAAAGTTTAGATAAGAATTTCCG
42 mva-R GGCGGATCCTTATTGTTGGCTTCTTAAATCTTG
43 Pr-tHMG1-F GCGACTAGTCAGTTCGAGTTTATCA
44 Pr-tHMG1-R GGCGGATCCTTAGGATTTAATGCAGGTGACG
45 Pr-mva-F GCGACTAGTCAGTTCGAGTTTATCA
46 Pr-mva-R GGCGGATCCTTATTGTTGGCTTCTTAAATCTTG
Primer no. Descrição Sequência (5 ′ a 3 ′)
1 crtI-F GGCGGATCCATGGGAAAAGAACAAGATCAG
2 crtI-R AAAGCGGCCGCTCAGAAAGCAAGAACACCA
3 crtYB-F GCGGGATCCATGACGGCTCTCGCATATTAC
4 crtYB-R AAAGCGGCCGCTTACTGCCCTTCCCATCCG
5 crtI-116-F CAACCGACATGGCGTTGCTCAAGAGAGAAGTCGAGCG
6 crtI-116-R CGCTCGACTTCTCTCTTGAGCAACGCCATGTCGGTTG
7 crtI-129-F GGCAAAGATGGATTTGATAGATTCTTGTCGTTTATCCAAGAAGCCCAC
8 crtI-129-R GTGGGCTTCTTGGATAAACGACAAGAATCTATCAAATCCATCTTTGCC
9 crtI-161-F CCCTGGCTTCGCAGCATTCTTAAGACTACAGTTCATTGGCC
10 crtI-161-R GGCCAATGAACTGTAGTCTTAAGAATGCTGCGAAGCCAGGG
11 crtI-244-F CCTAATACTCTTCTTCAGATCGTCAAGAGAAACAATCCCTCAGCC
12 crtI-244-R GGCTGAGGGATTGTTTCTCTTGACGATCTGAAGAAGAGTATTAGG
13 crtI-420-F GCTTGTTGCTAGAGCAAGGAAGTTTGTGATCCACACGCTTTCC
14 crtI-420-R GGAAAGCGTGTGGATCACAAACTTCCTTGCTCTAGCAACAAGC
15 crtYB-155-F CTACTTCTACATGAGAGCACTCTCCTTACTCATCACCCCACC
16 crtYB-155-R GGTGGGGTGATGAGTAAGGAGAGTGCTCTCATGTAGAAGTAG
17 crtYB-310-F GTTGGAGGAAAAGAGCAGAAGCTTTTTTGTTGCCTCGGCTGG
18 crtYB-310-R CCAGCCGAGGCAACAAAAAAGCTTCTGCTCTTTTCCTCCAAC
19 crtYB-335-F GGCTGGTTGGACTATACGCATTCTGCAGAGTGACTGATGATC
20 crtYB-335-R GATCATCAGTCACTCTGCAGAATGCGTATAGTCCAACCAGCC
21 crtYB-462-F CGACAGAGGCAGTCCAGGCTAGAAAGACGCCTATCG
22 crtYB-462-R CGATAGGCGTCTTTCTAGCCTGGACTGCCTCTGTCG
23 crtYB-548-F CTCTCATTCTTTGGTCTTAGAGATGAATCAAAGCTTGCGATCCCG
24 crtYB-548-R CGGGATCGCAAGCTTTGATTCATCTCTAAGACCAAAGAATGAGAG
25 crtYB-563-F CCCGACTGATTGGACGGAACCTAGACCTCAAGATTTCGAC
26 crtYB-563-R GTCGAAATCTTGAGGTCTAGGTTCCGTCCAATCAGTCGGG
27 crtYB-589-F CGCCTCAGAAAGCTTCAGATTCGAATGGAAGACGTACTCGC
28 crtYB-589-R GCGAGTACGTCTTCCATTCGAATCTGAAGCTTTCTGAGGCG
29 crtYB-660-F GGATGGAGGAGAGTAAGAAAAGTCTTGAGTGTGGTCATGAGCG
30 crtYB-660-R CGCTCATGACCACACTCAAGACTTTTCTTACTCTCCTCCATCC
31 TDH3p-F GCGCTCGAGACTAGTCAGTTCGAGTTTATCA
32 TDH3p-R GCCGGATCCTTTGTTTGTTTATGTG
33 CYC1t-F TTTGCGGCCGCATCCGCTCTAACCGAAA
34 CYC1t-R GCCGGATCCTTTGTTTGTTTATGTG
35 Pr-crtI-Tr-F GCGCTCGAGACTAGTCAGTTCGAGTTTATCA
36 Pr-crtI-Tr-R GCCGGATCCTTTGTTTGTTTATGTG
37 Pr-crtYB-Tr-F GCGCTCGAGACTAGTCAGTTCGAGTTTATCA
38 Pr-crtYB-Tr-R GCCGGATCCTTTGTTTGTTTATGTG
39 tHMG1-F CACATAAACAAACAAAATGGACCAATTGGTGAAAACTGAAG
40 tHMG1-R GGCGGATCCTTAGGATTTAATGCAGGTGACG
41 mva-F CACATAAACAAACAAAATGCAAAGTTTAGATAAGAATTTCCG
42 mva-R GGCGGATCCTTATTGTTGGCTTCTTAAATCTTG
43 Pr-tHMG1-F GCGACTAGTCAGTTCGAGTTTATCA
44 Pr-tHMG1-R GGCGGATCCTTAGGATTTAATGCAGGTGACG
45 Pr-mva-F GCGACTAGTCAGTTCGAGTTTATCA
46 Pr-mva-R GGCGGATCCTTATTGTTGGCTTCTTAAATCTTG

Os iniciadores utilizados neste estudo

Primer no. Descrição Sequência (5 ′ a 3 ′)
1 crtI-F GGCGGATCCATGGGAAAAGAACAAGATCAG
2 crtI-R AAAGCGGCCGCTCAGAAAGCAAGAACACCA
3 crtYB-F GCGGGATCCATGACGGCTCTCGCATATTAC
4 crtYB-R AAAGCGGCCGCTTACTGCCCTTCCCATCCG
5 crtI-116-F CAACCGACATGGCGTTGCTCAAGAGAGAAGTCGAGCG
6 crtI-116-R CGCTCGACTTCTCTCTTGAGCAACGCCATGTCGGTTG
7 crtI-129-F GGCAAAGATGGATTTGATAGATTCTTGTCGTTTATCCAAGAAGCCCAC
8 crtI-129-R GTGGGCTTCTTGGATAAACGACAAGAATCTATCAAATCCATCTTTGCC
9 crtI-161-F CCCTGGCTTCGCAGCATTCTTAAGACTACAGTTCATTGGCC
10 crtI-161-R GGCCAATGAACTGTAGTCTTAAGAATGCTGCGAAGCCAGGG
11 crtI-244-F CCTAATACTCTTCTTCAGATCGTCAAGAGAAACAATCCCTCAGCC
12 crtI-244-R GGCTGAGGGATTGTTTCTCTTGACGATCTGAAGAAGAGTATTAGG
13 crtI-420-F GCTTGTTGCTAGAGCAAGGAAGTTTGTGATCCACACGCTTTCC
14 crtI-420-R GGAAAGCGTGTGGATCACAAACTTCCTTGCTCTAGCAACAAGC
15 crtYB-155-F CTACTTCTACATGAGAGCACTCTCCTTACTCATCACCCCACC
16 crtYB-155-R GGTGGGGTGATGAGTAAGGAGAGTGCTCTCATGTAGAAGTAG
17 crtYB-310-F GTTGGAGGAAAAGAGCAGAAGCTTTTTTGTTGCCTCGGCTGG
18 crtYB-310-R CCAGCCGAGGCAACAAAAAAGCTTCTGCTCTTTTCCTCCAAC
19 crtYB-335-F GGCTGGTTGGACTATACGCATTCTGCAGAGTGACTGATGATC
20 crtYB-335-R GATCATCAGTCACTCTGCAGAATGCGTATAGTCCAACCAGCC
21 crtYB-462-F CGACAGAGGCAGTCCAGGCTAGAAAGACGCCTATCG
22 crtYB-462-R CGATAGGCGTCTTTCTAGCCTGGACTGCCTCTGTCG
23 crtYB-548-F CTCTCATTCTTTGGTCTTAGAGATGAATCAAAGCTTGCGATCCCG
24 crtYB-548-R CGGGATCGCAAGCTTTGATTCATCTCTAAGACCAAAGAATGAGAG
25 crtYB-563-F CCCGACTGATTGGACGGAACCTAGACCTCAAGATTTCGAC
26 crtYB-563-R GTCGAAATCTTGAGGTCTAGGTTCCGTCCAATCAGTCGGG
27 crtYB-589-F CGCCTCAGAAAGCTTCAGATTCGAATGGAAGACGTACTCGC
28 crtYB-589-R GCGAGTACGTCTTCCATTCGAATCTGAAGCTTTCTGAGGCG
29 crtYB-660-F GGATGGAGGAGAGTAAGAAAAGTCTTGAGTGTGGTCATGAGCG
30 crtYB-660-R CGCTCATGACCACACTCAAGACTTTTCTTACTCTCCTCCATCC
31 TDH3p-F GCGCTCGAGACTAGTCAGTTCGAGTTTATCA
32 TDH3p-R GCCGGATCCTTTGTTTGTTTATGTG
33 CYC1t-F TTTGCGGCCGCATCCGCTCTAACCGAAA
34 CYC1t-R GCCGGATCCTTTGTTTGTTTATGTG
35 Pr-crtI-Tr-F GCGCTCGAGACTAGTCAGTTCGAGTTTATCA
36 Pr-crtI-Tr-R GCCGGATCCTTTGTTTGTTTATGTG
37 Pr-crtYB-Tr-F GCGCTCGAGACTAGTCAGTTCGAGTTTATCA
38 Pr-crtYB-Tr-R GCCGGATCCTTTGTTTGTTTATGTG
39 tHMG1-F CACATAAACAAACAAAATGGACCAATTGGTGAAAACTGAAG
40 tHMG1-R GGCGGATCCTTAGGATTTAATGCAGGTGACG
41 mva-F CACATAAACAAACAAAATGCAAAGTTTAGATAAGAATTTCCG
42 mva-R GGCGGATCCTTATTGTTGGCTTCTTAAATCTTG
43 Pr-tHMG1-F GCGACTAGTCAGTTCGAGTTTATCA
44 Pr-tHMG1-R GGCGGATCCTTAGGATTTAATGCAGGTGACG
45 Pr-mva-F GCGACTAGTCAGTTCGAGTTTATCA
46 Pr-mva-R GGCGGATCCTTATTGTTGGCTTCTTAAATCTTG
Primer no. Descrição Sequência (5 ′ a 3 ′)
1 crtI-F GGCGGATCCATGGGAAAAGAACAAGATCAG
2 crtI-R AAAGCGGCCGCTCAGAAAGCAAGAACACCA
3 crtYB-F GCGGGATCCATGACGGCTCTCGCATATTAC
4 crtYB-R AAAGCGGCCGCTTACTGCCCTTCCCATCCG
5 crtI-116-F CAACCGACATGGCGTTGCTCAAGAGAGAAGTCGAGCG
6 crtI-116-R CGCTCGACTTCTCTCTTGAGCAACGCCATGTCGGTTG
7 crtI-129-F GGCAAAGATGGATTTGATAGATTCTTGTCGTTTATCCAAGAAGCCCAC
8 crtI-129-R GTGGGCTTCTTGGATAAACGACAAGAATCTATCAAATCCATCTTTGCC
9 crtI-161-F CCCTGGCTTCGCAGCATTCTTAAGACTACAGTTCATTGGCC
10 crtI-161-R GGCCAATGAACTGTAGTCTTAAGAATGCTGCGAAGCCAGGG
11 crtI-244-F CCTAATACTCTTCTTCAGATCGTCAAGAGAAACAATCCCTCAGCC
12 crtI-244-R GGCTGAGGGATTGTTTCTCTTGACGATCTGAAGAAGAGTATTAGG
13 crtI-420-F GCTTGTTGCTAGAGCAAGGAAGTTTGTGATCCACACGCTTTCC
14 crtI-420-R GGAAAGCGTGTGGATCACAAACTTCCTTGCTCTAGCAACAAGC
15 crtYB-155-F CTACTTCTACATGAGAGCACTCTCCTTACTCATCACCCCACC
16 crtYB-155-R GGTGGGGTGATGAGTAAGGAGAGTGCTCTCATGTAGAAGTAG
17 crtYB-310-F GTTGGAGGAAAAGAGCAGAAGCTTTTTTGTTGCCTCGGCTGG
18 crtYB-310-R CCAGCCGAGGCAACAAAAAAGCTTCTGCTCTTTTCCTCCAAC
19 crtYB-335-F GGCTGGTTGGACTATACGCATTCTGCAGAGTGACTGATGATC
20 crtYB-335-R GATCATCAGTCACTCTGCAGAATGCGTATAGTCCAACCAGCC
21 crtYB-462-F CGACAGAGGCAGTCCAGGCTAGAAAGACGCCTATCG
22 crtYB-462-R CGATAGGCGTCTTTCTAGCCTGGACTGCCTCTGTCG
23 crtYB-548-F CTCTCATTCTTTGGTCTTAGAGATGAATCAAAGCTTGCGATCCCG
24 crtYB-548-R CGGGATCGCAAGCTTTGATTCATCTCTAAGACCAAAGAATGAGAG
25 crtYB-563-F CCCGACTGATTGGACGGAACCTAGACCTCAAGATTTCGAC
26 crtYB-563-R GTCGAAATCTTGAGGTCTAGGTTCCGTCCAATCAGTCGGG
27 crtYB-589-F CGCCTCAGAAAGCTTCAGATTCGAATGGAAGACGTACTCGC
28 crtYB-589-R GCGAGTACGTCTTCCATTCGAATCTGAAGCTTTCTGAGGCG
29 crtYB-660-F GGATGGAGGAGAGTAAGAAAAGTCTTGAGTGTGGTCATGAGCG
30 crtYB-660-R CGCTCATGACCACACTCAAGACTTTTCTTACTCTCCTCCATCC
31 TDH3p-F GCGCTCGAGACTAGTCAGTTCGAGTTTATCA
32 TDH3p-R GCCGGATCCTTTGTTTGTTTATGTG
33 CYC1t-F TTTGCGGCCGCATCCGCTCTAACCGAAA
34 CYC1t-R GCCGGATCCTTTGTTTGTTTATGTG
35 Pr-crtI-Tr-F GCGCTCGAGACTAGTCAGTTCGAGTTTATCA
36 Pr-crtI-Tr-R GCCGGATCCTTTGTTTGTTTATGTG
37 Pr-crtYB-Tr-F GCGCTCGAGACTAGTCAGTTCGAGTTTATCA
38 Pr-crtYB-Tr-R GCCGGATCCTTTGTTTGTTTATGTG
39 tHMG1-F CACATAAACAAACAAAATGGACCAATTGGTGAAAACTGAAG
40 tHMG1-R GGCGGATCCTTAGGATTTAATGCAGGTGACG
41 mva-F CACATAAACAAACAAAATGCAAAGTTTAGATAAGAATTTCCG
42 mva-R GGCGGATCCTTATTGTTGGCTTCTTAAATCTTG
43 Pr-tHMG1-F GCGACTAGTCAGTTCGAGTTTATCA
44 Pr-tHMG1-R GGCGGATCCTTAGGATTTAATGCAGGTGACG
45 Pr-mva-F GCGACTAGTCAGTTCGAGTTTATCA
46 Pr-mva-R GGCGGATCCTTATTGTTGGCTTCTTAAATCTTG

Construções de plasmídeo

Uma cassete de DNA para expressão de levedura foi preparada no vetor PUC19 para obter a construção pLQ01 (Fig. 1). O plasmídeo pLQ01 compreendia 680 pb TDH3 promotor do gene e 250-bp CYC1 sequências terminadoras de genes, que foram amplificadas a partir do DNA genômico de S. cerevisiae usando primers 31–34. As estruturas de leitura aberta (ORFs) de crtI, crtYB, McrtI e McrtYB estavam ligados ao TDH3 promotor e CYC1 terminador inserindo as ORFs no plasmídeo pLQ01 no local BamHI / NotI. A cassete de expressão ‘TDH3 promotor-gene-CYC1 terminator 'foi então amplificado usando os iniciadores 35–38. Os cassetes de DNATDH3 promotor-crtI-CYC1 terminador 'e'TDH3 promotor-McrtI-CYC1 terminador 'foram digeridos com enzimas de restrição SpeI e SalI e introduzidos em um vetor de expressão de levedura integrativo pRS406 em locais SpeI / SalI, resultando nos construtos pRS406-crtI e pRS406-McrtI, respectivamente. O fragmento SalI / XhoI de 'TDH3 promotor-crtYB-CYC1 terminator 'foi subsequentemente ligado a pRS406-crtI no local SalI / XhoI para obter a construção pRS406W (Fig. 1). A mesma abordagem foi aplicada para construir pRS406M por excisão do fragmento SalI / XhoI de 'TDH3 promotor-McrtYB-CYC1 terminador 'e introdução em pRS406-McrtI.

Estrutura dos vetores. (a) pLQ01 contendo um TDH3 promotor e um CYC1 o Exterminador do Futuro. (b) pRS406. (c) pRS406W carregando os genes do tipo selvagem responsáveis ​​pela expressão de carotenóides. (d) pRS406M carregando os genes de expressão de carotenóides otimizados. (e) pESC-TDH3-tHMG1 segurando o domínio catalítico de tHMG1 gene em Saccharomyces cerevisiae. (f) pESC-TDH3-tHMG1 segurando o mva gene derivado de Staphylococcus aureus.

Estrutura dos vetores. (a) pLQ01 contendo um TDH3 promotor e um CYC1 o Exterminador do Futuro. (b) pRS406. (c) pRS406W carregando os genes do tipo selvagem responsáveis ​​pela expressão de carotenóides. (d) pRS406M carregando os genes de expressão de carotenóides otimizados. (e) pESC-TDH3-tHMG1 segurando o domínio catalítico de tHMG1 gene em Saccharomyces cerevisiae. (f) pESC-TDH3-tHMG1 segurando o mva gene derivado de Staphylococcus aureus.

O ORF de tHMG1 cDNA (NCBI Reference Sequence NM_001182434.1) foi isolado por RT-PCR com primers 39-40 de S. cerevisiae Cepa WAT11, e o cDNA correspondente a mva (NCBI Reference Sequence NC_017342.1) foi amplificado usando os primers 41-42 do DNA genômico de S. aureus (ATCC25923). o S. aureus cepa foi gentilmente cedida pelo Dr. Qiang Gao (Controle Biológico de Vetores Arborvirus, Instituto de Virologia de Wuhan, Academia Chinesa de Ciências). Por meio de PCR de extensão sobreposta com os primers 43-44, a ORF de tHMG1 estava ligado ao TDH3 promotor para obter o fragmento 'TDH3-tHMG1’. O fragmento de DNATDH3-tHMG1'Foi então digerido e ligado em um vetor de expressão de levedura pESC-HIS (Stratagene) no sítio SpeI / BamHI para obter o construto pESC-HIS-TDH3-tHMG1. Da mesma forma, o ORF de mva foi clonado no TDH3 promotor por PCR de sobreposição usando os iniciadores 45-46 e, em seguida, ligado em pESC-HIS no sítio EcoRI / BamHI para obter o pESC-HIS-TDH3-mva vetor. Nos construtos pESC-HIS-TDH3-tHMG1 e pESC-HIS-TDH3-mva, os promotores indutores de galactose endógenos (Gal1 e Gal10) em pESC-HIS foram removidos (Fig. 1).

Construção e cultivo de cepa de levedura

Os vetores de integração pRS406, pRS406W e pRS406M foram linearizados com StuI e integrados no ura3-52 locus de S. cerevisiae Cepa WAT11 para criar as cepas de levedura WAT11 / pRS406, WAT11 / pRS406W e WAT11 / pRS406M, usando o método PEG / LiAc (Gietz & amp Woods, 2002). O vetor epissomal pESC-HIS-TDH3-tHMG1 foi transformado na cepa de levedura WAT11 / pRS406M para obter WAT11 / pRS406M-tHMG1. Da mesma forma, a cepa WAT11 / pRS406M-mva foi preparado transformando o construto pESC-HIS-TDH3-mva na cepa de levedura WAT11 / pRS406M. Como controle, o vetor vazio pESC-HIS foi transferido para a cepa de levedura WAT11 / pRS406M para construir WAT11 / pRS406M-HIS. Informações detalhadas sobre as cepas de leveduras construídas são apresentadas na Tabela 2.

Cepas e plasmídeos usados ​​neste estudo

Cepa ou plasmídeo Recursos relevantes
Cepas de levedura WAT11 MATα (leu2-3,112 trp1-1 can1-100 ura3-1 ade2-1 his3-11,15)
Transformantes de vetor integrativo
WAT11 / pRS406 WAT11 + pRS406
WAT11 / pRS406W WAT11 + pRS406W
WAT11 / pRS406M WAT11 + pRS406M
Transformantes de vetor episomal
WAT11 / pESC-HIS WAT11 + pRS406M + pESC-HIS
WAT11 / pRS406M-tHMG1 WAT11 + pRS406M + pESC-TDH3-tHMG1
WAT11 / pRS406M-mva WAT11 + pRS406M + pESC-TDH3-mva
Plasmídeos
pRS406W pRS406 TDH3-WCrtYB-CYC1, TDH3-WCrtI-CYC1
pRS406M pRS406 TDH3-MCrtYB-CYC1, TDH3-MCrtI-CYC1
pESC-TDH3-tHMG1 pESC-TDH3-tHMG1-CYC1
pESC-TDH3-mva pESC-TDH3-mva-CYC1
Cepa ou plasmídeo Recursos relevantes
Cepas de levedura WAT11 MATα (leu2-3,112 trp1-1 can1-100 ura3-1 ade2-1 his3-11,15)
Transformantes de vetor integrativo
WAT11 / pRS406 WAT11 + pRS406
WAT11 / pRS406W WAT11 + pRS406W
WAT11 / pRS406M WAT11 + pRS406M
Transformantes de vetor episomal
WAT11 / pESC-HIS WAT11 + pRS406M + pESC-HIS
WAT11 / pRS406M-tHMG1 WAT11 + pRS406M + pESC-TDH3-tHMG1
WAT11 / pRS406M-mva WAT11 + pRS406M + pESC-TDH3-mva
Plasmídeos
pRS406W pRS406 TDH3-WCrtYB-CYC1, TDH3-WCrtI-CYC1
pRS406M pRS406 TDH3-MCrtYB-CYC1, TDH3-MCrtI-CYC1
pESC-TDH3-tHMG1 pESC-TDH3-tHMG1-CYC1
pESC-TDH3-mva pESC-TDH3-mva-CYC1

Cepas e plasmídeos usados ​​neste estudo

Cepa ou plasmídeo Recursos relevantes
Cepas de levedura WAT11 MATα (leu2-3,112 trp1-1 can1-100 ura3-1 ade2-1 his3-11,15)
Transformantes de vetor integrativo
WAT11 / pRS406 WAT11 + pRS406
WAT11 / pRS406W WAT11 + pRS406W
WAT11 / pRS406M WAT11 + pRS406M
Transformantes de vetor episomal
WAT11 / pESC-HIS WAT11 + pRS406M + pESC-HIS
WAT11 / pRS406M-tHMG1 WAT11 + pRS406M + pESC-TDH3-tHMG1
WAT11 / pRS406M-mva WAT11 + pRS406M + pESC-TDH3-mva
Plasmídeos
pRS406W pRS406 TDH3-WCrtYB-CYC1, TDH3-WCrtI-CYC1
pRS406M pRS406 TDH3-MCrtYB-CYC1, TDH3-MCrtI-CYC1
pESC-TDH3-tHMG1 pESC-TDH3-tHMG1-CYC1
pESC-TDH3-mva pESC-TDH3-mva-CYC1
Cepa ou plasmídeo Recursos relevantes
Cepas de levedura WAT11 MATα (leu2-3,112 trp1-1 can1-100 ura3-1 ade2-1 his3-11,15)
Transformantes de vetor integrativo
WAT11 / pRS406 WAT11 + pRS406
WAT11 / pRS406W WAT11 + pRS406W
WAT11 / pRS406M WAT11 + pRS406M
Transformantes de vetor episomal
WAT11 / pESC-HIS WAT11 + pRS406M + pESC-HIS
WAT11 / pRS406M-tHMG1 WAT11 + pRS406M + pESC-TDH3-tHMG1
WAT11 / pRS406M-mva WAT11 + pRS406M + pESC-TDH3-mva
Plasmídeos
pRS406W pRS406 TDH3-WCrtYB-CYC1, TDH3-WCrtI-CYC1
pRS406M pRS406 TDH3-MCrtYB-CYC1, TDH3-MCrtI-CYC1
pESC-TDH3-tHMG1 pESC-TDH3-tHMG1-CYC1
pESC-TDH3-mva pESC-TDH3-mva-CYC1

As cepas de levedura foram cultivadas a 250 rpm e 30 ° C em um meio líquido de levedura apropriado. As cepas WAT11 / pRS406, WAT11 / pRS406W e WAT11 / pRS406M foram cultivadas em meio SD-URA (meio de eliminação de aminoácidos) e as cepas WAT11 / pRS406M-tHMG1, WAT11 / pRS406M-mvae WAT11 / pRS406M-HIS foram cultivados em meio SD-HIS-URA (meio de eliminação de aminoácidos). Para monitorar o crescimento da levedura, um único clone de cada uma das cepas de levedura foi inicialmente cultivado em 5 mL de meio de levedura a 30 ° C sob agitação constante até uma densidade óptica (medida a 600 nm OD600) de 0,6. As culturas de levedura foram então inoculadas em meio SD fresco na proporção de 1: 40. Posteriormente, 200 μL das amostras foram coletadas a 0, 6, 12, 24, 30, 36, 48, 60, 72, 96 e 120 h para medir OD600.

Extração e quantificação de beta-caroteno

As células de levedura cultivadas a 30 ° C por 72 h em 50 mL de meio de levedura foram sedimentadas por centrifugação a 3500 g por 5 min, lavado duas vezes com 0,9% (w / v) NaCl, e liofilizado (Lange & amp Steinbuchel, 2011). Aproximadamente 100 mg das células liofilizadas foram suspensas em 2 mL de acetona / 0,2% de pirogalol em metanol (w / v 80: 20, v / v) e 1 g de contas de vidro (diâmetro, 425-600 μm) foi adicionado. A mistura foi agitada por 3 min em um moedor de tecido de alto rendimento, e a fração de acetona-metanol foi coletada por centrifugação a 6000 g por 5 min. A extração foi repetida quatro a cinco vezes. As extrações orgânicas foram reunidas, evaporadas até à secura e redissolvidas em 1 mL de acetona para análise por HPLC. Para evitar a foto-oxidação, todos os procedimentos de extração foram realizados no escuro.

A análise de HPLC foi realizada em um instrumento LC-20AT equipado com uma bomba binária, um amostrador automático e um detector de matriz de fotodiodo (Shimadzu, Kyoto, Japão). Uma coluna de fase reversa Agilent HC-C18 (2) (4,6 × 250 mm, 5 μm) foi usada com acetonitrila / metanol (50: 50 v / v) como a fase móvel a uma taxa de fluxo de 1 mL min -1. A temperatura da coluna foi fixada em 25 ° C e o comprimento de onda de detecção foi de 450 nm. O beta-caroteno gerado a partir das culturas de levedura foi quantificado com base em uma curva de calibração padrão feita com beta-caroteno autêntico (Sigma Aldrich GmbH, China) de várias concentrações.


Biossíntese de carotenóides em leveduras - Biologia

Todos os artigos publicados pela MDPI são disponibilizados imediatamente em todo o mundo sob uma licença de acesso aberto. Nenhuma permissão especial é necessária para reutilizar todo ou parte do artigo publicado pela MDPI, incluindo figuras e tabelas. Para artigos publicados sob uma licença Creative Common CC BY de acesso aberto, qualquer parte do artigo pode ser reutilizada sem permissão, desde que o artigo original seja claramente citado.

Os artigos de destaque representam a pesquisa mais avançada com potencial significativo de alto impacto no campo. Artigos de destaque são submetidos a convite individual ou recomendação dos editores científicos e passam por revisão por pares antes da publicação.

O Artigo pode ser um artigo de pesquisa original, um estudo de pesquisa substancial que frequentemente envolve várias técnicas ou abordagens, ou um artigo de revisão abrangente com atualizações concisas e precisas sobre os últimos avanços no campo que revisa sistematicamente os avanços mais interessantes na área científica literatura. Este tipo de papel fornece uma perspectiva sobre as futuras direções de pesquisa ou possíveis aplicações.

Os artigos do Editor’s Choice são baseados nas recomendações dos editores científicos de periódicos MDPI de todo o mundo. Os editores selecionam um pequeno número de artigos publicados recentemente na revista que eles acreditam ser particularmente interessantes para os autores ou importantes neste campo. O objetivo é fornecer um instantâneo de alguns dos trabalhos mais interessantes publicados nas várias áreas de pesquisa da revista.


Artigo ORIGINAL RESEARCH

Jia Li 1 & # x2020, Jia Shen 1 & # x2020, Zhiqiang Sun 1, Jing Li 1, Changfu Li 1, Xiaohua Li 1,2 e Yansheng Zhang 1 *
  • 1 CAS Laboratório Chave de Melhoramento de Germoplasma Vegetal e Agricultura Especializada, Jardim Botânico de Wuhan, Academia Chinesa de Ciências, Wuhan, China
  • 2 Universidade da Academia Chinesa de Ciências, Pequim, China

& # x03B2-Caroteno é o precursor da vitamina A e também exibe múltiplas funções farmacêuticas por si só. Em comparação com a síntese química, a produção de & # x03B2-caroteno em micróbios por estratégia de engenharia metabólica é relativamente barata. Identificar genes que aumentam a produção de & # x03B2-caroteno em micróbios é importante para a engenharia de uma cepa de produção mais elevada de & # x03B2-caroteno. A maioria dos esforços anteriores na identificação de alvos gênicos se concentraram na via dos isoprenóides, onde a biossíntese de & # x03B2-caroteno pertence. No entanto, devido às complexas interações entre fluxos metabólicos, genes aparentemente irrelevantes que estão fora da via isoprenóide também podem afetar a biossíntese de & # x03B2-caroteno. Para este fim, fornecemos aqui um exemplo de que vários novos alvos de genes, que estão fora da via dos isoprenóides, têm efeitos de melhoria na síntese de & # x03B2-caroteno em células de levedura, quando foram superexpressos. Entre esses alvos, a proteína de classe E da via de classificação de proteína vacuolar (Did2) levou à maior melhoria nos rendimentos de & # x03B2-caroteno, que foi 2,1 vezes maior que o do controle correspondente. Esta melhoria foi ainda explicada pela observação de que a superexpressão do DID2 gene geralmente aumenta as transcrições dos genes da via do & # x03B2-caroteno. O mecanismo pelo qual os outros alvos melhoram a produção de & # x03B2-caroteno é discutido.


Genética e biologia molecular da biossíntese de pigmentos carotenóides

Para quem as solicitações de correspondência e reimpressão devem ser enviadas, em: Instituto de Ciências Vegetais, Genética de Plantas, Instituto Federal Suíço de Tecnologia (ETH), CH-8092 Zürich, Suíça. Pesquise mais artigos deste autor

Departamento de Química, Universidade da Califórnia, Divisão de Biologia Estrutural, Laboratório Lawrence Berkeley, Berkeley, Califórnia, 94720 EUA

Instituto de Ciências Vegetais, Genética Vegetal, Instituto Federal Suíço de Tecnologia, CH-8092 Zurique, Suíça

Para quem as solicitações de correspondência e reimpressão devem ser enviadas, em: Instituto de Ciências Vegetais, Genética de Plantas, Instituto Federal Suíço de Tecnologia (ETH), CH-8092 Zürich, Suíça. Pesquise mais artigos deste autor

Departamento de Química, Universidade da Califórnia, Divisão de Biologia Estrutural, Laboratório Lawrence Berkeley, Berkeley, Califórnia, 94720 EUA

Resumo

Os papéis cruciais dos carotenóides e seus metabólitos na proteção fotooxidativa e fotossíntese, sem falar na nutrição, visão e diferenciação celular, os tornam uma classe importante e complexa de pigmentos biológicos. Avanços significativos nos últimos anos aumentaram nossa compreensão da genética e da biologia molecular da biossíntese de carotenóides em bactérias, fungos, algas e plantas. Todos os genes envolvidos na biossíntese de carotenóides a partir de Rhodobacter capsulatus, uma bactéria fotossintética anoxigênica e de várias espécies de Erwinia, bactérias não fotossintéticas, foram caracterizadas molecularmente. Estudos recentes revelaram que duas enzimas precoces da biossíntese de carotenóides, geranilgeranil pirofosfato sintase e fitoeno sintase, estão estrutural e funcionalmente relacionadas em todos os organismos carotenogênicos. Em contraste, a conversão subsequente de fitoeno, o primeiro C40 carotenóide, para β-caroteno requer duas dessaturases e uma ciclase em organismos fotossintéticos oxigenados (cianobactérias, algas e plantas superiores), mas apenas uma dessaturase estruturalmente distinta e uma ciclase estruturalmente distinta em outras bactérias carotenogênicas e em fungos. Os estudos das enzimas que introduzem grupos funcionais contendo oxigênio nos carotenos para produzir xantofilas, a grande maioria de todos os carotenóides, ainda estão em sua infância. Esta revisão resume os desenvolvimentos mais recentes na biossíntese de carotenóides de um ponto de vista da genética molecular. - Armstrong, G. A., Hearst, J. E. Genetics and molecular biology of carotenoid pigment biosynthesis. FASEB J. 10, 228-237 (1996)


Agradecemos aos membros do nosso laboratório e aos drs. Foen Peng, Pam Diggle, Jeff Seemann e Qinlong Zhu para discussões.

Alba, R., Payton, P., Fei, Z., McQuinn, R., Debbie, P., Martin, G. B., et al. (2005). As análises de transcriptoma e metabólitos selecionados revelam múltiplos pontos de controle do etileno durante o desenvolvimento do tomate. Célula vegetal 17 (11), 2954 e # x20132965. doi: 10.1105 / tpc.105.036053

Alder, A., Jamil, M., Marzorati, M., Bruno, M., Vermathen, M., Bigler, P., et al. (2012). O caminho do & # x3b2-caroteno para a carlactona, um hormônio vegetal semelhante à estrigolactona. Ciência 335 (6074), 1348. doi: 10.1126 / science.1218094

Amiour, N., Imbaud, S., Cl & # xe9ment, G., Agier, N., Zivy, M., Valot, B., et al. (2012). O uso de metabolômica integrada com estudos transcriptômicos e proteômicos para identificar as etapas principais envolvidas no controle do metabolismo do nitrogênio em culturas como o milho. J. Exp. Robô. 63 (14), 5017 e # x20135033. doi: 10.1093 / jxb / ers186

Ampomah-Dwamena, C., Thrimawithana, A. H., Dejnoprat, S., Lewis, D., Espley, R. V., Allan, A. C. (2019). Um kiwi (Actinidia deliciosa) O fator de transcrição R2R3-MYB modula o acúmulo de clorofila e carotenóide. New Phytol. 221 (1), 309 e # x2013325. doi: 10.1111 / nph.15362

Andersson, A., Keskitalo, J., Sj & # xf6din, A., Bhalerao, R., Sterky, F., Wissel, K., et al. (2004). Um cronograma transcricional da senescência no outono. Genome Biol. 5 (4), R24. doi: 10.1186 / gb-2004-5-4-r24

Andrade, P., Caudep & # xf3n, D., Altabella, T., Arr & # xf3, M., Ferrer, A., Manzano, D. (2017). Interações complexas entre fitoesteróis e desenvolvimento de plastídios. Plant Signal Behav. 12 (11), e1387708. doi: 10.1080 / 15592324.2017.1387708

Arango, J., W & # xfcst, F., Beyer, P., Welsch, R. (2010). Caracterização das fitoeno-sintases da mandioca e seu envolvimento nas respostas abióticas mediadas pelo estresse. Planta 232 (5), 1251 e # x20131262. doi: 10.1007 / s00425-010-1250-6

Arango, J., Beltr & # xe1n, J., Nu & # xf1ez, J., Chavarriaga, P. (2016). & # x201c Evidência de mecanismos epigenéticos que afetam os carotenóides, & # x201d em Carotenóides na Natureza (Cham, Suíça: Springer) 295 & # x2013307.

Audran, C., Borel, C., Frey, A., Sotta, B., Meyer, C., Simonneau, T., et al. (1998). Estudos de expressão do gene zeaxantina epoxidase em Nicotiana plumbaginifolia. J. Plant Physiol. 118 (3), 1021 e # x20131028. doi: 10.1104 / pp.118.3.1021

Audran, C., Liotenberg, S., Gonneau, M., North, H., Frey, A., Tap-Waksman, K., et al. (2001). Localização e expressão do mRNA da zeaxantina epoxidase em Arabidopsis em resposta ao estresse hídrico e durante o desenvolvimento da semente. Funct. Plant Biol. 28 (12), 1161 e # x20131173.

Auldridge, M. E., McCarty, D. R., Klee, H. J. (2006). Oxigenases de clivagem de carotenóides de plantas e seus produtos apocarotenóides. Curr. Opin. Plant Biol. 9 (3), 315 e # x2013321. doi: 10.1016 / j.pbi.2006.03.005

Avenda & # xf1o-V & # xe1zquez, A., Cordoba, E., Llamas, E., San Rom & # xe1n, C., Nisar, N., Torre, D. L., et al. (2014). Um sinal derivado de apocarotenóide não caracterizado gerado em mutantes & # x3b6-caroteno dessaturase regula o desenvolvimento da folha e a expressão de cloroplasto e genes nucleares em Arabidopsis. Célula vegetal 26 (6), 2524 e # x20132537. doi: 10.1105 / tpc.114.123349

Bae, G., Choi, G. (2008). Decodificação de sinais de luz por fitocromos de plantas e suas proteínas de interação. Annu. Rev. Plant Biol. 59 (1), 281 e # x2013311. doi: 10.1146 / annurev.arplant.59.032607.092859

Balazadeh, S., Schildhauer, J., Ara & # xfajo, W. L., Munn & # xe9-Bosch, S., Fernie, A. R., Proost, S., et al. (2014). Reversão da senescência pelo reabastecimento de N para famintos por N Arabidopsis thaliana: consequências transcriptômicas e metabolômicas. J. Exp. Robô. 65 (14), 3975 e # x20133992. doi: 10.1093 / jxb / eru119

Baroli, I., Niyogi, K. K. (2000). Genética molecular da fotoproteção dependente de xantofila em algas verdes e plantas. Philos. Trans. R. Soc. Lond., B, Biol. Sci. 355 (1402), 1385 e # x20131394. doi: 10.1098 / rstb.2000.0700

Bartley, G. E., Scolnik, P. A. (1995). Carotenóides vegetais: pigmentos para fotoproteção, atração visual e saúde humana. Célula vegetal 7 (7), 1027 e # x20131038. doi: 10.1105 / tpc.7.7.1027

Bemer, M., Karlova, R., Ballester, A. R., Tikunov, Y. M., Bovy, A. G., Wolters-Arts, M., et al. (2012). Os homólogos do tomate FRUITFULL TDR4 / FUL1 e MBP7 / FUL2 regulam os aspectos independentes do etileno do amadurecimento dos frutos. Célula vegetal 24 (11), 4437 e # x20134451. doi: 10.1105 / tpc.112.103283

Biswal, B. (1995). Catabolismo carotenóide durante a senescência foliar e seu controle pela luz. J. Photochem. Photobiol. B, Biol. 30 (1), 3 e # x201313. doi: 10.1016 / 1011-1344 (95) 07197-A

Blanchette, M., Tompa, M. (2002). Descoberta de elementos regulatórios por um método computacional para pegada filogenética. Genome Res. 12 (5), 739 e # x2013748. doi: 10.1101 / gr.6902

Bou-Torrent, J., Toledo-Ortiz, G., Ortiz-Alcaide, M., Cifuentes-Esquivel, N., Halliday, K. J., Martinez-Garc & # xeda, J., et al. (2015). A regulação da biossíntese de carotenóides por sombra depende de subconjuntos específicos de fatores de transcrição e cofatores antagônicos. J. Plant Physiol. 169 (3), 1584. doi: 10,1104 / pp.15,00552

Bradshaw, H., Jr., Schemske, D. W. (2003). A substituição de alelos em um locus de cor de flor produz uma mudança no polinizador em macacosflores. Natureza 426 (6963), 176. doi: 10.1038 / nature02106

Breeze, E., Harrison, E., Mchattie, S., Hughes, L., Hickman, R., Hill, C., et al. (2011). Perfil temporal de alta resolução de transcrições durante Arabidopsis a senescência foliar revela uma cronologia distinta de processos e regulação. Célula vegetal 23 (3), 873 e # x2013894. doi: 10.1105 / tpc.111.083345

Britton, G., Young, A. J. (1989). & # x201cCarotenóides do cloroplasto: função, biossíntese e efeitos do estresse e senescência, & # x201d em Tendências na pesquisa de fotossíntese. Eds. Biswal, U. C., Britton, G. (India: Agro Botanical Publishers), 303 & # x2013319.

Brown, B.A., Cloix, C., Jiang, G.H., Kaiserli, E., Herzyk, P., Kliebenstein, D.J., et al. (2005). Um componente de sinalização específico UV-B & # x2013 orquestra a proteção UV da planta. Proc Natl Acad Sci 102 (50), 18225 e # x201318230. doi: 10.1073 / pnas.0507187102

Brown, B. A., Jenkins, G. I. (2008). Vias de sinalização UV-B com diferentes perfis de resposta de taxa de fluência são diferenciadas em adultos Arabidopsis tecido foliar por exigência de UVR8, HY5 e HYH. J. Plant Physiol. 146 (2), 576 e # x2013588. doi: 10.1104 / pp.107.108456

Catal & # xe1, R., Medina, J., Salinas, J. (2011). Integração de baixa temperatura e sinalização de luz durante a resposta de aclimatação ao frio em Arabidopsis. Proc. Natl. Acad. Sci. EUA. 108 (39), 16475. doi: 10.1073 / pnas.1107161108

Cavill, R., Jennen, D., Kleinjans, J., Bried & # xe9, J. J. (2016). Integração de dados transcriptômicos e metabolômicos. Apresentação. Bioinformática 17 (5), 891 e # x2013901. doi: 10.1093 / bib / bbv090

Cazzonelli, C. I., Cuttriss, A. J., Cossetto, S. B., Pye, W., Crisp, P., Whelan, J., et al. (2009). Regulação da composição de carotenóides e ramificação do caule em Arabidopsis por uma histona metiltransferase modificadora da cromatina, SDG8. Célula vegetal 21 (1), 39 e # x201353. doi: 10.1105 / tpc.108.063131

Cazzonelli, C. I., Pogson, B. J. (2010). Fonte para sumidouro: regulação da biossíntese de carotenóides nas plantas. Trends Plant Sci. 15 (5), 266 e # x2013274. doi: 10.1016 / j.tplants.2010.02.003

Cheminant, S., Wild, M., Bouvier, F., Pelletier, S., Renou, J., Erhardt, M., et al. (2011). DELLAs regulam a biossíntese de clorofila e carotenóide para prevenir danos fotooxidativos durante a desetiolação de mudas em Arabidopsis. Célula vegetal 23 (5), 1849. doi: 10.1105 / tpc.111.085233

Chiou, C., Pan, H., Chuang, Y., Yeh, K. (2010). A expressão diferencial de genes relacionados a carotenóides determina a coloração diversificada de carotenóides em tecidos florais de Oncidium cultivares. Planta 232 (4), 937 e # x2013948. doi: 10.1007 / s00425-010-1222-x

Chung, M., Vrebalov, J., Alba, R., Lee, J., McQuinn, R., Chung, J., et al. (2010). Um tomate (Solanum lycopersicum) O gene APETALA2 / ERF, SlAP2a, é um regulador negativo do amadurecimento dos frutos. Plant J. 64 (6), 936 e # x2013947. doi: 10.1111 / j.1365-313X.2010.04384.x

Cloix, C., Jenkins, G. I. (2008). Interação do componente de sinalização específico UVR8 da Arabidopsis UV-B & # x2013 com cromatina. Mol. Plantar 1 (1), 118 e # x2013128. doi: 10.1093 / mp / ssm012

Clotault, J., Peltier, D., Berruyer, R., Thomas, M., Briard, M., Geoffriau, E. (2008). Expressão de genes de biossíntese de carotenóides durante o desenvolvimento da raiz da cenoura. J. Exp. Robô. 59 (13), 3563 e # x20133573. doi: 10.1093 / jxb / ern210

Corona, V., Aracri, B., Kosturkova, G., Bartley, G. E., Pitto, L., Giorgetti, L., et al. (1996). Regulação de um promotor do gene da biossíntese de carotenóides durante o desenvolvimento da planta. Plant J. 9 (4), 505 e # x2013512.

Cutler, S. R., Rodriguez, P. L., Finkelstein, R. R., Abrams, S. R. (2010). Ácido abscísico: emergência de uma rede central de sinalização. Annu. Rev. Plant Biol. 61, 651 e # x2013679. doi: 10.1146 / annurev-arplant-042809-112122

D & # x2019Andrea, L., Simon-Moya, M., Llorente, B., Llamas, E., Marro, M., Loza-Alvarez, P., et al. (2018). A interferência com a protease clp prejudica o acúmulo de carotenóides durante o amadurecimento do tomate. J. Exp. Robô. 69 (7), 1557 e # x20131568. doi: 10.1093 / jxb / erx491

Dalal, M., Chinnusamy, V., Bansal, K. C. (2010). Isolamento e caracterização funcional do promotor licopeno & # x3b2-ciclase (CYC-B) de Solanum habrochaites. BMC Plant Biol. 10 (1), 61. doi: 10.1186 / 1471-2229-10-61

Dall & # x2019Osto, L., Cazzaniga, S., North, H., Marion-Poll, A., Bassi, R. (2007). o Arabidopsis O mutante aba4-1 revela uma função específica da neoxantina na proteção contra o estresse fotooxidativo. Célula vegetal 19 (3), 1048. doi: 10.1105 / tpc.106.049114

Dall & # x2019Osto, L., Holt, N. E., Kaligotla, S., Fuciman, M., Cazzaniga, S., Carbonera, D., et al. (2012). A zeaxantina protege a fotossíntese das plantas modulando o rendimento de tripletos de clorofila em subunidades específicas da antena de coleta de luz. J. Biol. Chem. 287 (50), 41820 e # x201341834. doi: 10.1074 / jbc.M112.405498

Delker, C., Sonntag, L., James, G., Janitza, P., Iba & # xf1ez, C., Ziermann, H., et al. (2014). A via DET1 & # x2013COP1 & # x2013HY5 constitui um módulo de sinalização multifuncional que regula a fotomorfogênese e termomorfogênese da planta. Cell Rep. 9 (6), 1983 & # x20131989. doi: 10.1016 / j.celrep.2014.11.043

Demmig-Adams, B., Adams, W. W., III (1996). O papel dos carotenóides do ciclo da xantofila na proteção da fotossíntese. Trends Plant Sci. 1 (1), 21 e # x201326. doi: 10.1016 / S1360-1385 (96) 80019-7

Dong, J., Tang, D., Gao, Z., Yu, R., Li, K., He, H., et al. (2014). Arabidopsis DE-ETIOLADO1 reprime a fotomorfogênese regulando positivamente os fatores que interagem com o fitocromo no escuro. Célula vegetal 26 (9), 3630. doi: 10.1105 / tpc.114.130666

Dong, T., Hu, Z., Deng, L., Wang, Y., Zhu, M., Zhang, J., et al. (2013). Um fator de transcrição da caixa MADS do tomate, SlMADS1, atua como um regulador negativo do amadurecimento da fruta. J. Plant Physiol. 163 (2), 1026 e # x20131036. doi: 10.1104 / pp.113.224436

Dudareva, N., Negre, F., Nagegowda, D. A., Orlova, I. (2006). Voláteis de plantas: avanços recentes e perspectivas futuras. Crit. Rev. Plant Sci. 25 (5), 417 e # x2013440. doi: 10.1080 / 07352680600899973

Emiliani, J., D & # x2019Andrea, L., Ferreyra, M. L. F., Mauli & # xf3n, E., Rodriguez, E., Rodriguez-Concepci & # xf3n, M., et al. (2018). Uma função para & # x3b2, & # x3b2-xantofilas em Arabidopsis Fotoproteção UV-B. J. Exp. Robô. 69 (20), 4921 e # x20134933. doi: 10.1093 / jxb / ery242

Enfissi, E. M. A., Nogueira, M., Bramley, P. M., Fraser, P. D. (2017). A regulação da formação de carotenóides em tomateiros. Plant J. 89 (4), 774 e # x2013788. doi: 10.1111 / tpj.13428

Eriksson, E. M., Bovy, A., Manning, K., Harrison, L., Andrews, J., De Silva, J., et al. (2004). Efeito da mutação incolor de não amadurecimento na bioquímica da parede celular e na expressão gênica durante o desenvolvimento e amadurecimento do tomate. J. Plant Physiol. 136 (4), 4184 e # x20134197. doi: 10.1104 / pp.104.045765

Favory, J. J., Stec, A., Gruber, H., Rizzini, L., Oravecz, A., Funk, M., et al. (2009). A interação de COP1 e UVR8 regula a fotomorfogênese induzida por UV-B & # x2013 e aclimatação ao estresse em Arabidopsis. EMBO J. 28 (5), 591 e # x2013601. doi: 10.1038 / emboj.2009.4

Frank, H. A., Cogdell, R. J. (1996). Carotenóides na fotossíntese. Photochem. Photobiol. 63 (3), 257 e # x2013264. doi: 10.1111 / j.1751-1097.1996.tb03022.x

Fraser, P. D., Truesdale, M. R., Bird, C. R., Schuch, W., Bramley, P. M. (1994). Biossíntese de carotenóides durante o desenvolvimento do tomate (evidência de expressão gênica específica para tecidos). J. Plant Physiol. 105 (1), 405 e # x2013413. doi: 10.1104 / pp.105.1.405

Fu, C., Han, Y., Fan, Z., Chen, J., Chen, W., Lu, W., et al. (2016). O fator de transcrição CpNAC1 do mamão modula a biossíntese de carotenóides por meio da ativação dos genes CpPDS2 / 4 da fitoeno-dessaturase durante o amadurecimento dos frutos. J. Agric. Food Chem. 64 (27), 5454 e # x20135463. doi: 10.1021 / acs.jafc.6b01020

Fu, C., Han, Y., Kuang, J., Chen, J., Lu, W. (2017). CpEIN3a e CpNAC2 de mamão regulam cooperativamente os genes relacionados à biossíntese de carotenóides CpPDS2 / 4, CpLCY-e e CpCHY-b durante o amadurecimento dos frutos. Plant Cell Physiol. 58 (12), 2155 e # x20132165. doi: 10.1093 / pcp / pcx149

Fuentes, P., Pizarro, L., Moreno, J.C., Handford, M., Rodriguez-Concepcion, M., Stange, C. (2012). Mudanças na diferenciação de plastídios dependentes de luz influenciam a expressão e o acúmulo de genes de carotenóides nas raízes da cenoura. Plant Mol. Biol. 79 (1 e # x20132), 47 e # x201359. doi: 10.1007 / s11103-012-9893-2

Fujisawa, M., Nakano, T., Ito, Y. (2011). Identificação de genes-alvo potenciais para o regulador do amadurecimento do tomate, RIN, por imunoprecipitação da cromatina. BMC Plant Biol. 11 (1), 26. doi: 10.1186 / 1471-2229-11-26

Fujisawa, M., Shima, Y., Higuchi, N., Nakano, T., Koyama, Y., Kasumi, T., et al. (2012). Alvos diretos do regulador de maturação de tomate RIN identificados por transcriptoma e análises de imunoprecipitação da cromatina. Planta 235 (6), 1107 e # x20131122. doi: 10.1007 / s00425-011-1561-2

Fujisawa, M., Nakano, T., Shima, Y., Ito, Y. (2013). Uma identificação em grande escala de alvos diretos do INIBIDOR DE MATURAMENTO do fator de transcrição da caixa MADS do tomate revela a regulação do amadurecimento dos frutos. Célula vegetal 25 (2), 371 e # x2013386. doi: 10.1105 / tpc.112.108118

Fujisawa, M., Shima, Y., Nakagawa, H., Kitagawa, M., Kimbara, J., Nakano, T., et al. (2014). Regulação da transcrição do amadurecimento de frutas por homólogos FRUITFULL de tomate e proteínas box MADS associadas. Célula vegetal 26 (1), 89 e # x2013101. doi: 10.1105 / tpc.113.119453

Galpaz, N., Ronen, G., Khalfa, Z., Zamir, D., Hirschberg, J. (2006). Uma via de biossíntese de carotenóides específica do cromoplasto é revelada pela clonagem do locus da flor branca do tomate. Célula vegetal 18 (8), 1947 e # x20131960. doi: 10.1105 / tpc.105.039966

Gan, S., Amasino, R. M. (1997). Fazendo sentido da senescência (regulação genética molecular e manipulação da senescência foliar). J. Plant Physiol. 113 (2), 313. doi: 10.1104 / pp.113.2.313

Gandikota, M., Birkenbihl, R. P., H & # xf6hmann, S., Cardon, G. H., Saedler, H., Huijser, P. (2007). O elemento de reconhecimento miRNA156 / 157 na UTR 3 & # x2032 do Arabidopsis O gene da caixa SBP SPL3 impede o florescimento precoce por meio da inibição da tradução em mudas. Plant J. 49 (4), 683 e # x2013693. doi: 10.1111 / j.1365-313X.2006.02983.x

Gim & # xe9nez, E., Pineda, B., Capel, J., Ant & # xf3n, M. T., Atar & # xe9s, A., P & # xe9rez-Mart & # xedn, F., et al. (2010). A análise funcional do mutante Arlequin corrobora o papel essencial do gene Arlequin / TAGL1 durante o desenvolvimento reprodutivo do tomate. PLoS One 5 (12), e14427. doi: 10.1371 / journal.pone.0014427

Giovannoni, J. J. (2007). Mutantes de amadurecimento de frutas fornecem informações sobre o controle de amadurecimento. Curr. Opiniões Plant Biol. 10 (3), 283 e # x2013289. doi: 10.1016 / j.pbi.2007.04.008

Giovannoni, J., Nguyen, C., Ampofo, B., Zhong, S., Fei, Z. (2017). O epigenoma e a dinâmica transcricional do amadurecimento dos frutos. Annu. Rev. Plant Biol. 68, 61 e # x201384.

Giuliano, G., Bartley, G. E., Scolnik, P. A. (1993). Regulação da biossíntese de carotenóides durante o desenvolvimento do tomate. Célula vegetal 5 (4), 379 e # x2013387. doi: 10.1105 / tpc.5.4.379

Goodwin, T., Britton, G. W. (1988). & # x201cDistribuição e análise de carotenóides, & # x201d em Pigmentos de Plantas. Ed. Goodwin, T. W. (London: Academic Press), 62 & # x2013132.

Grassi, S., Piro, G., Lee, J.M., Zheng, Y., Fei, Z., Dalessandro, G., et al. (2013). A genômica comparativa revela candidatos a reguladores da via dos carotenóides do amadurecimento de frutos de melancia. BMC Genomics 14 (1), 781. doi: 10.1186 / 1471-2164-14-781

Guo, J., Hu, Z., Yu, X., Li, A., Li, F., Wang, Y., et al. (2018). Um gene da histona desacetilase, SlHDA3, atua como um regulador negativo do amadurecimento da fruta e do acúmulo de carotenóides. Plant Cell Rep. 37 (1), 125 e # x2013135. doi: 10.1007 / s00299-017-2211-3

Ha, S., Kim, J., Park, J., Lee, S., Cho, K. (2007). Uma comparação do acúmulo de carotenóides em variedades de pimentão que apresentam diferentes cores de amadurecimento: a deleção do gene da capsantina & # x2013capsorubina sintase não é um pré-requisito para a formação de um pimentão amarelo. J. Exp. Robô. 58 (12), 3135 e # x20133144. doi: 10.1093 / jxb / erm132

Hao, Y., Hu, G., Breitel, D., Liu, M., Mila, I., Frasse, P., et al. (2015). O fator de resposta da auxina SlARF2 é um componente essencial do mecanismo regulador que controla o amadurecimento do tomate. PLoS Genetics 11 (12), e1005649. doi: 10.1371 / journal.pgen.1005649

Hashimoto, H., Uragami, C., Cogdell, R. J. (2016). & # x201cCarotenóides e fotossíntese, & # x201d em Carotenóides na Natureza (Cham, Suíça: Springer), 111 & # x2013139.

Havaux, M. (1998). Carotenóides como estabilizadores de membrana em cloroplastos. Trends Plant Sci. 3 (4), 147 e # x2013151. doi: 10.1016 / S1360-1385 (98) 01200-X

Helmy, M., Crits-Christoph, A., Bader, G. D. (2016). Dez regras simples para o desenvolvimento de bancos de dados biológicos públicos. PLoS Comput. Biol. 12 (11), e1005128. doi: 10.1371 / journal.pcbi.1005128

Higo, K., Ugawa, Y., Iwamoto, M., Korenaga, T. (1999). Banco de dados de elementos reguladores de DNA de ação cis da planta (PLACE): 1999. Nucleic Acids Res. 27 (1), 297 e # x2013300. doi: 10.1093 / nar / 27.1.297

Hirschberg, J. (2001).Biossíntese de carotenóides em plantas com flores. Curr. Opiniões Plant Biol. 4 (3), 210 e # x2013218. doi: 10.1016 / S1369-5266 (00) 00163-1

Hou, X., Rivers, J., Le & # xf3n, P., McQuinn, R. P., Pogson, B. J. (2016). Síntese e função de sinais de apocarotenóides em plantas. Trends Plant Sci. 21 (9), 792 e # x2013803. doi: 10.1016 / j.tplants.2016.06.001

Howitt, C. A., Pogson, B. J. (2006). Acúmulo e função de carotenóides em sementes e tecidos não verdes. Plant Cell Environ. 29 (3), 435 e # x2013445. doi: 10.1111 / j.1365-3040.2005.01492.x

Itkin, M., Seybold, H., Breitel, D., Rogachev, I., Meir, S., Aharoni, A. (2009). TOMATO AGAMOUS-LIKE 1 é um componente da rede reguladora do amadurecimento de frutas. Plant J. 60 (6), 1081 e # x20131095. doi: 10.1111 / j.1365-313X.2009.04064.x

Ito, Y., Kitagawa, M., Ihashi, N., Yabe, K., Kimbara, J., Yasuda, J., et al. (2008). Especificidade de ligação ao DNA, potencial de ativação transcricional e o efeito da mutação rin para o regulador de amadurecimento de frutos de tomate, RIN. Plant J. 55 (2), 212 e # x2013223. doi: 10.1111 / j.1365-313X.2008.03491.x

Jahns, P., Holzwarth, A. R. (2012). O papel do ciclo da xantofila e da luteína na fotoproteção do fotossistema II. BBA-Bioenergética 1817 (1), 182 e # x2013193. doi: 10.1016 / j.bbabio.2011.04.012

Jia, K., Baz, L., Al-Babili, S. (2017). De carotenóides a estrigolactonas. J. Exp. Robô. 69 (9), 2189 e # x20132204. doi: 10.1093 / jxb / erx476

Jiao, Y., Lau, O. S., Deng, X. W. (2007). Redes de transcrição reguladas por luz em plantas superiores. Nat. Rev. Genet. 8 (3), 217. doi: 10.1038 / nrg2049

Jin, X., Bai, C., Bassie, L., Nogareda, C., Romagosa, I., Twyman, R. M., et al. (2019). Os fatores de transcrição ZmPBF e ZmGAMYB transativam independentemente o promotor do milho (Zea mays) & # x3b2-caroteno hidroxilase 2 gene. New Phytol. 222 (2), 793 e # x2013804. doi: 10.1111 / nph.15614

Karlova, R., Rosin, F. M., Busscher-Lange, J., Parapunova, V., Do, P. T., Fernie, A. R., et al. (2011). O perfil do transcriptoma e do metabólito mostra que APETALA2a é um importante regulador do amadurecimento do tomate. Célula vegetal 23 (3), 923 e # x2013941. doi: 10.1105 / tpc.110.081273

Kim, D. H., Yamaguchi, S., Lim, S., Oh, E., Park, J., Hanada, A., et al. (2008). SOMNUS, uma proteína dedo de zinco do tipo CCCH em Arabidopsis, regula negativamente a germinação de sementes dependente de luz a jusante de PIL5. Célula vegetal 20 (5), 1260 e # x20131277. doi: 10.1105 / tpc.108.058859

Kim, J., Kang, H., Park, J., Kim, W., Yoo, J., Lee, N., et al. (2016). Fatores de transcrição que interagem com PIF1 e seus elementos de sequência de ligação determinam o na Vivo sites de segmentação de PIF1. Célula vegetal 28 (6), 1388 e # x20131405. doi: 10.1105 / tpc.16.00125

Kishimoto, S., Oda-Yamamizo, C., Ohmiya, A. (2018). Regulação da pigmentação carotenóide em corolas de petúnia. Plant Mol. Biol. Rep. 36 (4), 632 e # x2013642. doi: 10.1007 / s11105-018-1107-x

Klee, H. J., Giovannoni, J. J. (2011). Genética e controle do amadurecimento e atributos de qualidade do tomate. Annu. Rev. Genet. 45 (1), 41 e # x201359. doi: 10.1146 / annurev-genet-110410-132507

Kolotilin, I., Koltai, H., Tadmor, Y., Bar-Or, C., Reuveni, M., Meir, A., et al. (2007). O perfil transcricional do mutante de tomate com alto pigmento-2 dg liga a biogênese inicial dos plastídios da fruta com sua superprodução de fitonutrientes. J. Plant Physiol. 145 (2), 389 e # x2013401. doi: 10.1104 / pp.107.102962

Kramer, E. M. (2015). Um estranho em uma terra estranha: a utilidade e a interpretação da expressão heteróloga. Frente. Plant Sci. 6, 734. doi: 10.3389 / fpls.2015.00734

Lau, O. S., Deng, X. W. (2012). Os repressores fotomorfogênicos COP1 e DET1: 20 anos depois. Trends Plant Sci. 17 (10), 584 e # x2013593. doi: 10.1016 / j.tplants.2012.05.004

Larsen, P.E., Sreedasyam, A., Trivedi, G., Desai, S., Dai, Y., Cseke, L.J., et al. (2016). Abordagem multi-omics identifica mecanismos moleculares de interação micorrízica planta & # x2013fungus. Frente. Plant Sci. 6, 1061. doi: 10.3389 / fpls.2015.01061

Lescot, M., D & # xe9hais, P., Thijs, G., Marchal, K., Moreau, Y., de Peer, Y., et al. (2002). PlantCARE, um banco de dados de elementos regulatórios de ação cis da planta e um portal para ferramentas para análise in silico de sequências de promotores. Nucleic Acids Res. 30 (1), 325 & # x2013327. doi: 10.1093 / nar / 30.1.325

Levin, I., Frankel, P., Gilboa, N., Tanny, S., Lalazar, A. (2003). A mutação verde escura do tomate é um novo alelo do homólogo do tomate do gene DEETIOLATED1. Theor. Appl. Genet. 106 (3), 454 e # x2013460. doi: 10.1007 / s00122-002-1080-4

Li, F., Vallabhaneni, R., Yu, J., Rocheford, T., Wurtzel, E. T. (2008a). A família de genes da fitoeno-sintase do milho: papéis sobrepostos para a carotenogênese no endosperma, fotomorfogênese e tolerância ao estresse térmico. J. Plant Physiol. 147 (3), 1334 e # x20131346. doi: 10.1104 / pp.108.122119

Li, F., Vallabhaneni, R., Wurtzel, E. T. (2008b). PSY3, um novo membro da família do gene da fitoeno sintase conservado nas Poaceae e regulador da carotenogênese da raiz induzida pelo estresse abiótico. J. Plant Physiol. 146 (3), 1333 e # x20131345. doi: 10.1104 / pp.107.111120

Li, L., Yuan, H., Zeng, Y., Xu, Q. (2016). & # x201cPlastídeos e acumulação de carotenóides, & # x201d em Carotenóides na Natureza (Cham, Suíça: Springer), 273 & # x2013293.

Li, S., Chen, K., Grierson, D. (2019). Uma avaliação crítica do papel dos fatores de transcrição de etileno e MADS na rede de controle do amadurecimento de frutos carnosos. New Phytol. 221 (4), 1724 e # x20131741. doi: 10.1111 / nph.15545

Lieberman, M., Segev, O., Gilboa, N., Lalazar, A., Levin, I. (2004). O homólogo de tomate do gene que codifica a proteína 1 de ligação ao DNA danificada por UV (DDB1) sublinhado como o gene que causa o fenótipo mutante de pigmento-1 alto. Theor. Appl. Genet. 108 (8), 1574 e # x20131581. doi: 10.1007 / s00122-004-1584-1

Lim, P. O., Kim, H. J., Gil Nam, H. (2007). Senescência foliar. Annu. Rev. Plant Biol. 58, 115 e # x2013136. doi: 10.1146 / annurev.arplant.57.032905.105316

Lin, Z., Hong, Y., Yin, M., Li, C., Zhang, K., Grierson, D. (2008). Uma proteína homeobox HD-Zip de tomate, LeHB-1, desempenha um papel importante na organogênese floral e no amadurecimento. Plant J. 55 (2), 301 e # x2013310. doi: 10.1111 / j.1365-313X.2008.03505.x

Liu, G., Ren, G., Guirgis, A., Thornburg, R. W. (2009). O fator de transcrição MYB305 regula a expressão de genes da nectarina no nectário floral do tabaco ornamental. Célula vegetal 21 (9), 2672 & # x20132687. doi: 10.1105 / tpc.108.060079

Liu, L., Jia, C., Zhang, M., Chen, D., Chen, S., Guo, R., et al. (2014). A expressão ectópica de um fator de transcrição BZR1-1D na sinalização de brassinosteróides aumenta o acúmulo de carotenóides e os atributos de qualidade do fruto em tomate. Plant Biotechnol. J. 12 (1), 105 e # x2013115. doi: 10.1111 / pbi.12121

Liu, L., Wei, J., Zhang, M., Zhang, L., Li, C., Wang, Q. (2012). Indução independente de etileno da biossíntese de licopeno em frutos de tomate por jasmonatos. J. Exp. Robô. 63 (16), 5751 e # x20135761. doi: 10.1093 / jxb / ers224

Liu, L., Shao, Z., Zhang, M., Wang, Q. (2015a). Regulação do metabolismo de carotenóides em tomate. Mol. Plantar 8 (1), 28 e # x201339. doi: 10.1016 / j.molp.2014.11.006

Liu, M., Pirrello, J., Chervin, C., Roustan, J., Bouzayen, M. (2015b). Controle do etileno no amadurecimento de frutas: revisitando a complexa rede de regulação transcricional. J. Plant Physiol. 169 (4), 2380. doi: 10.1104 / pp.15.01361

Liu, X., Zhang, Y., Chen, Y., Li, M., Zhou, F., Li, K., et al. (2017). Captura in situ de interações da cromatina por dCas9 biotinilado. Célula 170 (5), 1028 e # x20131043. doi: 10.1016 / j.cell.2017.08.003

Llorente, B., D & # x2019andrea, L., Ruiz-Sola, M.A., Botterweg, E., Pulido, P., Andilla, J., et al. (2016). A biossíntese de carotenóides do tomate é ajustada à progressão real do amadurecimento por um mecanismo dependente da luz. Plant J. 85 (1), 107 e # x2013119. doi: 10.1111 / tpj.13094

Llorente, B., Martinez-Garcia, J., Stange, C., Rodriguez-Concepcion, M. (2017). Cores iluminantes: regulação da biossíntese e acúmulo de carotenóides pela luz. Curr. Opiniões Plant Biol. 37, 49 e # x201355. doi: 10.1016 / j.pbi.2017.03.011

L & # xf3pez-R & # xe1ez, J. A., Charnikhova, T., G & # xf3mez-Rold & # xe1n, V., Matusova, R., Kohlen, W., De Vos, R., et al. (2008). As estrigolactonas do tomate são derivadas de carotenóides e sua biossíntese é promovida pela privação de fosfato. New Phytol. 178 (4), 863 e # x2013874. doi: 10.1111 / j.1469-8137.2008.02406.x

Lu, S., Van Eck, J., Zhou, X., Lopez, A. B., O & # x2019Halloran, D. M., Cosman, K. M., et al. (2006). A couve-flor ou gene codifica um domínio rico em cisteína DnaJ & # x2013 contendo proteína que medeia altos níveis de acúmulo de beta-caroteno. Célula vegetal 18 (12), 3594 e # x20133605. doi: 10.1105 / tpc.106.046417

Lu, S., Zhang, Y., Zhu, K., Yang, W., Ye, J., Chai, L., et al. (2018). O fator de transcrição de citros CsMADS6 modula o metabolismo dos carotenóides por meio da regulação direta dos genes carotenogênicos. J. Plant Physiol. 176 (4), 2657 e # x20132676. doi: 10.1104 / pp.17.01830

Luo, Z., Zhang, J., Li, J., Yang, C., Wang, T., Ouyang, B., et al. (2013). Uma proteína STAY-GREEN SlSGR1 regula o acúmulo de licopeno e & # x3b2-caroteno interagindo diretamente com SlPSY1 durante os processos de amadurecimento no tomate. New Phytol. 198 (2), 442 e # x2013452. doi: 10.1111 / nph.12175

Ma, N., Feng, H., Meng, X., Li, D., Yang, D., Wu, C., et al. (2014). A superexpressão do fator de transcrição SlNAC1 do tomate altera a pigmentação e o amolecimento da fruta. BMC Plant Biol. 14 (1), 351. doi: 10.1186 / s12870-014-0351-y

Maass, D., Arango, J., W & # xfcst, F., Beyer, P., Welsch, R. (2009). Formação de cristais de carotenóide em Arabidopsis e raízes de cenoura causadas por níveis aumentados de proteína de fitoeno sintase. PloS One 4 (7), e6373. doi: 10.1371 / journal.pone.0006373

Manning, K., T & # xf6r, M., Poole, M., Hong, Y., Thompson, A. J., King, G. J., et al. (2006). Uma mutação epigenética de ocorrência natural em um gene que codifica um fator de transcrição SBP-box inibe o amadurecimento do tomate. Nat. Genet. 38 (8), 948. doi: 10.1038 / ng1841

Martel, C., Vrebalov, J., Tafelmeyer, P., Giovannoni, J. J. (2011). O fator de transcrição MADS-box do tomate INIBIDOR DE AMADURECIMENTO interage com promotores envolvidos em vários processos de amadurecimento de uma maneira dependente de NÃO CORRENTE & # x2013. J. Plant Physiol. 157 (3), 1568. doi: 10.1104 / pp.111.181107

Maruyama, K., Urano, K., Yoshiwara, K., Morishita, Y., Sakurai, N., Suzuki, H., et al. (2014). Análise integrada dos efeitos do frio e da desidratação nos metabólitos do arroz, fitohormônios e transcrições gênicas. J. Plant Physiol. 164 (4), 1759 e # x20131771. doi: 10.1104 / pp.113.231720

Meier, S., Tzfadia, O., Vallabhaneni, R., Gehring, C., Wurtzel, E. T. (2011). Uma análise transcricional dos genes da biossíntese de carotenóide, clorofila e isoprenóide plastidial durante o desenvolvimento e respostas de estresse osmótico em Arabidopsis thaliana. BMC Syst. Biol. 5 (1), 77. doi: 10.1186 / 1752-0509-5-77

Meng, C., Yang, D., Ma, X., Zhao, W., Liang, X., Ma, N., et al. (2016). A supressão do fator de transcrição SlNAC1 do tomate retarda o amadurecimento dos frutos. J. Plant Physiol. 193, 88 e # x201396. doi: 10.1016 / j.jplph.2016.01.014

Middleton, E. M., Teramura, A. H. (1993). O papel dos flavonóis glicosídeos e carotenóides na proteção da soja dos danos ultravioleta-B. J. Plant Physiol. 103 (3), 741 e # x2013752. doi: 10.1104 / pp.103.3.741

Mochida, K., Shinozaki, K. (2011). Avanços nas ferramentas ômicas e bioinformáticas para análises de sistemas de funções de plantas. Plant Cell Physiol. 52 (12), 2017 e # x20132038. doi: 10.1093 / pcp / pcr153

Moehs, C. P., Tian, ​​L., Osteryoung, K. W., DellaPenna, D. (2001). Análise da expressão gênica biossintética de carotenóides durante o desenvolvimento da pétala do calêndula. Plant Mol. Biol. 45 (3), 281 e # x2013293. doi: 10.1023 / A: 1006417009203

Moon, J., Zhu, L., Shen, H., Huq, E. (2008). O PIF1 regula direta e indiretamente a biossíntese da clorofila para otimizar o processo de esverdeamento em Arabidopsis. Proc. Natl. Acad. Sci. EUA. 105 (27), 9433. doi: 10.1073 / pnas.0803611105

Mou, W., Li, D., Bu, J., Jiang, Y., Khan, Z. U., Luo, Z., et al. (2016). Análise abrangente dos efeitos do ABA na biossíntese e sinalização do etileno durante o amadurecimento do tomate. PLoS One 11 (4), e0154072. doi: 10.1371 / journal.pone.0154072

M & # xfcller, P., Li, X. P., Niyogi, K. K. (2001). Têmpera não fotoquímica. Uma resposta ao excesso de energia luminosa. J. Plant Physiol. 125 (4), 1558 e # x20131566. doi: 10.1104 / pp.125.4.1558

Mustilli, A. C., Fenzi, F., Ciliento, R., Alfano, F., Bowler, C. (1999). O fenótipo do mutante de alto pigmento 2 do tomate é causado por uma mutação no homólogo do tomate DEETIOLATED1. Célula vegetal 11 (2), 145 e # x2013157. doi: 10.1105 / tpc.11.2.145

Nambara, E., Marion-Poll, A. (2005). Biossíntese e catabolismo do ácido abscísico. Annu. Rev. Plant Biol. 56, 165 & # x2013185. doi: 10.1146 / annurev.arplant.56.032604.144046

Nielsen, J., Keasling, J. D. (2016). Engenharia do metabolismo celular. Célula 164 (6), 1185 e # x20131197. doi: 10.1016 / j.cell.2016.02.004

Nielsen, K. M., Lewis, D. H., Morgan, E. R. (2003). Caracterização de pigmentos carotenóides e sua biossíntese em duas linhas de flores amarelas de Sandersonia aurantiaca (Gancho). Euphytica 130 (1), 25 e # x201334. doi: 10.1023 / A: 1022328828688

Nisar, N., Li, L., Lu, S., Khin, N., Pogson, B. (2015). Metabolismo de carotenóides em plantas. Mol. Plantar 8 (1), 68 e # x201382. doi: 10.1016 / j.molp.2014.12.007

Niyogi, K. K. (1999). Fotoproteção revisitada: abordagens genéticas e moleculares. Annu. Rev. Plant Biol. 50 (1), 333 e # x2013359. doi: 10.1146 / annurev.arplant.50.1.333

Oh, E., Kang, H., Yamaguchi, S., Park, J., Lee, D., Kamiya, Y., et al. (2009). Análise de todo o genoma de genes direcionados pelo FATOR DE INTERAÇÃO DE FITOCROMA 3-LIKE5 durante a germinação da semente em Arabidopsis. Célula vegetal 21 (2), 403 e # x2013419. doi: 10.1105 / tpc.108.064691

Ohmiya, A., Kishimoto, S., Aida, R., Yoshioka, S., Sumitomo, K. (2006). A dioxigenase de clivagem de carotenóides (CmCCD4a) contribui para a formação da cor branca nas pétalas do crisântemo. J. Plant Physiol. 142 (3), 1193 e # x20131201. doi: 10.1104 / pp.106.087130

Ohmiya, A. (2011). Diversidade da composição de carotenóides nas pétalas das flores. Jpn. Agric. Res. Q. 45 (2), 163 & # x2013171. doi: 10.6090 / jarq.45.163

Ohmiya, A. (2013). Controle qualitativo e quantitativo do acúmulo de carotenóides nas pétalas das flores. Sci. Hortic. 163, 10 e # x201319. doi: 10.1016 / j.scienta.2013.06.018

Ohmiya, A., Kato, M., Shimada, T., Nashima, K., Kishimoto, S., Nagata, M. (2019). Base molecular da acumulação de carotenóides em culturas hortícolas. Hortic. J. 88 (2), 135 e # x2013149. doi: 10.2503 / hortj.UTD-R003

Ougham, H. J., Morris, P., Thomas, H. (2005). As cores das folhas de outono como sintomas de reciclagem celular e defesas contra as agressões ambientais. Curr. Principal. Dev. Biol. 66, 136 e # x2013161.

Pecker, I., Chamovitz, D., Linden, H., Sandmann, G., Hirschberg, J. (1992). Um único polipeptídeo que catalisa a conversão de fitoeno em zeta-caroteno é transcricionalmente regulado durante o amadurecimento do tomate. Proc. Natl. Acad. Sci. EUA. 89 (11), 4962 e # x20134966. doi: 10.1073 / pnas.89.11.4962

Pfeiffer, A., Shi, H., Tepperman, J. M., Zhang, Y., Quail, P. H. (2014). Complexidade combinatória em um hub de sinalização centrado na transcrição em Arabidopsis. Mol. Plantar 7 (11), 1598 e # x20131618. doi: 10.1093 / mp / ssu087

Pogson, B. J., Niyogi, K. K., Bjorkman, O., Dellapenna, D. (1998). As composições de xantofila alteradas afetam adversamente o acúmulo de clorofila e a extinção não fotoquímica em Arabidopsis mutantes. Proc. Natl. Acad. Sci. 95 (22), 13324 e # x201313329. doi: 10.1073 / pnas.95.22.13324

Posp & # xed & # x161il, P. (2016). Produção de espécies reativas de oxigênio pelo fotossistema II em resposta ao estresse luminoso e térmico. Frente. Plant Sci. 7, 1950. doi: 10.3389 / fpls.2016.01950

Qin, G., Wang, Y., Cao, B., Wang, W., Tian, ​​S. (2012). Desvendando a rede regulatória do fator de transcrição RIN da caixa MADS no amadurecimento de frutas. Plant J. 70 (2), 243 e # x2013255. doi: 10.1111 / j.1365-313X.2011.04861.x

Rai, A., Saito, K., Yamazaki, M. (2017). Análise ômica integrada do metabolismo especializado em plantas medicinais. Plant J. 90 (4), 764 e # x2013787. doi: 10.1111 / tpj.13485

Rizzini, L., Favory, J. J., Cloix, C., Faggionato, D., O & # x2019Hara, A., Kaiserli, E., et al. (2011). Percepção de UV-B pelo Arabidopsis Proteína UVR8. Ciência 332 (6025), 103 e # x2013106. doi: 10.1126 / science.1200660

Rock, C. D., Zeevaart, J. A. (1991). O mutante aba de Arabidopsis thaliana é prejudicada na biossíntese de epóxi-carotenóide. Proc. Natl. Acad. Sci. EUA. 88 (17), 7496 e # x20137499. doi: 10.1073 / pnas.88.17.7496

Rodr & # xedguez-Leal, D., Lemmon, Z. H., Man, J., Bartlett, M. E., Lippman, Z. B. (2017). Variação de características quantitativas de engenharia para melhoria de cultura por edição de genoma. Célula 171 (2), 470 e # x2013480. doi: 10.1016 / j.cell.2017.08.030

Rodr & # xedguez-Villal & # xf3n, A., Gas, E., Rodr & # xedguez-Concepci & # xf3n, M. (2009).A atividade da fitoeno sintase controla a biossíntese de carotenóides e o fornecimento de seus precursores metabólicos em Arabidopsis mudas. Plant J. 60 (3), 424 e # x2013435. doi: 10.1111 / j.1365-313X.2009.03966.x

Ronen, G., Cohen, M., Zamir, D., Hirschberg, J. (1999). Regulação da biossíntese de carotenóides durante o desenvolvimento do tomate: a expressão do gene para licopeno epsilon-ciclase é regulada negativamente durante o amadurecimento e é elevada no delta mutante. Plant J. 17 (4), 341 e # x2013351. doi: 10.1046 / j.1365-313X.1999.00381.x

Rossel, J. B., Wilson, I. W., Pogson, B. J. (2002). Mudanças globais na expressão gênica em resposta à alta luz em Arabidopsis. J. Plant Physiol. 130 (3), 1109 e # x20131120. doi: 10.1104 / pp.005595

Ruiz-Sola, M., Arbona, V., G & # xf3mez-Cadenas, A., Rodr & # xedguez-Concepci & # xf3n, M., Rodr & # xedguez-Villal & # xf3n, A. (2014). A indução específica da raiz da biossíntese de carotenóides contribui para a produção de ABA após estresse salino em Arabidopsis. PLoS One 9 (3), e90765. doi: 10.1371 / journal.pone.0090765

Ruiz-Sola, M. A., Rodr & # xedguez-Concepci & # xf3n, M. (2012). Biossíntese de carotenóides em Arabidopsis: um caminho colorido. Livro de Arabidopsis 10, e0158. doi: 10.1199 / tab.0158

Sagawa, J. M., Stanley, L. E., LaFountain, A. M., Frank, H. A., Liu, C., Yuan, Y. (2016). Um fator de transcrição R2R3-MYB regula a pigmentação carotenóide em Mimulus lewisii flores. New Phytol. 209 (3), 1049 e # x20131057. doi: 10.1111 / nph.13647

Sakakibara, H. (2006). Citocininas: atividade, biossíntese e translocação. Annu. Rev. Plant Biol. 57, 431 e # x2013449. doi: 10.1146 / annurev.arplant.57.032905.105231

Shen, H., Zhu, L., Castillon, A., Majee, M., Downie, B., Huq, E. (2008). Fosforilação induzida pela luz e degradação do regulador negativo FITOCROMA-FATOR 1 DE INTERAÇÃO de Arabidopsis dependem de suas interações físicas diretas com fitocromos fotoativados. Célula vegetal 20 (6), 1586. doi: 10.1105 / tpc.108.060020

Shi, H., Wang, X., Mo, X., Tang, C., Zhong, S., Deng, X. W. (2015). Arabidopsis O DET1 degrada o HFR1, mas estabiliza o PIF1 para regular com precisão a germinação das sementes. Proc. Natl. Acad. Sci. EUA. 112 (12), 3817. doi: 10.1073 / pnas.1502405112

Shima, Y., Kitagawa, M., Fujisawa, M., Nakano, T., Kato, H., Kimbara, J., et al. (2013). Homólogos de tomate FRUITFULL atuam no amadurecimento de frutas através da formando complexos de fator de transcrição MADS-box com RIN. Plant Mol. Biol. 82 (4-5), 427 e # x2013438. doi: 10.1007 / s11103-013-0071-y

Shin, J., Kim, K., Kang, H., Zulfugarov, I.S., Bae, G., Lee, C., et al. (2009). Os fitocromos promovem as respostas à luz da plântula, inibindo quatro fatores que interagem com o fitocromo de ação negativa. Proc. Natl. Acad. Sci. EUA. 106 (18), 7660. doi: 10.1073 / pnas.0812219106

Shinozaki, K., Yamaguchi-Shinozaki, K. (2007). Redes de genes envolvidas na resposta e tolerância ao estresse por seca. J. Exp. Robô. 58 (2), 221 e # x2013227. doi: 10.1093 / jxb / erl164

Snowden, K. C., Simkin, A. J., Janssen, B. J., Templeton, K. R., Loucas, H. M., Simons, J. L., et al. (2005). A dominância apical diminuída1 /Petunia Hybrida O gene CAROTENOID CLEAVAGE DIOXYGENASE8 afeta a produção de ramos e desempenha um papel na senescência da folha, no crescimento da raiz e no desenvolvimento da flor. Célula vegetal 17 (3), 746. doi: 10.1105 / tpc.104.027714

Stanley, L.E., Ding, B., Sun, W., Mou, F., Hill, C., Chen, S., et al. (2017). Uma proteína de repetição tetratricopeptídica regula a biossíntese de carotenóides e o desenvolvimento de cromoplastos em macacosflores (Mimulus). Biorxiv 171249. doi: 10.1101 / 171249

Su, L., Diretto, G., Purgatto, E., Danoun, S., Zouine, M., Li, Z., et al. (2015). O acúmulo de carotenóides durante o amadurecimento do tomate é modulado pelo balanço de auxina e # x2013etileno. BMC Plant Biol. 15 (1), 114. doi: 10.1186 / s12870-015-0495-4

Sun, T., Yuan, H., Cao, H., Yazdani, M., Tadmor, Y., Li, L. (2018a). Metabolismo de carotenóides em plantas: o papel dos plastídios. Mol. Plantar 11 (1), 58 e # x201374. doi: 10.1016 / j.molp.2017.09.010

Sun, Y., Liang, B., Wang, J., Kai, W., Chen, P., Jiang, L., et al. (2018b). SlPti4 afeta a regulação do amadurecimento dos frutos, germinação de sementes e respostas ao estresse modulando a sinalização ABA em tomate. Plant Cell Physiol. 59 (10), 1956 e # x20131965. doi: 10.1093 / pcp / pcy111

Szyma & # x144ska, R., & # x15alesak, I., Orzechowska, A., Kruk, J. (2017). Respostas fisiológicas e bioquímicas ao estresse elevado de luz e temperatura nas plantas. Environ. Exp. Robô. 139, 165 & # x2013177. doi: 10.1016 / j.envexpbot.2017.05.002

Thompson, A. J., Tor, M., Barry, C. S., Vrebalov, J., Orfila, C., Jarvis, M. C., et al. (1999). Caracterização molecular e genética de um novo mutante pleiotrópico de amadurecimento de tomate. J. Plant Physiol. 120 (2), 383 e # x2013390. doi: 10.1104 / pp.120.2.383

Toledo-Ortiz, G., Huq, E., Rodr & # xedguez-Concepci & # xf3n, M. (2010). Regulação direta da expressão do gene da fitoeno-sintase e da biossíntese de carotenóides por fatores que interagem com o fitocromo. Proc. Natl. Acad. Sci. EUA. 107 (25), 11626. doi: 10.1073 / pnas.0914428107

Toledo-Ortiz, G., Johansson, H., Lee, K. P., Bou-Torrent, J., Stewart, K., Steel, G., et al. (2014). O módulo regulador HY5 & # x2013PIF coordena o controle de luz e temperatura da transcrição do gene fotossintético (regulação da transcrição do gene fotossintético de luz e temperatura). PLoS Genetics 10 (6), e1004416. doi: 10.1371 / journal.pgen.1004416

Ueda, H., Kusaba, M. (2015). A estrigolactona regula a senescência foliar em conjunto com o etileno em Arabidopsis. J. Plant Physiol. 169 (1), 138. doi: 10,1104 / pp.15,00325

Vallabhaneni, R., Bradbury, L. M. T., Wurtzel, E. T. (2010). Família do gene da dioxigenase carotenóide no milho, sorgo e arroz. Arco. Biochem. Biophys. 504 (1), 104 e # x2013111. doi: 10.1016 / j.abb.2010.07.019

Vardhini, B. V., Rao, S. S. R. (2002). Aceleração do amadurecimento de discos de pericarpo de tomateiro por brassinosteróides. Fitoquímica 61 (7), 843 e # x2013847. doi: 10.1016 / S0031-9422 (02) 00223-6

Vrebalov, J., Ruezinsky, D., Padmanabhan, V., White, R., Medrano, D., Drake, R., et al. (2002). Um gene MADS-box necessário para o amadurecimento de frutas no locus inibidor de amadurecimento de tomate (rin). Ciência 296 (5566), 343 & # x2013346. doi: 10.1126 / science.1068181

Vrebalov, J., Pan, I. L., Arroyo, A. J. M., Mcquinn, R., Chung, M., Poole, M., et al. (2009). A expansão e o amadurecimento da fruta carnosa são regulados pelo gene SHATTERPROOF do tomate TAGL1. Célula vegetal 21 (10), 3041 e # x20133062. doi: 10.1105 / tpc.109.066936

Wang, J., Czech, B., Weigel, D. (2009). Fatores de transcrição de SPL regulados por miR156 definem uma via de floração endógena em Arabidopsis thaliana. Célula 138 (4), 738 e # x2013749. doi: 10.1016 / j.cell.2009.06.014

Wang, W., Liu, G., Niu, H., Timko, M. P., Zhang, H. (2014). A proteína F-box COI1 funciona a montante de MYB305 para regular o metabolismo primário de carboidratos no tabaco (Nicotiana tabacum L. cv. TN90). J. Exp. Robô. 65 (8), 2147 e # x20132160. doi: 10.1093 / jxb / eru084

Wang, X., Yamagishi, M. (2019). Os mecanismos que suprimem o acúmulo de carotenóides nas flores diferem dependendo dos grupos híbridos de lírios (Lilium spp.). Sci. Hortic. 243, 159 & # x2013168. doi: 10.1016 / j.scienta.2018.08.025

Wei, S., Yu, B., Gruber, M. Y., Khachatourians, G. G., Hegedus, D. D., Hannoufa, A. (2010). Níveis aprimorados de carotenóides na semente e ramificação em transgênicos Brassica napus expressando o Arabidopsis gene miR156b. J. Agric. Food Chem. 58 (17), 9572 & # x20139578. doi: 10.1021 / jf102635f

Welsch, R., Medina, J., Giuliano, G., Beyer, P., von Lintig, J. (2003). Caracterização estrutural e funcional do promotor da fitoeno sintase de Arabidopsis thaliana. Planta 216 (3), 523 e # x2013534. doi: 10.1007 / s00425-002-0885-3

Welsch, R., Maass, D., Voegel, T., Dellapenna, D., Beyer, P. (2007). Fator de transcrição RAP2.2 e seu parceiro de interação SINAT2: elementos estáveis ​​na carotenogênese de Arabidopsis sai. J. Plant Physiol. 145 (3), 1073 e # x20131085. doi: 10.1104 / pp.107.104828

Welsch, R., Wust, F., Bar, C., Al-Babili, S., Beyer, P. (2008). Uma terceira fitoeno sintase é dedicada à formação de ácido abscísico induzida por estresse abiótico no arroz e define a diversificação funcional dos genes da fitoeno sintase. J. Plant Physiol. 147 (1), 367 e # x2013380. doi: 10.1104 / pp.108.117028

Weng, L., Zhao, F., Li, R., Xu, C., Chen, K., Xiao, H. (2015). O fator de transcrição de dedo de zinco SlZFP2 regula negativamente a biossíntese de ácido abscísico e o amadurecimento de frutos em tomate. J. Plant Physiol. 167 (3), 931 e # x2013949. doi: 10.1104 / pp.114.255174

Wu, W., Liu, L. L., Yan, Y. C. (2019). TERF1 regula a expressão do gene nuclear por meio de sinais retrógrados do cloroplasto. Russ. J. Plant Physiol., 66 (1), 22 e # x201328. doi: 10.1134 / S1021443719010205

Xie, Q., Hu, Z., Zhu, Z., Dong, T., Zhao, Z., Cui, B., et al. (2014). A superexpressão de um novo gene MADS-box SlFYFL retarda a senescência, amadurecimento da fruta e abscisão em tomate. Sci. Rep. 4, 4367. doi: 10.1038 / srep04367

Xiong, C., Luo, D., Lin, A., Zhang, C., Shan, L., He, P., et al. (2019). Uma proteína SlBBX20 do tomate B-box modula a biossíntese de carotenóides ativando diretamente o FITOENO SINTASE 1 e é direcionada para o proteassoma 26S e a degradação mediada pelo # x2013. New Phytol. 221 (1), 279 e # x2013294. doi: 10.1111 / nph.15373

Yamagishi, M., Kishimoto, S., Nakayama, M. (2010). Composição de carotenóides e mudanças na expressão de genes biossintéticos de carotenóides em tépalas de lírio híbrido asiático. Raça de planta. 129 (1), 100 e # x2013107. doi: 10.1111 / j.1439-0523.2009.01656.x

Yamamizo, C., Kishimoto, S., Ohmiya, A. (2010). Composição de carotenóides e expressão de genes carotenogênicos durante Ipomoea desenvolvimento de pétalas. J. Exp. Robô. 61 (3), 709 e # x2013719. doi: 10.1093 / jxb / erp335

Yang, J. C., Zhang, J. H., Wang, Z. Q., Zhu, Q. S., Liu, L. J. (2003). Envolvimento do ácido abscísico e citocininas na senescência e remobilização das reservas de carbono em trigo submetido a estresse hídrico durante o enchimento de grãos. Plant Cell Environ. 26 (10), 1621 e # x20131631. doi: 10.1046 / j.1365-3040.2003.01081.x

Yuan, H., Zhang, J., Nageswaran, D., Li, L. (2015). Metabolismo e regulação de carotenóides em culturas hortícolas. Hortic Res. 2, 15036. doi: 10.1038 / hortres.2015.36

Zhang, B., Liu, C., Wang, Y., Yao, X., Wang, F., Wu, J., et al. (2015). A interrupção de um gene CAROTENOID CLEAVAGE DIOXYGENASE 4 converte a cor da flor de branco para amarelo em Brassica espécies. New Phytol. 206 (4), 1513 e # x20131526. doi: 10.1111 / nph.13335

Zhang, J., Hu, Z., Yao, Q., Guo, X., Nguyen, V., Li, F., et al. (2018a). Uma proteína MADS-box de tomate, SlCMB1, regula a biossíntese de etileno e o acúmulo de carotenóides durante o amadurecimento dos frutos. Sci. Rep. 8 (1), 3413. doi: 10.1038 / s41598-018-21672-8

Zhang, M., Yuan, B., Leng, P. (2009). O papel do ABA no desencadeamento da biossíntese de etileno e no amadurecimento do tomate. J. Exp. Robô. 60 (6), 1579 e # x20131588. doi: 10.1093 / jxb / erp026

Zhang, Y., Li, Z., Tu, Y., Cheng, W., Yang, Y. (2018b). Tomate (Solanum lycopersicum) SlIPT4, que codifica uma isopenteniltransferase, está envolvida na senescência da folha e na biossíntese do licopeno durante o amadurecimento dos frutos. BMC Plant Biol. 18 (1), 107. doi: 10.1186 / s12870-018-1327-0

Zhong, S., Fei, Z., Yun-Ru, C., Zheng, Y., Huang, M., Vrebalov, J., et al. (2013). Metilomas de resolução de base única do desenvolvimento do fruto do tomate revelam modificações no epigenoma associadas ao amadurecimento. Nat. Biotechnol. 31 (2), 154. doi: 10.1038 / nbt.2462

Zhou, X., Welsch, R., Yang, Y., Alvarez, D., Riediger, M., Yuan, H., et al. (2015). Arabidopsis As proteínas OR são os principais reguladores pós-transcricionais da fitoeno sintase no controle da biossíntese de carotenóides. Proc. Natl. Acad. Sci. EUA. 112 (11), 3558 e # x20133563. doi: 10.1073 / pnas.1420831112

Zhou, D., Shen, Y., Zhou, P., Fatima, M., Lin, J., Yue, J., et al. (2019). O CpbHLH1 / 2 do mamão regula genes relacionados à biossíntese de carotenóides durante o amadurecimento do mamoeiro. Hortic Res. 6 (1), 80. doi: 10.1038 / s41438-019-0162-2

Zhu, F., Luo, T., Liu, C., Wang, Y., Yang, H., Yang, W., et al. (2017a). Um fator de transcrição R2R3-MYB reprime a transformação dos carotenóides do ramo & # x3b1 e & # x3b2 regulando negativamente a expressão de CrBCH2 e CrNCED5 em flavedo de reticulado de citros. New Phytol. 216 (1), 178 & # x2013192. doi: 10.1111 / nph.14684

Zhu, J. (2002). Transdução de sinal de estresse de sal e seca em plantas. Annu. Rev. Plant Biol. 53 (1), 247 e # x2013273. doi: 10.1146 / annurev.arplant.53.091401.143329

Zhu, L., Bu, Q., Xu, X., Paik, I., Huang, X., Hoecker, U., et al. (2015). CUL4 forma uma ligase E3 com COP1 e SPA para promover a degradação induzida pela luz de PIF1. Nat. Comum. 6, 7245. doi: 10.1038 / ncomms8245

Zhu, M., Chen, G., Zhou, S., Tu, Y., Wang, Y., Dong, T., et al. (2014). Um novo fator de transcrição NAC (NAM / ATAF1 / 2 / CUC2) do tomate, SlNAC4, funciona como um regulador positivo do amadurecimento da fruta e do acúmulo de carotenóides. Plant Cell Physiol. 55 (1), 119 e # x2013135. doi: 10.1093 / pcp / pct162

Zhu, Q., Zeng, D., Yu, S., Cui, C., Li, J., Li, H., et al. (2018). De Golden Rice a aSTARice: bioengenharia da biossíntese de astaxantina no endosperma do arroz. Mol. Plantar 11 (12), 1440 e # x20131448. doi: 10.1016 / j.molp.2018.09.007

Zhu, Z., Chen, G., Guo, X., Yin, W., Yu, X., Hu, J., et al. (2017b). A superexpressão de SlPRE2, um fator de transcrição atípico do bHLH, afeta a morfologia da planta e o acúmulo de pigmento no fruto do tomate. Sci. Rep. 7 (1), 5786. doi: 10.1038 / s41598-017-04092-y

Zhu, Z., Li, G., Yan, C., Liu, L., Zhang, Q., Han, Z., et al. (2019). DRL1, que codifica um fator de transcrição NAC, está envolvido na senescência da folha na videira. Int. J. Mole. Sci. 20 (11), 2678. doi: 10.3390 / ijms20112678

Palavras-chave: biossíntese de carotenóides, regulação da transcrição, tecido fotossintético, flores, frutos, sementes, raízes

Citação: Stanley L e Yuan Y-W (2019) Regulação da transcrição da biossíntese de carotenóides em plantas: tantos reguladores, tão pouco consenso. Frente. Plant Sci. 10: 1017. doi: 10.3389 / fpls.2019.01017

Recebido: 17 de maio de 2019 Aceito: 22 de julho de 2019
Publicado: 09 de agosto de 2019.

Manuel Rodriguez-Concepcion, Centro de Pesquisa em Genômica Agrícola (CRAG), Espanha

Gianfranco Diretto, Energia e Desenvolvimento Econômico Sustentável (ENEA), Itália
Gabriela Toledo-Ortiz, Lancaster University, Reino Unido

Copyright & # xa9 2019 Stanley e Yuan. Este é um artigo de acesso aberto distribuído sob os termos da Creative Commons Attribution License (CC BY). O uso, distribuição ou reprodução em outros fóruns é permitido, desde que o (s) autor (es) original (is) e o (s) proprietário (s) dos direitos autorais sejam creditados e que a publicação original nesta revista seja citada, de acordo com a prática acadêmica aceita. Não é permitida a utilização, distribuição ou reprodução em desacordo com estes termos.


Assista o vídeo: The Real Reason Leaves Change Color In the Fall (Janeiro 2022).